data_1WVD # _entry.id 1WVD # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.386 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 1WVD pdb_00001wvd 10.2210/pdb1wvd/pdb NDB AR0055 ? ? RCSB RCSB024045 ? ? WWPDB D_1000024045 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2004-12-21 2 'Structure model' 1 1 2008-04-30 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2024-02-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_struct_conn_angle 5 4 'Structure model' struct_conn 6 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_comp_id' 4 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id' 5 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_atom_id' 6 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_comp_id' 7 4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_seq_id' 8 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_comp_id' 9 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id' 10 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_atom_id' 11 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_comp_id' 12 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_seq_id' 13 4 'Structure model' '_struct_conn.pdbx_dist_value' 14 4 'Structure model' '_struct_conn.ptnr1_auth_asym_id' 15 4 'Structure model' '_struct_conn.ptnr1_auth_comp_id' 16 4 'Structure model' '_struct_conn.ptnr1_auth_seq_id' 17 4 'Structure model' '_struct_conn.ptnr1_label_asym_id' 18 4 'Structure model' '_struct_conn.ptnr1_label_atom_id' 19 4 'Structure model' '_struct_conn.ptnr1_label_comp_id' 20 4 'Structure model' '_struct_conn.ptnr1_label_seq_id' 21 4 'Structure model' '_struct_conn.ptnr2_auth_asym_id' 22 4 'Structure model' '_struct_conn.ptnr2_auth_comp_id' 23 4 'Structure model' '_struct_conn.ptnr2_auth_seq_id' 24 4 'Structure model' '_struct_conn.ptnr2_label_asym_id' 25 4 'Structure model' '_struct_conn.ptnr2_label_atom_id' 26 4 'Structure model' '_struct_conn.ptnr2_label_comp_id' 27 4 'Structure model' '_struct_conn.ptnr2_label_seq_id' 28 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 29 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 30 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 1WVD _pdbx_database_status.recvd_initial_deposition_date 2004-12-15 _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1Y95 'HIV-1 Dis(Mal) Duplex Pb-Soaked' unspecified PDB 1Y6T 'HIV-1 Dis(Mal) Duplex Co Hexamine-Soaked' unspecified PDB 1Y6S 'HIV-1 Dis(Mal) Duplex BaCl2-Soaked' unspecified PDB 1Y73 'HIV-1 Dis(Mal) Duplex PtCl4-Soaked' unspecified PDB 1Y90 'HIV-1 Dis(Mal) Duplex MnCl2-Soaked' unspecified PDB 462D 'HIV-1 Dis(Mal) Duplex Mg-Native' unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Ennifar, E.' 1 'Walter, P.' 2 'Dumas, P.' 3 # _citation.id primary _citation.title 'A crystallographic study of the binding of 13 metal ions to two related RNA duplexes' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 31 _citation.page_first 2671 _citation.page_last 2682 _citation.year 2003 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 12736317 _citation.pdbx_database_id_DOI 10.1093/nar/gkg350 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Ennifar, E.' 1 ? primary 'Walter, P.' 2 ? primary 'Dumas, P.' 3 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn "5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*GP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP*AP*G)-3'" 7402.472 2 ? ? ? 'HIV-1 DIS RNA' 2 non-polymer syn 'COBALT (II) ION' 58.933 8 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code CUUGCUGAGGUGCACACAGCAAG _entity_poly.pdbx_seq_one_letter_code_can CUUGCUGAGGUGCACACAGCAAG _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'COBALT (II) ION' _pdbx_entity_nonpoly.comp_id CO # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 U n 1 3 U n 1 4 G n 1 5 C n 1 6 U n 1 7 G n 1 8 A n 1 9 G n 1 10 G n 1 11 U n 1 12 G n 1 13 C n 1 14 A n 1 15 C n 1 16 A n 1 17 C n 1 18 A n 1 19 G n 1 20 C n 1 21 A n 1 22 A n 1 23 G n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CO non-polymer . 'COBALT (II) ION' ? 'Co 2' 58.933 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 1 1 C CYT A . n A 1 2 U 2 2 2 U URI A . n A 1 3 U 3 3 3 U URI A . n A 1 4 G 4 4 4 G GUA A . n A 1 5 C 5 5 5 C CYT A . n A 1 6 U 6 6 6 U URI A . n A 1 7 G 7 7 7 G GUA A . n A 1 8 A 8 8 8 A ADE A . n A 1 9 G 9 9 9 G GUA A . n A 1 10 G 10 10 10 G GUA A . n A 1 11 U 11 11 11 U URI A . n A 1 12 G 12 12 12 G GUA A . n A 1 13 C 13 13 13 C CYT A . n A 1 14 A 14 14 14 A ADE A . n A 1 15 C 15 15 15 C CYT A . n A 1 16 A 16 16 16 A ADE A . n A 1 17 C 17 17 17 C CYT A . n A 1 18 A 18 18 18 A ADE A . n A 1 19 G 19 19 19 G GUA A . n A 1 20 C 20 20 20 C CYT A . n A 1 21 A 21 21 21 A ADE A . n A 1 22 A 22 22 22 A ADE A . n A 1 23 G 23 23 23 G GUA A . n B 1 1 C 1 1 1 C CYT B . n B 1 2 U 2 2 2 U URI B . n B 1 3 U 3 3 3 U URI B . n B 1 4 G 4 4 4 G GUA B . n B 1 5 C 5 5 5 C CYT B . n B 1 6 U 6 6 6 U URI B . n B 1 7 G 7 7 7 G GUA B . n B 1 8 A 8 8 8 A ADE B . n B 1 9 G 9 9 9 G GUA B . n B 1 10 G 10 10 10 G GUA B . n B 1 11 U 11 11 11 U URI B . n B 1 12 G 12 12 12 G GUA B . n B 1 13 C 13 13 13 C CYT B . n B 1 14 A 14 14 14 A ADE B . n B 1 15 C 15 15 15 C CYT B . n B 1 16 A 16 16 16 A ADE B . n B 1 17 C 17 17 17 C CYT B . n B 1 18 A 18 18 18 A ADE B . n B 1 19 G 19 19 19 G GUA B . n B 1 20 C 20 20 20 C CYT B . n B 1 21 A 21 21 21 A ADE B . n B 1 22 A 22 22 22 A ADE B . n B 1 23 G 23 23 23 G GUA B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 CO 1 501 501 CO CO2 A . D 2 CO 1 503 503 CO CO2 A . E 2 CO 1 507 507 CO CO2 A . F 2 CO 1 508 508 CO CO2 A . G 2 CO 1 502 502 CO CO2 B . H 2 CO 1 504 504 CO CO2 B . I 2 CO 1 505 505 CO CO2 B . J 2 CO 1 506 506 CO CO2 B . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal CNS refinement 1.1 ? 1 DENZO 'data reduction' . ? 2 SCALEPACK 'data scaling' . ? 3 CNS phasing . ? 4 # _cell.entry_id 1WVD _cell.length_a 59.168 _cell.length_b 59.168 _cell.length_c 63.996 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 12 _cell.pdbx_unique_axis ? # _symmetry.entry_id 1WVD _symmetry.space_group_name_H-M 'P 31 2 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 152 _symmetry.space_group_name_Hall ? # _exptl.entry_id 1WVD _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.18 _exptl_crystal.density_percent_sol 50 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.temp 310 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_details 'MPD, spermine, KCl, MgCl2, Na Cacodylate, pH 7.0, VAPOR DIFFUSION, SITTING DROP, temperature 310K' _exptl_crystal_grow.pdbx_pH_range . # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.details 1 1 1 MPD ? ? ? 1 2 1 spermine ? ? ? 1 3 1 KCl ? ? ? 1 4 1 MgCl2 ? ? ? 1 5 1 'Na Cacodylate' ? ? ? 1 6 1 H2O ? ? ? 1 7 2 MPD ? ? ? 1 8 2 KCl ? ? ? 1 9 2 MgCl2 ? ? ? 1 10 2 'Na Cacodylate' ? ? ? # _diffrn.id 1 _diffrn.ambient_temp 120 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector 'IMAGE PLATE' _diffrn_detector.type MACSCIENCE _diffrn_detector.pdbx_collection_date 2000-07-10 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator mirror _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.54 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source 'ROTATING ANODE' _diffrn_source.type ENRAF-NONIUS _diffrn_source.pdbx_synchrotron_site ? _diffrn_source.pdbx_synchrotron_beamline ? _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 1.54 # _reflns.entry_id 1WVD _reflns.observed_criterion_sigma_I 0 _reflns.observed_criterion_sigma_F 0 _reflns.d_resolution_low 15 _reflns.d_resolution_high 2.93 _reflns.number_obs 5330 _reflns.number_all ? _reflns.percent_possible_obs 99.1 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value 0.066 _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate 42.9 _reflns.pdbx_redundancy ? _reflns.R_free_details ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _reflns_shell.d_res_high 2.93 _reflns_shell.d_res_low 3.06 _reflns_shell.percent_possible_all 94.1 _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value 0.139 _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.pdbx_redundancy ? _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all 625 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_diffrn_id ? _reflns_shell.pdbx_ordinal 1 # _refine.entry_id 1WVD _refine.ls_number_reflns_obs 4874 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.0 _refine.pdbx_data_cutoff_high_absF 673479.45 _refine.pdbx_data_cutoff_low_absF 0.000000 _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 8.00 _refine.ls_d_res_high 2.93 _refine.ls_percent_reflns_obs 95.1 _refine.ls_R_factor_obs 0.208 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.208 _refine.ls_R_factor_R_free 0.239 _refine.ls_R_factor_R_free_error 0.012 _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 8.2 _refine.ls_number_reflns_R_free 400 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean 49.8 _refine.aniso_B[1][1] -3.61 _refine.aniso_B[2][2] -3.61 _refine.aniso_B[3][3] 7.21 _refine.aniso_B[1][2] 3.27 _refine.aniso_B[1][3] 0.00 _refine.aniso_B[2][3] 0.00 _refine.solvent_model_details 'FLAT MODEL' _refine.solvent_model_param_ksol 0.288467 _refine.solvent_model_param_bsol 37.4696 _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct 'FOURIER SYNTHESIS' _refine.pdbx_isotropic_thermal_model RESTRAINED _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.overall_SU_B ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_analyze.entry_id 1WVD _refine_analyze.Luzzati_coordinate_error_obs 0.33 _refine_analyze.Luzzati_sigma_a_obs 0.44 _refine_analyze.Luzzati_d_res_low_obs 5.00 _refine_analyze.Luzzati_coordinate_error_free 0.41 _refine_analyze.Luzzati_sigma_a_free 0.30 _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1048 _refine_hist.pdbx_number_atoms_ligand 8 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1056 _refine_hist.d_res_high 2.93 _refine_hist.d_res_low 8.00 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function c_bond_d 0.008 ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg 1.2 ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d 13.1 ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d 1.58 ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_mcbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_mcangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_scbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? c_scangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_total_number_of_bins_used 6 _refine_ls_shell.d_res_high 2.93 _refine_ls_shell.d_res_low 3.10 _refine_ls_shell.number_reflns_R_work 701 _refine_ls_shell.R_factor_R_work 0.301 _refine_ls_shell.percent_reflns_obs 86.0 _refine_ls_shell.R_factor_R_free 0.316 _refine_ls_shell.R_factor_R_free_error 0.049 _refine_ls_shell.percent_reflns_R_free 5.7 _refine_ls_shell.number_reflns_R_free 42 _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? # loop_ _pdbx_xplor_file.serial_no _pdbx_xplor_file.param_file _pdbx_xplor_file.topol_file _pdbx_xplor_file.pdbx_refine_id 1 WATER_REP.PARAM WATER.TOP 'X-RAY DIFFRACTION' 2 DNA-RNA.PARAM DNA-RNA.TOP 'X-RAY DIFFRACTION' 3 ION.PARAM ION.TOP 'X-RAY DIFFRACTION' 4 BRU_REP.PARAM ? 'X-RAY DIFFRACTION' # _database_PDB_matrix.entry_id 1WVD _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 1WVD _struct.title 'HIV-1 Dis(Mal) Duplex CoCl2-Soaked' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 1WVD _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'HIV-1, RNA, bulge, metal ions' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 2 ? I N N 2 ? J N N 2 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 1WVD _struct_ref.pdbx_db_accession 1WVD _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 1WVD A 1 ? 23 ? 1WVD 1 ? 23 ? 1 23 2 1 1WVD B 1 ? 23 ? 1WVD 1 ? 23 ? 1 23 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.pdbx_parent_biol_id ? _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A U 3 O4 ? ? ? 1_555 D CO . CO ? ? A U 3 A CO 503 1_555 ? ? ? ? ? ? ? 2.574 ? ? metalc2 metalc ? ? A G 4 O6 ? ? ? 1_555 D CO . CO ? ? A G 4 A CO 503 1_555 ? ? ? ? ? ? ? 2.666 ? ? metalc3 metalc ? ? A A 8 OP2 ? ? ? 1_555 E CO . CO ? ? A A 8 A CO 507 1_555 ? ? ? ? ? ? ? 2.348 ? ? metalc4 metalc ? ? A G 9 N7 ? ? ? 1_555 E CO . CO ? ? A G 9 A CO 507 1_555 ? ? ? ? ? ? ? 2.433 ? ? metalc5 metalc ? ? A G 9 OP1 ? ? ? 1_555 G CO . CO ? ? A G 9 B CO 502 1_555 ? ? ? ? ? ? ? 2.414 ? ? metalc6 metalc ? ? B A 8 OP2 A ? ? 1_555 J CO . CO ? ? B A 8 B CO 506 1_555 ? ? ? ? ? ? ? 2.340 ? ? metalc7 metalc ? ? B A 8 OP2 B ? ? 1_555 J CO . CO ? ? B A 8 B CO 506 1_555 ? ? ? ? ? ? ? 2.163 ? ? metalc8 metalc ? ? B G 9 OP1 B ? ? 1_555 G CO . CO ? ? B G 9 B CO 502 1_555 ? ? ? ? ? ? ? 2.312 ? ? metalc9 metalc ? ? B G 9 N7 A ? ? 1_555 J CO . CO ? ? B G 9 B CO 506 1_555 ? ? ? ? ? ? ? 2.542 ? ? metalc10 metalc ? ? B G 9 N7 B ? ? 1_555 J CO . CO ? ? B G 9 B CO 506 1_555 ? ? ? ? ? ? ? 2.108 ? ? hydrog1 hydrog ? ? A C 1 N3 ? ? ? 1_555 B G 23 N1 ? ? A C 1 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 1 N4 ? ? ? 1_555 B G 23 O6 ? ? A C 1 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 1 O2 ? ? ? 1_555 B G 23 N2 ? ? A C 1 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 2 N3 ? ? ? 1_555 B A 22 N1 ? ? A U 2 B A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A U 2 O4 ? ? ? 1_555 B A 22 N6 ? ? A U 2 B A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 3 N3 ? ? ? 1_555 B A 21 N1 ? ? A U 3 B A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 O4 ? ? ? 1_555 B A 21 N6 ? ? A U 3 B A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 4 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 4 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 4 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 B G 19 N1 ? ? A C 5 B G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 B G 19 O6 ? ? A C 5 B G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 B G 19 N2 ? ? A C 5 B G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 N3 ? ? ? 1_555 B A 18 N1 ? ? A U 6 B A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 O4 ? ? ? 1_555 B A 18 N6 ? ? A U 6 B A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 7 N1 ? ? ? 1_555 B C 17 N3 ? ? A G 7 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 7 N2 ? ? ? 1_555 B C 17 O2 ? ? A G 7 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 7 O6 ? ? ? 1_555 B C 17 N4 ? ? A G 7 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 B A 16 N1 ? ? A G 9 B A 16 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog20 hydrog ? ? A G 9 O6 ? ? ? 1_555 B A 16 N6 ? ? A G 9 B A 16 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 B C 17 O2 ? ? A G 9 B C 17 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog22 hydrog ? ? A G 10 N1 ? ? ? 1_555 B C 15 N3 ? ? A G 10 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N2 ? ? ? 1_555 B C 15 O2 ? ? A G 10 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 O6 ? ? ? 1_555 B C 15 N4 ? ? A G 10 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 11 N3 ? ? ? 1_555 B A 14 N1 ? ? A U 11 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 11 O4 ? ? ? 1_555 B A 14 N6 ? ? A U 11 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 13 N3 ? ? A G 12 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 13 O2 ? ? A G 12 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 13 N4 ? ? A G 12 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 13 B G 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 13 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 13 B G 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 13 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 13 B G 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 14 N1 ? ? ? 1_555 B U 11 N3 ? ? A A 14 B U 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A A 14 N6 ? ? ? 1_555 B U 11 O4 ? ? A A 14 B U 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 N3 ? ? ? 1_555 B G 10 N1 ? ? A C 15 B G 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 15 N4 ? ? ? 1_555 B G 10 O6 ? ? A C 15 B G 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 15 O2 ? ? ? 1_555 B G 10 N2 ? ? A C 15 B G 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 16 N1 ? ? ? 1_555 B G 9 N1 A ? A A 16 B G 9 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog39 hydrog ? ? A A 16 N6 ? ? ? 1_555 B G 9 O6 A ? A A 16 B G 9 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog40 hydrog ? ? A C 17 N3 ? ? ? 1_555 B G 7 N1 A ? A C 17 B G 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 17 N4 ? ? ? 1_555 B G 7 O6 A ? A C 17 B G 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 17 O2 ? ? ? 1_555 B G 7 N2 A ? A C 17 B G 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 18 N1 ? ? ? 1_555 B U 6 N3 ? ? A A 18 B U 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 18 N6 ? ? ? 1_555 B U 6 O4 ? ? A A 18 B U 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 5 N3 ? ? A G 19 B C 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 5 O2 ? ? A G 19 B C 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 5 N4 ? ? A G 19 B C 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 20 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 20 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 20 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 21 N1 ? ? ? 1_555 B U 3 N3 ? ? A A 21 B U 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 21 N6 ? ? ? 1_555 B U 3 O4 ? ? A A 21 B U 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A A 22 N1 ? ? ? 1_555 B U 2 N3 ? ? A A 22 B U 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A A 22 N6 ? ? ? 1_555 B U 2 O4 ? ? A A 22 B U 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 23 N1 ? ? ? 1_555 B C 1 N3 ? ? A G 23 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 23 N2 ? ? ? 1_555 B C 1 O2 ? ? A G 23 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 23 O6 ? ? ? 1_555 B C 1 N4 ? ? A G 23 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O4 ? A U 3 ? A U 3 ? 1_555 CO ? D CO . ? A CO 503 ? 1_555 O6 ? A G 4 ? A G 4 ? 1_555 78.0 ? 2 OP2 ? A A 8 ? A A 8 ? 1_555 CO ? E CO . ? A CO 507 ? 1_555 N7 ? A G 9 ? A G 9 ? 1_555 93.3 ? 3 OP1 ? A G 9 ? A G 9 ? 1_555 CO ? G CO . ? B CO 502 ? 1_555 OP1 B B G 9 ? B G 9 ? 1_555 157.1 ? 4 OP2 A B A 8 ? B A 8 ? 1_555 CO ? J CO . ? B CO 506 ? 1_555 OP2 B B A 8 ? B A 8 ? 1_555 19.3 ? 5 OP2 A B A 8 ? B A 8 ? 1_555 CO ? J CO . ? B CO 506 ? 1_555 N7 A B G 9 ? B G 9 ? 1_555 75.6 ? 6 OP2 B B A 8 ? B A 8 ? 1_555 CO ? J CO . ? B CO 506 ? 1_555 N7 A B G 9 ? B G 9 ? 1_555 94.7 ? 7 OP2 A B A 8 ? B A 8 ? 1_555 CO ? J CO . ? B CO 506 ? 1_555 N7 B B G 9 ? B G 9 ? 1_555 55.6 ? 8 OP2 B B A 8 ? B A 8 ? 1_555 CO ? J CO . ? B CO 506 ? 1_555 N7 B B G 9 ? B G 9 ? 1_555 74.8 ? 9 N7 A B G 9 ? B G 9 ? 1_555 CO ? J CO . ? B CO 506 ? 1_555 N7 B B G 9 ? B G 9 ? 1_555 20.2 ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software B CO 502 ? 2 'BINDING SITE FOR RESIDUE CO B 502' AC2 Software A CO 503 ? 2 'BINDING SITE FOR RESIDUE CO A 503' AC3 Software B CO 505 ? 1 'BINDING SITE FOR RESIDUE CO B 505' AC4 Software B CO 506 ? 2 'BINDING SITE FOR RESIDUE CO B 506' AC5 Software A CO 507 ? 2 'BINDING SITE FOR RESIDUE CO A 507' AC6 Software A CO 508 ? 3 'BINDING SITE FOR RESIDUE CO A 508' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 2 G A 9 ? G A 9 . ? 1_555 ? 2 AC1 2 G B 9 ? G B 9 . ? 1_555 ? 3 AC2 2 U A 3 ? U A 3 . ? 1_555 ? 4 AC2 2 G A 4 ? G A 4 . ? 1_555 ? 5 AC3 1 G B 7 ? G B 7 . ? 1_555 ? 6 AC4 2 A B 8 ? A B 8 . ? 1_555 ? 7 AC4 2 G B 9 ? G B 9 . ? 1_555 ? 8 AC5 2 A A 8 ? A A 8 . ? 1_555 ? 9 AC5 2 G A 9 ? G A 9 . ? 1_555 ? 10 AC6 3 G A 12 ? G A 12 . ? 1_555 ? 11 AC6 3 G B 12 ? G B 12 . ? 1_555 ? 12 AC6 3 C B 13 ? C B 13 . ? 1_555 ? # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 U A 3 ? ? 0.093 'SIDE CHAIN' 2 1 C A 15 ? ? 0.062 'SIDE CHAIN' # loop_ _pdbx_validate_polymer_linkage.id _pdbx_validate_polymer_linkage.PDB_model_num _pdbx_validate_polymer_linkage.auth_atom_id_1 _pdbx_validate_polymer_linkage.auth_asym_id_1 _pdbx_validate_polymer_linkage.auth_comp_id_1 _pdbx_validate_polymer_linkage.auth_seq_id_1 _pdbx_validate_polymer_linkage.PDB_ins_code_1 _pdbx_validate_polymer_linkage.label_alt_id_1 _pdbx_validate_polymer_linkage.auth_atom_id_2 _pdbx_validate_polymer_linkage.auth_asym_id_2 _pdbx_validate_polymer_linkage.auth_comp_id_2 _pdbx_validate_polymer_linkage.auth_seq_id_2 _pdbx_validate_polymer_linkage.PDB_ins_code_2 _pdbx_validate_polymer_linkage.label_alt_id_2 _pdbx_validate_polymer_linkage.dist 1 1 "O3'" B U 6 ? ? P B G 7 ? B 2.50 2 1 "O3'" B G 9 ? A P B G 10 ? ? 2.40 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CO CO CO N N 73 G OP3 O N N 74 G P P N N 75 G OP1 O N N 76 G OP2 O N N 77 G "O5'" O N N 78 G "C5'" C N N 79 G "C4'" C N R 80 G "O4'" O N N 81 G "C3'" C N S 82 G "O3'" O N N 83 G "C2'" C N R 84 G "O2'" O N N 85 G "C1'" C N R 86 G N9 N Y N 87 G C8 C Y N 88 G N7 N Y N 89 G C5 C Y N 90 G C6 C N N 91 G O6 O N N 92 G N1 N N N 93 G C2 C N N 94 G N2 N N N 95 G N3 N N N 96 G C4 C Y N 97 G HOP3 H N N 98 G HOP2 H N N 99 G "H5'" H N N 100 G "H5''" H N N 101 G "H4'" H N N 102 G "H3'" H N N 103 G "HO3'" H N N 104 G "H2'" H N N 105 G "HO2'" H N N 106 G "H1'" H N N 107 G H8 H N N 108 G H1 H N N 109 G H21 H N N 110 G H22 H N N 111 U OP3 O N N 112 U P P N N 113 U OP1 O N N 114 U OP2 O N N 115 U "O5'" O N N 116 U "C5'" C N N 117 U "C4'" C N R 118 U "O4'" O N N 119 U "C3'" C N S 120 U "O3'" O N N 121 U "C2'" C N R 122 U "O2'" O N N 123 U "C1'" C N R 124 U N1 N N N 125 U C2 C N N 126 U O2 O N N 127 U N3 N N N 128 U C4 C N N 129 U O4 O N N 130 U C5 C N N 131 U C6 C N N 132 U HOP3 H N N 133 U HOP2 H N N 134 U "H5'" H N N 135 U "H5''" H N N 136 U "H4'" H N N 137 U "H3'" H N N 138 U "HO3'" H N N 139 U "H2'" H N N 140 U "HO2'" H N N 141 U "H1'" H N N 142 U H3 H N N 143 U H5 H N N 144 U H6 H N N 145 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 1WVD 'double helix' 1WVD 'a-form double helix' 1WVD 'bulge loop' 1WVD 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 1 1_555 B G 23 1_555 0.243 -0.303 -0.033 16.447 -22.882 -3.856 1 A_C1:G23_B A 1 ? B 23 ? 19 1 1 A U 2 1_555 B A 22 1_555 -0.183 -0.373 -0.091 3.155 -15.602 6.442 2 A_U2:A22_B A 2 ? B 22 ? 20 1 1 A U 3 1_555 B A 21 1_555 0.060 -0.274 0.063 5.978 -15.689 9.780 3 A_U3:A21_B A 3 ? B 21 ? 20 1 1 A G 4 1_555 B C 20 1_555 -0.068 -0.035 0.095 -0.381 -15.341 -0.845 4 A_G4:C20_B A 4 ? B 20 ? 19 1 1 A C 5 1_555 B G 19 1_555 0.696 -0.188 0.616 -11.541 -18.112 1.125 5 A_C5:G19_B A 5 ? B 19 ? 19 1 1 A U 6 1_555 B A 18 1_555 0.131 -0.141 0.561 -12.035 -7.434 1.893 6 A_U6:A18_B A 6 ? B 18 ? 20 1 1 A G 7 1_555 B C 17 1_555 0.045 -0.316 -0.189 -1.554 -15.747 -1.544 7 A_G7:C17_B A 7 ? B 17 ? 19 1 1 A G 9 1_555 B A 16 1_555 -0.115 1.360 -0.521 25.145 -22.841 -11.631 8 A_G9:A16_B A 9 ? B 16 ? 8 ? 1 A G 10 1_555 B C 15 1_555 -0.155 -0.217 -0.094 -7.468 -10.416 1.617 9 A_G10:C15_B A 10 ? B 15 ? 19 1 1 A U 11 1_555 B A 14 1_555 -0.919 -0.201 -0.425 -8.193 -14.217 -2.777 10 A_U11:A14_B A 11 ? B 14 ? 20 1 1 A G 12 1_555 B C 13 1_555 -0.650 -0.430 0.137 -6.145 -9.629 -3.078 11 A_G12:C13_B A 12 ? B 13 ? 19 1 1 A C 13 1_555 B G 12 1_555 0.080 -0.276 -0.069 4.039 -11.514 -4.189 12 A_C13:G12_B A 13 ? B 12 ? 19 1 1 A A 14 1_555 B U 11 1_555 0.184 -0.190 0.551 14.470 -8.234 3.965 13 A_A14:U11_B A 14 ? B 11 ? 20 1 1 A C 15 1_555 B G 10 1_555 -0.491 -0.188 0.823 -5.319 -16.625 -5.889 14 A_C15:G10_B A 15 ? B 10 ? 19 1 1 A A 16 1_555 B G 9 1_555 0.267 1.182 -0.078 -8.863 -18.669 -17.990 15 A_A16:G9_B A 16 ? B 9 ? 8 ? 1 A C 17 1_555 B G 7 1_555 -0.056 -0.192 0.917 -2.067 -6.840 2.228 16 A_C17:G7_B A 17 ? B 7 ? 19 1 1 A A 18 1_555 B U 6 1_555 0.199 -0.043 0.352 9.520 -4.659 5.800 17 A_A18:U6_B A 18 ? B 6 ? 20 1 1 A G 19 1_555 B C 5 1_555 -0.353 -0.264 0.025 7.988 -20.765 0.068 18 A_G19:C5_B A 19 ? B 5 ? 19 1 1 A C 20 1_555 B G 4 1_555 0.151 -0.230 -0.037 2.347 -15.209 2.512 19 A_C20:G4_B A 20 ? B 4 ? 19 1 1 A A 21 1_555 B U 3 1_555 -0.005 0.008 0.088 -0.545 -13.560 12.694 20 A_A21:U3_B A 21 ? B 3 ? 20 1 1 A A 22 1_555 B U 2 1_555 -0.024 -0.307 0.251 4.069 -13.968 5.581 21 A_A22:U2_B A 22 ? B 2 ? 20 1 1 A G 23 1_555 B C 1 1_555 -0.420 -0.383 0.364 5.331 -15.961 -0.791 22 A_G23:C1_B A 23 ? B 1 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 1 1_555 B G 23 1_555 A U 2 1_555 B A 22 1_555 0.109 -1.529 3.510 -2.005 13.831 33.847 -4.323 -0.447 2.692 22.597 3.276 36.540 1 AA_C1U2:A22G23_BB A 1 ? B 23 ? A 2 ? B 22 ? 1 A U 2 1_555 B A 22 1_555 A U 3 1_555 B A 21 1_555 0.230 -0.923 3.137 -1.937 7.301 34.529 -2.524 -0.645 2.872 12.121 3.215 35.320 2 AA_U2U3:A21A22_BB A 2 ? B 22 ? A 3 ? B 21 ? 1 A U 3 1_555 B A 21 1_555 A G 4 1_555 B C 20 1_555 0.041 -1.845 3.166 1.842 15.512 30.493 -5.202 0.175 2.018 27.355 -3.249 34.176 3 AA_U3G4:C20A21_BB A 3 ? B 21 ? A 4 ? B 20 ? 1 A G 4 1_555 B C 20 1_555 A C 5 1_555 B G 19 1_555 -0.299 -1.252 3.662 -3.637 8.255 36.908 -3.069 -0.043 3.329 12.805 5.642 37.957 4 AA_G4C5:G19C20_BB A 4 ? B 20 ? A 5 ? B 19 ? 1 A C 5 1_555 B G 19 1_555 A U 6 1_555 B A 18 1_555 0.232 -1.390 3.060 1.898 7.871 30.419 -3.869 -0.114 2.636 14.677 -3.539 31.454 5 AA_C5U6:A18G19_BB A 5 ? B 19 ? A 6 ? B 18 ? 1 A U 6 1_555 B A 18 1_555 A G 7 1_555 B C 17 1_555 0.490 -1.660 2.777 6.257 15.215 28.520 -4.881 -0.067 1.759 28.122 -11.565 32.840 6 AA_U6G7:C17A18_BB A 6 ? B 18 ? A 7 ? B 17 ? 1 A G 7 1_555 B C 17 1_555 A G 9 1_555 B A 16 1_555 -1.680 0.014 2.797 5.504 1.537 39.154 -0.128 3.014 2.546 2.278 -8.159 39.553 7 AA_G7G9:A16C17_BB A 7 ? B 17 ? A 9 ? B 16 ? 1 A G 9 1_555 B A 16 1_555 A G 10 1_555 B C 15 1_555 0.305 -2.236 3.818 -7.885 16.347 35.268 -5.268 -1.397 2.466 25.039 12.077 39.532 8 AA_G9G10:C15A16_BB A 9 ? B 16 ? A 10 ? B 15 ? 1 A G 10 1_555 B C 15 1_555 A U 11 1_555 B A 14 1_555 -0.589 -1.601 3.035 1.663 8.120 31.733 -4.047 1.291 2.526 14.542 -2.978 32.771 9 AA_G10U11:A14C15_BB A 10 ? B 15 ? A 11 ? B 14 ? 1 A U 11 1_555 B A 14 1_555 A G 12 1_555 B C 13 1_555 0.301 -1.620 3.247 -3.603 7.747 30.070 -4.371 -1.193 2.702 14.566 6.773 31.233 10 AA_U11G12:C13A14_BB A 11 ? B 14 ? A 12 ? B 13 ? 1 A G 12 1_555 B C 13 1_555 A C 13 1_555 B G 12 1_555 -0.020 -1.498 3.119 1.733 -0.171 34.684 -2.485 0.287 3.121 -0.286 -2.905 34.726 11 AA_G12C13:G12C13_BB A 12 ? B 13 ? A 13 ? B 12 ? 1 A C 13 1_555 B G 12 1_555 A A 14 1_555 B U 11 1_555 0.261 -1.669 2.736 -3.964 6.892 30.829 -4.025 -1.040 2.268 12.700 7.305 31.813 12 AA_C13A14:U11G12_BB A 13 ? B 12 ? A 14 ? B 11 ? 1 A A 14 1_555 B U 11 1_555 A C 15 1_555 B G 10 1_555 -0.001 -1.959 3.547 -1.399 6.875 30.105 -5.037 -0.275 3.032 13.015 2.648 30.893 13 AA_A14C15:G10U11_BB A 14 ? B 11 ? A 15 ? B 10 ? 1 A C 15 1_555 B G 10 1_555 A A 16 1_555 B G 9 1_555 -0.477 -2.272 2.904 8.216 10.953 40.414 -4.001 1.312 2.115 15.332 -11.500 42.578 14 AA_C15A16:G9G10_BB A 15 ? B 10 ? A 16 ? B 9 ? 1 A A 16 1_555 B G 9 1_555 A C 17 1_555 B G 7 1_555 1.511 -0.247 3.396 -14.783 -3.157 35.561 0.000 -4.041 2.601 -4.905 22.967 38.545 15 AA_A16C17:G7G9_BB A 16 ? B 9 ? A 17 ? B 7 ? 1 A C 17 1_555 B G 7 1_555 A A 18 1_555 B U 6 1_555 -0.592 -1.285 2.688 -0.121 10.402 32.303 -3.481 1.001 2.183 18.120 0.210 33.895 16 AA_C17A18:U6G7_BB A 17 ? B 7 ? A 18 ? B 6 ? 1 A A 18 1_555 B U 6 1_555 A G 19 1_555 B C 5 1_555 0.008 -1.414 3.420 2.069 9.538 30.001 -4.349 0.364 2.842 17.841 -3.871 31.514 17 AA_A18G19:C5U6_BB A 18 ? B 6 ? A 19 ? B 5 ? 1 A G 19 1_555 B C 5 1_555 A C 20 1_555 B G 4 1_555 0.886 -1.476 3.416 2.974 1.239 35.493 -2.600 -0.995 3.425 2.027 -4.866 35.634 18 AA_G19C20:G4C5_BB A 19 ? B 5 ? A 20 ? B 4 ? 1 A C 20 1_555 B G 4 1_555 A A 21 1_555 B U 3 1_555 -0.294 -1.278 3.192 0.614 13.008 31.034 -4.132 0.600 2.467 23.079 -1.089 33.593 19 AA_C20A21:U3G4_BB A 20 ? B 4 ? A 21 ? B 3 ? 1 A A 21 1_555 B U 3 1_555 A A 22 1_555 B U 2 1_555 -0.411 -0.740 3.137 0.229 11.028 30.305 -3.148 0.779 2.706 20.270 -0.420 32.206 20 AA_A21A22:U2U3_BB A 21 ? B 3 ? A 22 ? B 2 ? 1 A A 22 1_555 B U 2 1_555 A G 23 1_555 B C 1 1_555 0.401 -1.426 3.092 2.478 11.236 31.576 -4.091 -0.337 2.478 19.842 -4.377 33.557 21 AA_A22G23:C1U2_BB A 22 ? B 2 ? A 23 ? B 1 ? # _atom_sites.entry_id 1WVD _atom_sites.fract_transf_matrix[1][1] 0.016901 _atom_sites.fract_transf_matrix[1][2] 0.009758 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.019516 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.015626 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C CO N O P # loop_