data_1Y6S
# 
_entry.id   1Y6S 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.386 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
_database_2.pdbx_database_accession 
_database_2.pdbx_DOI 
PDB   1Y6S         pdb_00001y6s 10.2210/pdb1y6s/pdb 
NDB   AR0052       ?            ?                   
RCSB  RCSB031187   ?            ?                   
WWPDB D_1000031187 ?            ?                   
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2004-12-21 
2 'Structure model' 1 1 2008-04-30 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2024-02-14 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
_pdbx_audit_revision_details.details             ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
3 4 'Structure model' 'Data collection'           
4 4 'Structure model' 'Database references'       
5 4 'Structure model' 'Derived calculations'      
# 
loop_
_pdbx_audit_revision_category.ordinal 
_pdbx_audit_revision_category.revision_ordinal 
_pdbx_audit_revision_category.data_content_type 
_pdbx_audit_revision_category.category 
1 4 'Structure model' chem_comp_atom         
2 4 'Structure model' chem_comp_bond         
3 4 'Structure model' database_2             
4 4 'Structure model' pdbx_struct_conn_angle 
5 4 'Structure model' struct_conn            
6 4 'Structure model' struct_site            
# 
loop_
_pdbx_audit_revision_item.ordinal 
_pdbx_audit_revision_item.revision_ordinal 
_pdbx_audit_revision_item.data_content_type 
_pdbx_audit_revision_item.item 
1  4 'Structure model' '_database_2.pdbx_DOI'                        
2  4 'Structure model' '_database_2.pdbx_database_accession'         
3  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_comp_id'  
4  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id'   
5  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_atom_id' 
6  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_comp_id' 
7  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_seq_id'  
8  4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_comp_id'  
9  4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id'   
10 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_atom_id' 
11 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_comp_id' 
12 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_seq_id'  
13 4 'Structure model' '_pdbx_struct_conn_angle.value'               
14 4 'Structure model' '_struct_conn.pdbx_dist_value'                
15 4 'Structure model' '_struct_conn.ptnr1_auth_asym_id'             
16 4 'Structure model' '_struct_conn.ptnr1_auth_comp_id'             
17 4 'Structure model' '_struct_conn.ptnr1_auth_seq_id'              
18 4 'Structure model' '_struct_conn.ptnr1_label_asym_id'            
19 4 'Structure model' '_struct_conn.ptnr1_label_atom_id'            
20 4 'Structure model' '_struct_conn.ptnr1_label_comp_id'            
21 4 'Structure model' '_struct_conn.ptnr1_label_seq_id'             
22 4 'Structure model' '_struct_conn.ptnr2_auth_asym_id'             
23 4 'Structure model' '_struct_conn.ptnr2_auth_comp_id'             
24 4 'Structure model' '_struct_conn.ptnr2_auth_seq_id'              
25 4 'Structure model' '_struct_conn.ptnr2_label_asym_id'            
26 4 'Structure model' '_struct_conn.ptnr2_label_atom_id'            
27 4 'Structure model' '_struct_conn.ptnr2_label_comp_id'            
28 4 'Structure model' '_struct_conn.ptnr2_label_seq_id'             
29 4 'Structure model' '_struct_site.pdbx_auth_asym_id'              
30 4 'Structure model' '_struct_site.pdbx_auth_comp_id'              
31 4 'Structure model' '_struct_site.pdbx_auth_seq_id'               
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1Y6S 
_pdbx_database_status.recvd_initial_deposition_date   2004-12-07 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.db_id 
_pdbx_database_related.details 
_pdbx_database_related.content_type 
PDB 1NLC 'HIV-1 Dis(Mal) Duplex Zn-Soaked'          unspecified 
PDB 1O3Z 'HIV-1 Dis(Mal) Duplex Ru Hexamine-Soaked' unspecified 
PDB 462D 'HIV-1 Dis(Mal) Duplex Mg-native'          unspecified 
PDB 1Y6T .                                          unspecified 
PDB 1Y73 .                                          unspecified 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Ennifar, E.' 1 
'Walter, P.'  2 
'Dumas, P.'   3 
# 
_citation.id                        primary 
_citation.title                     'A crystallographic study of the binding of 13 metal ions to two related RNA duplexes' 
_citation.journal_abbrev            'Nucleic Acids Res.' 
_citation.journal_volume            31 
_citation.page_first                2671 
_citation.page_last                 2682 
_citation.year                      2003 
_citation.journal_id_ASTM           NARHAD 
_citation.country                   UK 
_citation.journal_id_ISSN           0305-1048 
_citation.journal_id_CSD            0389 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   12736317 
_citation.pdbx_database_id_DOI      10.1093/nar/gkg350 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Ennifar, E.' 1 ? 
primary 'Walter, P.'  2 ? 
primary 'Dumas, P.'   3 ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     syn "5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*GP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP*AP*G)-3'" 7402.472 2 ? ? ? 'HIV-1 DIS RNA' 
2 non-polymer syn 'BARIUM ION'                                                                    137.327  6 ? ? ? ?               
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   no 
_entity_poly.pdbx_seq_one_letter_code       CUUGCUGAGGUGCACACAGCAAG 
_entity_poly.pdbx_seq_one_letter_code_can   CUUGCUGAGGUGCACACAGCAAG 
_entity_poly.pdbx_strand_id                 A,B 
_entity_poly.pdbx_target_identifier         ? 
# 
_pdbx_entity_nonpoly.entity_id   2 
_pdbx_entity_nonpoly.name        'BARIUM ION' 
_pdbx_entity_nonpoly.comp_id     BA 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  C n 
1 2  U n 
1 3  U n 
1 4  G n 
1 5  C n 
1 6  U n 
1 7  G n 
1 8  A n 
1 9  G n 
1 10 G n 
1 11 U n 
1 12 G n 
1 13 C n 
1 14 A n 
1 15 C n 
1 16 A n 
1 17 C n 
1 18 A n 
1 19 G n 
1 20 C n 
1 21 A n 
1 22 A n 
1 23 G n 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A  'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
BA non-polymer   . 'BARIUM ION'                 ? 'Ba 2'            137.327 
C  'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
G  'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
U  'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  C 1  1  1  C CYT A . n 
A 1 2  U 2  2  2  U URI A . n 
A 1 3  U 3  3  3  U URI A . n 
A 1 4  G 4  4  4  G GUA A . n 
A 1 5  C 5  5  5  C CYT A . n 
A 1 6  U 6  6  6  U URI A . n 
A 1 7  G 7  7  7  G GUA A . n 
A 1 8  A 8  8  8  A ADE A . n 
A 1 9  G 9  9  9  G GUA A . n 
A 1 10 G 10 10 10 G GUA A . n 
A 1 11 U 11 11 11 U URI A . n 
A 1 12 G 12 12 12 G GUA A . n 
A 1 13 C 13 13 13 C CYT A . n 
A 1 14 A 14 14 14 A ADE A . n 
A 1 15 C 15 15 15 C CYT A . n 
A 1 16 A 16 16 16 A ADE A . n 
A 1 17 C 17 17 17 C CYT A . n 
A 1 18 A 18 18 18 A ADE A . n 
A 1 19 G 19 19 19 G GUA A . n 
A 1 20 C 20 20 20 C CYT A . n 
A 1 21 A 21 21 21 A ADE A . n 
A 1 22 A 22 22 22 A ADE A . n 
A 1 23 G 23 23 23 G GUA A . n 
B 1 1  C 1  1  1  C CYT B . n 
B 1 2  U 2  2  2  U URI B . n 
B 1 3  U 3  3  3  U URI B . n 
B 1 4  G 4  4  4  G GUA B . n 
B 1 5  C 5  5  5  C CYT B . n 
B 1 6  U 6  6  6  U URI B . n 
B 1 7  G 7  7  7  G GUA B . n 
B 1 8  A 8  8  8  A ADE B . n 
B 1 9  G 9  9  9  G GUA B . n 
B 1 10 G 10 10 10 G GUA B . n 
B 1 11 U 11 11 11 U URI B . n 
B 1 12 G 12 12 12 G GUA B . n 
B 1 13 C 13 13 13 C CYT B . n 
B 1 14 A 14 14 14 A ADE B . n 
B 1 15 C 15 15 15 C CYT B . n 
B 1 16 A 16 16 16 A ADE B . n 
B 1 17 C 17 17 17 C CYT B . n 
B 1 18 A 18 18 18 A ADE B . n 
B 1 19 G 19 19 19 G GUA B . n 
B 1 20 C 20 20 20 C CYT B . n 
B 1 21 A 21 21 21 A ADE B . n 
B 1 22 A 22 22 22 A ADE B . n 
B 1 23 G 23 23 23 G GUA B . n 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
C 2 BA 1 501 501 BA BA A . 
D 2 BA 1 502 502 BA BA A . 
E 2 BA 1 503 503 BA BA A . 
F 2 BA 1 504 504 BA BA A . 
G 2 BA 1 505 505 BA BA B . 
H 2 BA 1 507 507 BA BA B . 
# 
loop_
_software.name 
_software.classification 
_software.version 
_software.citation_id 
_software.pdbx_ordinal 
CNS       refinement       1.1 ? 1 
DENZO     'data reduction' .   ? 2 
SCALEPACK 'data scaling'   .   ? 3 
CNS       phasing          .   ? 4 
# 
_cell.entry_id           1Y6S 
_cell.length_a           58.010 
_cell.length_b           58.010 
_cell.length_c           65.420 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        120.00 
_cell.Z_PDB              12 
_cell.pdbx_unique_axis   ? 
# 
_symmetry.entry_id                         1Y6S 
_symmetry.space_group_name_H-M             'P 31 2 1' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                152 
_symmetry.space_group_name_Hall            ? 
# 
_exptl.entry_id          1Y6S 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.15 
_exptl_crystal.density_percent_sol   50 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
# 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, SITTING DROP' 
_exptl_crystal_grow.temp            310 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              7.0 
_exptl_crystal_grow.pdbx_details    
'MPD, spermine, KCl, MgCl2, Na Cacodylate, pH 7.0, VAPOR DIFFUSION, SITTING DROP, temperature 310K' 
_exptl_crystal_grow.pdbx_pH_range   . 
# 
loop_
_exptl_crystal_grow_comp.crystal_id 
_exptl_crystal_grow_comp.id 
_exptl_crystal_grow_comp.sol_id 
_exptl_crystal_grow_comp.name 
_exptl_crystal_grow_comp.volume 
_exptl_crystal_grow_comp.conc 
_exptl_crystal_grow_comp.details 
1 1  1 MPD             ? ? ? 
1 2  1 spermine        ? ? ? 
1 3  1 KCl             ? ? ? 
1 4  1 MgCl2           ? ? ? 
1 5  1 'Na Cacodylate' ? ? ? 
1 6  1 H2O             ? ? ? 
1 7  2 MPD             ? ? ? 
1 8  2 KCl             ? ? ? 
1 9  2 MgCl2           ? ? ? 
1 10 2 'Na Cacodylate' ? ? ? 
# 
_diffrn.id                     1 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               'IMAGE PLATE' 
_diffrn_detector.type                   MACSCIENCE 
_diffrn_detector.pdbx_collection_date   ? 
_diffrn_detector.details                ? 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    mirror 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   1.5418 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      'ROTATING ANODE' 
_diffrn_source.type                        ENRAF-NONIUS 
_diffrn_source.pdbx_synchrotron_site       ? 
_diffrn_source.pdbx_synchrotron_beamline   ? 
_diffrn_source.pdbx_wavelength             1.5418 
_diffrn_source.pdbx_wavelength_list        ? 
# 
_reflns.entry_id                     1Y6S 
_reflns.observed_criterion_sigma_I   0 
_reflns.observed_criterion_sigma_F   0 
_reflns.d_resolution_low             12 
_reflns.d_resolution_high            2.8 
_reflns.number_obs                   3323 
_reflns.number_all                   ? 
_reflns.percent_possible_obs         99.8 
_reflns.pdbx_Rmerge_I_obs            ? 
_reflns.pdbx_Rsym_value              0.086 
_reflns.pdbx_netI_over_sigmaI        ? 
_reflns.B_iso_Wilson_estimate        36.5 
_reflns.pdbx_redundancy              8.1 
_reflns.R_free_details               ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
# 
_reflns_shell.d_res_high             2.80 
_reflns_shell.d_res_low              2.93 
_reflns_shell.percent_possible_all   99.0 
_reflns_shell.Rmerge_I_obs           ? 
_reflns_shell.pdbx_Rsym_value        0.297 
_reflns_shell.meanI_over_sigI_obs    ? 
_reflns_shell.pdbx_redundancy        ? 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.number_measured_all    ? 
_reflns_shell.number_measured_obs    ? 
_reflns_shell.number_unique_obs      ? 
_reflns_shell.pdbx_chi_squared       ? 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
# 
_refine.entry_id                                 1Y6S 
_refine.ls_number_reflns_obs                     2732 
_refine.ls_number_reflns_all                     2864 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          2.0 
_refine.pdbx_data_cutoff_high_absF               579338.35 
_refine.pdbx_data_cutoff_low_absF                0.000000 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             7.99 
_refine.ls_d_res_high                            2.90 
_refine.ls_percent_reflns_obs                    95.4 
_refine.ls_R_factor_obs                          0.248 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.248 
_refine.ls_R_factor_R_free                       0.276 
_refine.ls_R_factor_R_free_error                 0.017 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 9.9 
_refine.ls_number_reflns_R_free                  270 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.B_iso_mean                               45.4 
_refine.aniso_B[1][1]                            -6.07 
_refine.aniso_B[2][2]                            -6.07 
_refine.aniso_B[3][3]                            12.14 
_refine.aniso_B[1][2]                            1.05 
_refine.aniso_B[1][3]                            0.00 
_refine.aniso_B[2][3]                            0.00 
_refine.solvent_model_details                    'FLAT MODEL' 
_refine.solvent_model_param_ksol                 0.151274 
_refine.solvent_model_param_bsol                 14.9873 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          'FOURIER SYNTHESIS' 
_refine.pdbx_isotropic_thermal_model             RESTRAINED 
_refine.pdbx_stereochemistry_target_values       ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_analyze.entry_id                        1Y6S 
_refine_analyze.Luzzati_coordinate_error_obs    0.35 
_refine_analyze.Luzzati_sigma_a_obs             0.28 
_refine_analyze.Luzzati_d_res_low_obs           5.00 
_refine_analyze.Luzzati_coordinate_error_free   0.41 
_refine_analyze.Luzzati_sigma_a_free            0.28 
_refine_analyze.Luzzati_d_res_low_free          ? 
_refine_analyze.number_disordered_residues      ? 
_refine_analyze.occupancy_sum_hydrogen          ? 
_refine_analyze.occupancy_sum_non_hydrogen      ? 
_refine_analyze.pdbx_refine_id                  'X-RAY DIFFRACTION' 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   1048 
_refine_hist.pdbx_number_atoms_ligand         6 
_refine_hist.number_atoms_solvent             0 
_refine_hist.number_atoms_total               1054 
_refine_hist.d_res_high                       2.90 
_refine_hist.d_res_low                        7.99 
# 
loop_
_refine_ls_restr.type 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.weight 
_refine_ls_restr.number 
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.pdbx_restraint_function 
c_bond_d                0.004 ?    ? ? 'X-RAY DIFFRACTION' ? 
c_bond_d_na             ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_bond_d_prot           ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d               ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d_na            ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d_prot          ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg             0.8   ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg_na          ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg_prot        ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d      14.1  ?    ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d_na   ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d_prot ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d      1.28  ?    ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d_na   ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d_prot ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_mcbond_it             1.30  1.50 ? ? 'X-RAY DIFFRACTION' ? 
c_mcangle_it            2.03  2.00 ? ? 'X-RAY DIFFRACTION' ? 
c_scbond_it             ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_scangle_it            ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
# 
_refine_ls_shell.pdbx_total_number_of_bins_used   6 
_refine_ls_shell.d_res_high                       2.90 
_refine_ls_shell.d_res_low                        3.07 
_refine_ls_shell.number_reflns_R_work             353 
_refine_ls_shell.R_factor_R_work                  0.281 
_refine_ls_shell.percent_reflns_obs               86.5 
_refine_ls_shell.R_factor_R_free                  0.315 
_refine_ls_shell.R_factor_R_free_error            0.047 
_refine_ls_shell.percent_reflns_R_free            11.3 
_refine_ls_shell.number_reflns_R_free             45 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_ls_shell.number_reflns_all                ? 
_refine_ls_shell.R_factor_all                     ? 
# 
loop_
_pdbx_xplor_file.serial_no 
_pdbx_xplor_file.param_file 
_pdbx_xplor_file.topol_file 
_pdbx_xplor_file.pdbx_refine_id 
1 WATER_REP.PARAM WATER.TOP   'X-RAY DIFFRACTION' 
2 DNA-RNA.PARAM   DNA-RNA.TOP 'X-RAY DIFFRACTION' 
3 ION2.PARAM      ION2.TOP    'X-RAY DIFFRACTION' 
4 BRU_REP.PARAM   ?           'X-RAY DIFFRACTION' 
# 
_database_PDB_matrix.entry_id          1Y6S 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
# 
_struct.entry_id                  1Y6S 
_struct.title                     'HIV-1 DIS(Mal) duplex Ba-soaked' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        1Y6S 
_struct_keywords.pdbx_keywords   RNA 
_struct_keywords.text            'HIV-1, RNA, metal ions' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 1 ? 
C N N 2 ? 
D N N 2 ? 
E N N 2 ? 
F N N 2 ? 
G N N 2 ? 
H N N 2 ? 
# 
_struct_ref.id                         1 
_struct_ref.entity_id                  1 
_struct_ref.db_name                    PDB 
_struct_ref.db_code                    1Y6S 
_struct_ref.pdbx_db_accession          1Y6S 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.pdbx_seq_one_letter_code   ? 
_struct_ref.pdbx_align_begin           ? 
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1 1 1Y6S A 1 ? 23 ? 1Y6S 1 ? 23 ? 1 23 
2 1 1Y6S B 1 ? 23 ? 1Y6S 1 ? 23 ? 1 23 
# 
_pdbx_struct_assembly.id                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   dimeric 
_pdbx_struct_assembly.oligomeric_count     2 
# 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
_struct_biol.id                    1 
_struct_biol.pdbx_parent_biol_id   ? 
_struct_biol.details               ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
_struct_conn.pdbx_role 
metalc1  metalc ? ? A U 3  O4  ? ? ? 1_555 C BA .  BA ? ? A U 3  A BA 501 1_555 ? ? ? ? ? ? ?            3.237 ? ? 
metalc2  metalc ? ? A U 6  O4  ? ? ? 1_555 D BA .  BA ? ? A U 6  A BA 502 1_555 ? ? ? ? ? ? ?            3.520 ? ? 
metalc3  metalc ? ? A G 7  O6  ? ? ? 1_555 D BA .  BA ? ? A G 7  A BA 502 1_555 ? ? ? ? ? ? ?            3.220 ? ? 
metalc4  metalc ? ? A G 9  N7  ? ? ? 1_555 E BA .  BA ? ? A G 9  A BA 503 1_555 ? ? ? ? ? ? ?            3.468 ? ? 
metalc5  metalc ? ? A G 9  O6  ? ? ? 1_555 E BA .  BA ? ? A G 9  A BA 503 1_555 ? ? ? ? ? ? ?            2.597 ? ? 
metalc6  metalc ? ? A G 9  OP1 ? ? ? 1_555 G BA .  BA ? ? A G 9  B BA 505 1_555 ? ? ? ? ? ? ?            2.485 ? ? 
metalc7  metalc ? ? A G 10 O6  ? ? ? 1_555 E BA .  BA ? ? A G 10 A BA 503 1_555 ? ? ? ? ? ? ?            3.448 ? ? 
metalc8  metalc ? ? B U 3  O4  ? ? ? 1_555 H BA .  BA ? ? B U 3  B BA 507 1_555 ? ? ? ? ? ? ?            3.350 ? ? 
metalc9  metalc ? ? B G 4  O6  ? ? ? 1_555 H BA .  BA ? ? B G 4  B BA 507 1_555 ? ? ? ? ? ? ?            3.279 ? ? 
hydrog1  hydrog ? ? A C 1  N3  ? ? ? 1_555 B G  23 N1 ? ? A C 1  B G  23  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog2  hydrog ? ? A C 1  N4  ? ? ? 1_555 B G  23 O6 ? ? A C 1  B G  23  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog3  hydrog ? ? A C 1  O2  ? ? ? 1_555 B G  23 N2 ? ? A C 1  B G  23  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog4  hydrog ? ? A U 2  N3  ? ? ? 1_555 B A  22 N1 ? ? A U 2  B A  22  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog5  hydrog ? ? A U 2  O4  ? ? ? 1_555 B A  22 N6 ? ? A U 2  B A  22  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog6  hydrog ? ? A U 3  N3  ? ? ? 1_555 B A  21 N1 ? ? A U 3  B A  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog7  hydrog ? ? A U 3  O4  ? ? ? 1_555 B A  21 N6 ? ? A U 3  B A  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog8  hydrog ? ? A G 4  N1  ? ? ? 1_555 B C  20 N3 ? ? A G 4  B C  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog9  hydrog ? ? A G 4  N2  ? ? ? 1_555 B C  20 O2 ? ? A G 4  B C  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog10 hydrog ? ? A G 4  O6  ? ? ? 1_555 B C  20 N4 ? ? A G 4  B C  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog11 hydrog ? ? A C 5  N3  ? ? ? 1_555 B G  19 N1 ? ? A C 5  B G  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog12 hydrog ? ? A C 5  N4  ? ? ? 1_555 B G  19 O6 ? ? A C 5  B G  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog13 hydrog ? ? A C 5  O2  ? ? ? 1_555 B G  19 N2 ? ? A C 5  B G  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog14 hydrog ? ? A U 6  N3  ? ? ? 1_555 B A  18 N1 ? ? A U 6  B A  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog15 hydrog ? ? A U 6  O4  ? ? ? 1_555 B A  18 N6 ? ? A U 6  B A  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog16 hydrog ? ? A G 7  N1  ? ? ? 1_555 B C  17 O2 ? ? A G 7  B C  17  1_555 ? ? ? ? ? ? 'G-C PAIR'   ?     ? ? 
hydrog17 hydrog ? ? A G 9  N1  ? ? ? 1_555 B A  16 N1 ? ? A G 9  B A  16  1_555 ? ? ? ? ? ? TYPE_8_PAIR  ?     ? ? 
hydrog18 hydrog ? ? A G 9  O6  ? ? ? 1_555 B A  16 N6 ? ? A G 9  B A  16  1_555 ? ? ? ? ? ? TYPE_8_PAIR  ?     ? ? 
hydrog19 hydrog ? ? A G 10 N1  ? ? ? 1_555 B C  15 N3 ? ? A G 10 B C  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog20 hydrog ? ? A G 10 N2  ? ? ? 1_555 B C  15 O2 ? ? A G 10 B C  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog21 hydrog ? ? A G 10 O6  ? ? ? 1_555 B C  15 N4 ? ? A G 10 B C  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog22 hydrog ? ? A U 11 N3  ? ? ? 1_555 B A  14 N1 ? ? A U 11 B A  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog23 hydrog ? ? A U 11 O4  ? ? ? 1_555 B A  14 N6 ? ? A U 11 B A  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog24 hydrog ? ? A G 12 N1  ? ? ? 1_555 B C  13 N3 ? ? A G 12 B C  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog25 hydrog ? ? A G 12 N2  ? ? ? 1_555 B C  13 O2 ? ? A G 12 B C  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog26 hydrog ? ? A G 12 O6  ? ? ? 1_555 B C  13 N4 ? ? A G 12 B C  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog27 hydrog ? ? A C 13 N3  ? ? ? 1_555 B G  12 N1 ? ? A C 13 B G  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog28 hydrog ? ? A C 13 N4  ? ? ? 1_555 B G  12 O6 ? ? A C 13 B G  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog29 hydrog ? ? A C 13 O2  ? ? ? 1_555 B G  12 N2 ? ? A C 13 B G  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog30 hydrog ? ? A A 14 N1  ? ? ? 1_555 B U  11 N3 ? ? A A 14 B U  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog31 hydrog ? ? A A 14 N6  ? ? ? 1_555 B U  11 O4 ? ? A A 14 B U  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog32 hydrog ? ? A C 15 N3  ? ? ? 1_555 B G  10 N1 ? ? A C 15 B G  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog33 hydrog ? ? A C 15 N4  ? ? ? 1_555 B G  10 O6 ? ? A C 15 B G  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog34 hydrog ? ? A C 15 O2  ? ? ? 1_555 B G  10 N2 ? ? A C 15 B G  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog35 hydrog ? ? A A 16 N1  ? ? ? 1_555 B G  9  N1 A ? A A 16 B G  9   1_555 ? ? ? ? ? ? TYPE_8_PAIR  ?     ? ? 
hydrog36 hydrog ? ? A A 16 N6  ? ? ? 1_555 B G  9  O6 A ? A A 16 B G  9   1_555 ? ? ? ? ? ? TYPE_8_PAIR  ?     ? ? 
hydrog37 hydrog ? ? A C 17 N3  ? ? ? 1_555 B G  7  N1 A ? A C 17 B G  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog38 hydrog ? ? A C 17 N4  ? ? ? 1_555 B G  7  O6 A ? A C 17 B G  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog39 hydrog ? ? A C 17 O2  ? ? ? 1_555 B G  7  N2 A ? A C 17 B G  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog40 hydrog ? ? A A 18 N1  ? ? ? 1_555 B U  6  N3 ? ? A A 18 B U  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog41 hydrog ? ? A A 18 N6  ? ? ? 1_555 B U  6  O4 ? ? A A 18 B U  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog42 hydrog ? ? A G 19 N1  ? ? ? 1_555 B C  5  N3 ? ? A G 19 B C  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog43 hydrog ? ? A G 19 N2  ? ? ? 1_555 B C  5  O2 ? ? A G 19 B C  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog44 hydrog ? ? A G 19 O6  ? ? ? 1_555 B C  5  N4 ? ? A G 19 B C  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog45 hydrog ? ? A C 20 N3  ? ? ? 1_555 B G  4  N1 ? ? A C 20 B G  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog46 hydrog ? ? A C 20 N4  ? ? ? 1_555 B G  4  O6 ? ? A C 20 B G  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog47 hydrog ? ? A C 20 O2  ? ? ? 1_555 B G  4  N2 ? ? A C 20 B G  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog48 hydrog ? ? A A 21 N1  ? ? ? 1_555 B U  3  N3 ? ? A A 21 B U  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog49 hydrog ? ? A A 21 N6  ? ? ? 1_555 B U  3  O4 ? ? A A 21 B U  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog50 hydrog ? ? A A 22 N1  ? ? ? 1_555 B U  2  N3 ? ? A A 22 B U  2   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog51 hydrog ? ? A A 22 N6  ? ? ? 1_555 B U  2  O4 ? ? A A 22 B U  2   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog52 hydrog ? ? A G 23 N1  ? ? ? 1_555 B C  1  N3 ? ? A G 23 B C  1   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog53 hydrog ? ? A G 23 N2  ? ? ? 1_555 B C  1  O2 ? ? A G 23 B C  1   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
hydrog54 hydrog ? ? A G 23 O6  ? ? ? 1_555 B C  1  N4 ? ? A G 23 B C  1   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? ? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
metalc ? ? 
hydrog ? ? 
# 
loop_
_pdbx_struct_conn_angle.id 
_pdbx_struct_conn_angle.ptnr1_label_atom_id 
_pdbx_struct_conn_angle.ptnr1_label_alt_id 
_pdbx_struct_conn_angle.ptnr1_label_asym_id 
_pdbx_struct_conn_angle.ptnr1_label_comp_id 
_pdbx_struct_conn_angle.ptnr1_label_seq_id 
_pdbx_struct_conn_angle.ptnr1_auth_atom_id 
_pdbx_struct_conn_angle.ptnr1_auth_asym_id 
_pdbx_struct_conn_angle.ptnr1_auth_comp_id 
_pdbx_struct_conn_angle.ptnr1_auth_seq_id 
_pdbx_struct_conn_angle.ptnr1_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr1_symmetry 
_pdbx_struct_conn_angle.ptnr2_label_atom_id 
_pdbx_struct_conn_angle.ptnr2_label_alt_id 
_pdbx_struct_conn_angle.ptnr2_label_asym_id 
_pdbx_struct_conn_angle.ptnr2_label_comp_id 
_pdbx_struct_conn_angle.ptnr2_label_seq_id 
_pdbx_struct_conn_angle.ptnr2_auth_atom_id 
_pdbx_struct_conn_angle.ptnr2_auth_asym_id 
_pdbx_struct_conn_angle.ptnr2_auth_comp_id 
_pdbx_struct_conn_angle.ptnr2_auth_seq_id 
_pdbx_struct_conn_angle.ptnr2_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr2_symmetry 
_pdbx_struct_conn_angle.ptnr3_label_atom_id 
_pdbx_struct_conn_angle.ptnr3_label_alt_id 
_pdbx_struct_conn_angle.ptnr3_label_asym_id 
_pdbx_struct_conn_angle.ptnr3_label_comp_id 
_pdbx_struct_conn_angle.ptnr3_label_seq_id 
_pdbx_struct_conn_angle.ptnr3_auth_atom_id 
_pdbx_struct_conn_angle.ptnr3_auth_asym_id 
_pdbx_struct_conn_angle.ptnr3_auth_comp_id 
_pdbx_struct_conn_angle.ptnr3_auth_seq_id 
_pdbx_struct_conn_angle.ptnr3_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr3_symmetry 
_pdbx_struct_conn_angle.value 
_pdbx_struct_conn_angle.value_esd 
1 O4 ? A U 6 ? A U 6 ? 1_555 BA ? D BA . ? A BA 502 ? 1_555 O6 ? A G 7  ? A G 7  ? 1_555 66.5  ? 
2 N7 ? A G 9 ? A G 9 ? 1_555 BA ? E BA . ? A BA 503 ? 1_555 O6 ? A G 9  ? A G 9  ? 1_555 59.3  ? 
3 N7 ? A G 9 ? A G 9 ? 1_555 BA ? E BA . ? A BA 503 ? 1_555 O6 ? A G 10 ? A G 10 ? 1_555 106.7 ? 
4 O6 ? A G 9 ? A G 9 ? 1_555 BA ? E BA . ? A BA 503 ? 1_555 O6 ? A G 10 ? A G 10 ? 1_555 68.9  ? 
5 O4 ? B U 3 ? B U 3 ? 1_555 BA ? H BA . ? B BA 507 ? 1_555 O6 ? B G 4  ? B G 4  ? 1_555 63.3  ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software A BA 501 ? 1 'BINDING SITE FOR RESIDUE BA A 501' 
AC2 Software A BA 502 ? 2 'BINDING SITE FOR RESIDUE BA A 502' 
AC3 Software A BA 503 ? 2 'BINDING SITE FOR RESIDUE BA A 503' 
AC4 Software B BA 505 ? 2 'BINDING SITE FOR RESIDUE BA B 505' 
AC5 Software B BA 507 ? 2 'BINDING SITE FOR RESIDUE BA B 507' 
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1 AC1 1 U A 3  ? U A 3  . ? 1_555 ? 
2 AC2 2 U A 6  ? U A 6  . ? 1_555 ? 
3 AC2 2 G A 7  ? G A 7  . ? 1_555 ? 
4 AC3 2 G A 9  ? G A 9  . ? 1_555 ? 
5 AC3 2 G A 10 ? G A 10 . ? 1_555 ? 
6 AC4 2 G A 9  ? G A 9  . ? 1_555 ? 
7 AC4 2 G B 9  ? G B 9  . ? 1_555 ? 
8 AC5 2 U B 3  ? U B 3  . ? 1_555 ? 
9 AC5 2 G B 4  ? G B 4  . ? 1_555 ? 
# 
loop_
_pdbx_validate_polymer_linkage.id 
_pdbx_validate_polymer_linkage.PDB_model_num 
_pdbx_validate_polymer_linkage.auth_atom_id_1 
_pdbx_validate_polymer_linkage.auth_asym_id_1 
_pdbx_validate_polymer_linkage.auth_comp_id_1 
_pdbx_validate_polymer_linkage.auth_seq_id_1 
_pdbx_validate_polymer_linkage.PDB_ins_code_1 
_pdbx_validate_polymer_linkage.label_alt_id_1 
_pdbx_validate_polymer_linkage.auth_atom_id_2 
_pdbx_validate_polymer_linkage.auth_asym_id_2 
_pdbx_validate_polymer_linkage.auth_comp_id_2 
_pdbx_validate_polymer_linkage.auth_seq_id_2 
_pdbx_validate_polymer_linkage.PDB_ins_code_2 
_pdbx_validate_polymer_linkage.label_alt_id_2 
_pdbx_validate_polymer_linkage.dist 
1 1 "O3'" B U 6 ? ? P B G 7  ? B 2.78 
2 1 "O3'" B G 9 ? A P B G 10 ? ? 2.76 
# 
loop_
_chem_comp_atom.comp_id 
_chem_comp_atom.atom_id 
_chem_comp_atom.type_symbol 
_chem_comp_atom.pdbx_aromatic_flag 
_chem_comp_atom.pdbx_stereo_config 
_chem_comp_atom.pdbx_ordinal 
A  OP3    O  N N 1   
A  P      P  N N 2   
A  OP1    O  N N 3   
A  OP2    O  N N 4   
A  "O5'"  O  N N 5   
A  "C5'"  C  N N 6   
A  "C4'"  C  N R 7   
A  "O4'"  O  N N 8   
A  "C3'"  C  N S 9   
A  "O3'"  O  N N 10  
A  "C2'"  C  N R 11  
A  "O2'"  O  N N 12  
A  "C1'"  C  N R 13  
A  N9     N  Y N 14  
A  C8     C  Y N 15  
A  N7     N  Y N 16  
A  C5     C  Y N 17  
A  C6     C  Y N 18  
A  N6     N  N N 19  
A  N1     N  Y N 20  
A  C2     C  Y N 21  
A  N3     N  Y N 22  
A  C4     C  Y N 23  
A  HOP3   H  N N 24  
A  HOP2   H  N N 25  
A  "H5'"  H  N N 26  
A  "H5''" H  N N 27  
A  "H4'"  H  N N 28  
A  "H3'"  H  N N 29  
A  "HO3'" H  N N 30  
A  "H2'"  H  N N 31  
A  "HO2'" H  N N 32  
A  "H1'"  H  N N 33  
A  H8     H  N N 34  
A  H61    H  N N 35  
A  H62    H  N N 36  
A  H2     H  N N 37  
BA BA     BA N N 38  
C  OP3    O  N N 39  
C  P      P  N N 40  
C  OP1    O  N N 41  
C  OP2    O  N N 42  
C  "O5'"  O  N N 43  
C  "C5'"  C  N N 44  
C  "C4'"  C  N R 45  
C  "O4'"  O  N N 46  
C  "C3'"  C  N S 47  
C  "O3'"  O  N N 48  
C  "C2'"  C  N R 49  
C  "O2'"  O  N N 50  
C  "C1'"  C  N R 51  
C  N1     N  N N 52  
C  C2     C  N N 53  
C  O2     O  N N 54  
C  N3     N  N N 55  
C  C4     C  N N 56  
C  N4     N  N N 57  
C  C5     C  N N 58  
C  C6     C  N N 59  
C  HOP3   H  N N 60  
C  HOP2   H  N N 61  
C  "H5'"  H  N N 62  
C  "H5''" H  N N 63  
C  "H4'"  H  N N 64  
C  "H3'"  H  N N 65  
C  "HO3'" H  N N 66  
C  "H2'"  H  N N 67  
C  "HO2'" H  N N 68  
C  "H1'"  H  N N 69  
C  H41    H  N N 70  
C  H42    H  N N 71  
C  H5     H  N N 72  
C  H6     H  N N 73  
G  OP3    O  N N 74  
G  P      P  N N 75  
G  OP1    O  N N 76  
G  OP2    O  N N 77  
G  "O5'"  O  N N 78  
G  "C5'"  C  N N 79  
G  "C4'"  C  N R 80  
G  "O4'"  O  N N 81  
G  "C3'"  C  N S 82  
G  "O3'"  O  N N 83  
G  "C2'"  C  N R 84  
G  "O2'"  O  N N 85  
G  "C1'"  C  N R 86  
G  N9     N  Y N 87  
G  C8     C  Y N 88  
G  N7     N  Y N 89  
G  C5     C  Y N 90  
G  C6     C  N N 91  
G  O6     O  N N 92  
G  N1     N  N N 93  
G  C2     C  N N 94  
G  N2     N  N N 95  
G  N3     N  N N 96  
G  C4     C  Y N 97  
G  HOP3   H  N N 98  
G  HOP2   H  N N 99  
G  "H5'"  H  N N 100 
G  "H5''" H  N N 101 
G  "H4'"  H  N N 102 
G  "H3'"  H  N N 103 
G  "HO3'" H  N N 104 
G  "H2'"  H  N N 105 
G  "HO2'" H  N N 106 
G  "H1'"  H  N N 107 
G  H8     H  N N 108 
G  H1     H  N N 109 
G  H21    H  N N 110 
G  H22    H  N N 111 
U  OP3    O  N N 112 
U  P      P  N N 113 
U  OP1    O  N N 114 
U  OP2    O  N N 115 
U  "O5'"  O  N N 116 
U  "C5'"  C  N N 117 
U  "C4'"  C  N R 118 
U  "O4'"  O  N N 119 
U  "C3'"  C  N S 120 
U  "O3'"  O  N N 121 
U  "C2'"  C  N R 122 
U  "O2'"  O  N N 123 
U  "C1'"  C  N R 124 
U  N1     N  N N 125 
U  C2     C  N N 126 
U  O2     O  N N 127 
U  N3     N  N N 128 
U  C4     C  N N 129 
U  O4     O  N N 130 
U  C5     C  N N 131 
U  C6     C  N N 132 
U  HOP3   H  N N 133 
U  HOP2   H  N N 134 
U  "H5'"  H  N N 135 
U  "H5''" H  N N 136 
U  "H4'"  H  N N 137 
U  "H3'"  H  N N 138 
U  "HO3'" H  N N 139 
U  "H2'"  H  N N 140 
U  "HO2'" H  N N 141 
U  "H1'"  H  N N 142 
U  H3     H  N N 143 
U  H5     H  N N 144 
U  H6     H  N N 145 
# 
loop_
_chem_comp_bond.comp_id 
_chem_comp_bond.atom_id_1 
_chem_comp_bond.atom_id_2 
_chem_comp_bond.value_order 
_chem_comp_bond.pdbx_aromatic_flag 
_chem_comp_bond.pdbx_stereo_config 
_chem_comp_bond.pdbx_ordinal 
A OP3   P      sing N N 1   
A OP3   HOP3   sing N N 2   
A P     OP1    doub N N 3   
A P     OP2    sing N N 4   
A P     "O5'"  sing N N 5   
A OP2   HOP2   sing N N 6   
A "O5'" "C5'"  sing N N 7   
A "C5'" "C4'"  sing N N 8   
A "C5'" "H5'"  sing N N 9   
A "C5'" "H5''" sing N N 10  
A "C4'" "O4'"  sing N N 11  
A "C4'" "C3'"  sing N N 12  
A "C4'" "H4'"  sing N N 13  
A "O4'" "C1'"  sing N N 14  
A "C3'" "O3'"  sing N N 15  
A "C3'" "C2'"  sing N N 16  
A "C3'" "H3'"  sing N N 17  
A "O3'" "HO3'" sing N N 18  
A "C2'" "O2'"  sing N N 19  
A "C2'" "C1'"  sing N N 20  
A "C2'" "H2'"  sing N N 21  
A "O2'" "HO2'" sing N N 22  
A "C1'" N9     sing N N 23  
A "C1'" "H1'"  sing N N 24  
A N9    C8     sing Y N 25  
A N9    C4     sing Y N 26  
A C8    N7     doub Y N 27  
A C8    H8     sing N N 28  
A N7    C5     sing Y N 29  
A C5    C6     sing Y N 30  
A C5    C4     doub Y N 31  
A C6    N6     sing N N 32  
A C6    N1     doub Y N 33  
A N6    H61    sing N N 34  
A N6    H62    sing N N 35  
A N1    C2     sing Y N 36  
A C2    N3     doub Y N 37  
A C2    H2     sing N N 38  
A N3    C4     sing Y N 39  
C OP3   P      sing N N 40  
C OP3   HOP3   sing N N 41  
C P     OP1    doub N N 42  
C P     OP2    sing N N 43  
C P     "O5'"  sing N N 44  
C OP2   HOP2   sing N N 45  
C "O5'" "C5'"  sing N N 46  
C "C5'" "C4'"  sing N N 47  
C "C5'" "H5'"  sing N N 48  
C "C5'" "H5''" sing N N 49  
C "C4'" "O4'"  sing N N 50  
C "C4'" "C3'"  sing N N 51  
C "C4'" "H4'"  sing N N 52  
C "O4'" "C1'"  sing N N 53  
C "C3'" "O3'"  sing N N 54  
C "C3'" "C2'"  sing N N 55  
C "C3'" "H3'"  sing N N 56  
C "O3'" "HO3'" sing N N 57  
C "C2'" "O2'"  sing N N 58  
C "C2'" "C1'"  sing N N 59  
C "C2'" "H2'"  sing N N 60  
C "O2'" "HO2'" sing N N 61  
C "C1'" N1     sing N N 62  
C "C1'" "H1'"  sing N N 63  
C N1    C2     sing N N 64  
C N1    C6     sing N N 65  
C C2    O2     doub N N 66  
C C2    N3     sing N N 67  
C N3    C4     doub N N 68  
C C4    N4     sing N N 69  
C C4    C5     sing N N 70  
C N4    H41    sing N N 71  
C N4    H42    sing N N 72  
C C5    C6     doub N N 73  
C C5    H5     sing N N 74  
C C6    H6     sing N N 75  
G OP3   P      sing N N 76  
G OP3   HOP3   sing N N 77  
G P     OP1    doub N N 78  
G P     OP2    sing N N 79  
G P     "O5'"  sing N N 80  
G OP2   HOP2   sing N N 81  
G "O5'" "C5'"  sing N N 82  
G "C5'" "C4'"  sing N N 83  
G "C5'" "H5'"  sing N N 84  
G "C5'" "H5''" sing N N 85  
G "C4'" "O4'"  sing N N 86  
G "C4'" "C3'"  sing N N 87  
G "C4'" "H4'"  sing N N 88  
G "O4'" "C1'"  sing N N 89  
G "C3'" "O3'"  sing N N 90  
G "C3'" "C2'"  sing N N 91  
G "C3'" "H3'"  sing N N 92  
G "O3'" "HO3'" sing N N 93  
G "C2'" "O2'"  sing N N 94  
G "C2'" "C1'"  sing N N 95  
G "C2'" "H2'"  sing N N 96  
G "O2'" "HO2'" sing N N 97  
G "C1'" N9     sing N N 98  
G "C1'" "H1'"  sing N N 99  
G N9    C8     sing Y N 100 
G N9    C4     sing Y N 101 
G C8    N7     doub Y N 102 
G C8    H8     sing N N 103 
G N7    C5     sing Y N 104 
G C5    C6     sing N N 105 
G C5    C4     doub Y N 106 
G C6    O6     doub N N 107 
G C6    N1     sing N N 108 
G N1    C2     sing N N 109 
G N1    H1     sing N N 110 
G C2    N2     sing N N 111 
G C2    N3     doub N N 112 
G N2    H21    sing N N 113 
G N2    H22    sing N N 114 
G N3    C4     sing N N 115 
U OP3   P      sing N N 116 
U OP3   HOP3   sing N N 117 
U P     OP1    doub N N 118 
U P     OP2    sing N N 119 
U P     "O5'"  sing N N 120 
U OP2   HOP2   sing N N 121 
U "O5'" "C5'"  sing N N 122 
U "C5'" "C4'"  sing N N 123 
U "C5'" "H5'"  sing N N 124 
U "C5'" "H5''" sing N N 125 
U "C4'" "O4'"  sing N N 126 
U "C4'" "C3'"  sing N N 127 
U "C4'" "H4'"  sing N N 128 
U "O4'" "C1'"  sing N N 129 
U "C3'" "O3'"  sing N N 130 
U "C3'" "C2'"  sing N N 131 
U "C3'" "H3'"  sing N N 132 
U "O3'" "HO3'" sing N N 133 
U "C2'" "O2'"  sing N N 134 
U "C2'" "C1'"  sing N N 135 
U "C2'" "H2'"  sing N N 136 
U "O2'" "HO2'" sing N N 137 
U "C1'" N1     sing N N 138 
U "C1'" "H1'"  sing N N 139 
U N1    C2     sing N N 140 
U N1    C6     sing N N 141 
U C2    O2     doub N N 142 
U C2    N3     sing N N 143 
U N3    C4     sing N N 144 
U N3    H3     sing N N 145 
U C4    O4     doub N N 146 
U C4    C5     sing N N 147 
U C5    C6     doub N N 148 
U C5    H5     sing N N 149 
U C6    H6     sing N N 150 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
1Y6S 'double helix'         
1Y6S 'a-form double helix'  
1Y6S 'bulge loop'           
1Y6S 'mismatched base pair' 
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A C 1  1_555 B G 23 1_555 0.529  0.018  -0.039 16.586  -17.075 -3.356 1  A_C1:G23_B  A 1  ? B 23 ? 19 1 
1 A U 2  1_555 B A 22 1_555 -0.469 -0.352 -0.425 12.063  -6.738  4.881  2  A_U2:A22_B  A 2  ? B 22 ? 20 1 
1 A U 3  1_555 B A 21 1_555 -0.478 0.002  -0.448 8.898   -14.332 9.153  3  A_U3:A21_B  A 3  ? B 21 ? 20 1 
1 A G 4  1_555 B C 20 1_555 -0.961 -0.635 -0.805 -18.134 -22.904 -3.268 4  A_G4:C20_B  A 4  ? B 20 ? 19 1 
1 A C 5  1_555 B G 19 1_555 0.366  0.053  -0.018 -5.478  -6.277  4.106  5  A_C5:G19_B  A 5  ? B 19 ? 19 1 
1 A U 6  1_555 B A 18 1_555 -0.388 -0.199 0.155  -10.171 -4.753  -2.386 6  A_U6:A18_B  A 6  ? B 18 ? 20 1 
1 A G 7  1_555 B C 17 1_555 -1.402 -0.092 -0.189 4.372   -5.040  7.232  7  A_G7:C17_B  A 7  ? B 17 ? ?  1 
1 A G 9  1_555 B A 16 1_555 0.104  1.401  -0.541 18.889  -17.889 1.217  8  A_G9:A16_B  A 9  ? B 16 ? 8  1 
1 A G 10 1_555 B C 15 1_555 -0.691 -0.444 0.155  -7.969  -15.022 3.112  9  A_G10:C15_B A 10 ? B 15 ? 19 1 
1 A U 11 1_555 B A 14 1_555 -0.362 -0.211 0.239  -5.610  -4.518  5.241  10 A_U11:A14_B A 11 ? B 14 ? 20 1 
1 A G 12 1_555 B C 13 1_555 -0.216 -0.283 0.384  -2.022  -7.710  5.095  11 A_G12:C13_B A 12 ? B 13 ? 19 1 
1 A C 13 1_555 B G 12 1_555 -0.206 -0.503 -0.231 8.814   -9.608  -2.520 12 A_C13:G12_B A 13 ? B 12 ? 19 1 
1 A A 14 1_555 B U 11 1_555 0.584  -0.174 -0.107 0.657   -6.291  0.968  13 A_A14:U11_B A 14 ? B 11 ? 20 1 
1 A C 15 1_555 B G 10 1_555 -0.547 -0.471 -0.049 2.870   -10.217 -2.477 14 A_C15:G10_B A 15 ? B 10 ? 19 1 
1 A A 16 1_555 B G 9  1_555 0.078  1.088  -0.493 -17.868 -10.286 -4.565 15 A_A16:G9_B  A 16 ? B 9  ? 8  1 
1 A C 17 1_555 B G 7  1_555 0.630  -0.503 0.032  3.149   -7.917  -0.374 16 A_C17:G7_B  A 17 ? B 7  ? 19 1 
1 A A 18 1_555 B U 6  1_555 0.174  -0.146 0.176  12.080  -7.074  6.771  17 A_A18:U6_B  A 18 ? B 6  ? 20 1 
1 A G 19 1_555 B C 5  1_555 -1.093 -0.765 0.013  6.118   -9.217  -3.257 18 A_G19:C5_B  A 19 ? B 5  ? 19 1 
1 A C 20 1_555 B G 4  1_555 -0.358 -0.145 -0.469 11.200  -18.367 5.344  19 A_C20:G4_B  A 20 ? B 4  ? 19 1 
1 A A 21 1_555 B U 3  1_555 0.561  -0.148 -0.124 2.648   -11.700 8.126  20 A_A21:U3_B  A 21 ? B 3  ? 20 1 
1 A A 22 1_555 B U 2  1_555 0.153  -0.414 0.234  12.845  1.118   1.225  21 A_A22:U2_B  A 22 ? B 2  ? 20 1 
1 A G 23 1_555 B C 1  1_555 -0.180 0.265  0.290  18.905  -15.352 6.754  22 A_G23:C1_B  A 23 ? B 1  ? 19 1 
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A C 1  1_555 B G 23 1_555 A U 2  1_555 B A 22 1_555 -0.188 -1.987 3.094 -1.820  14.481 29.038 -5.625 0.077  1.920 26.847 3.374   
32.429 1  AA_C1U2:A22G23_BB   A 1  ? B 23 ? A 2  ? B 22 ? 
1 A U 2  1_555 B A 22 1_555 A U 3  1_555 B A 21 1_555 0.213  -1.399 3.120 -0.891  15.233 32.454 -4.175 -0.458 2.254 25.566 1.495   
35.775 2  AA_U2U3:A21A22_BB   A 2  ? B 22 ? A 3  ? B 21 ? 
1 A U 3  1_555 B A 21 1_555 A G 4  1_555 B C 20 1_555 -0.539 -1.708 4.135 3.406   15.170 29.292 -5.914 1.602  2.852 27.676 -6.213  
33.082 3  AA_U3G4:C20A21_BB   A 3  ? B 21 ? A 4  ? B 20 ? 
1 A G 4  1_555 B C 20 1_555 A C 5  1_555 B G 19 1_555 0.296  -0.772 2.978 -9.016  4.469  37.109 -1.668 -1.448 2.728 6.868  13.858  
38.402 4  AA_G4C5:G19C20_BB   A 4  ? B 20 ? A 5  ? B 19 ? 
1 A C 5  1_555 B G 19 1_555 A U 6  1_555 B A 18 1_555 -0.204 -1.416 3.153 -0.289  15.468 30.051 -4.618 0.311  2.186 27.648 0.517   
33.718 5  AA_C5U6:A18G19_BB   A 5  ? B 19 ? A 6  ? B 18 ? 
1 A U 6  1_555 B A 18 1_555 A G 7  1_555 B C 17 1_555 0.914  -1.854 2.928 4.310   8.896  24.782 -5.937 -1.055 2.262 19.754 -9.570  
26.652 6  AA_U6G7:C17A18_BB   A 6  ? B 18 ? A 7  ? B 17 ? 
1 A G 7  1_555 B C 17 1_555 A G 9  1_555 B A 16 1_555 -1.019 -0.009 3.111 6.688   3.657  40.644 -0.377 2.110  2.903 5.209  -9.528  
41.323 7  AA_G7G9:A16C17_BB   A 7  ? B 17 ? A 9  ? B 16 ? 
1 A G 9  1_555 B A 16 1_555 A G 10 1_555 B C 15 1_555 0.077  -2.034 3.332 -10.512 18.388 33.565 -4.895 -1.193 1.906 28.584 16.341  
39.526 8  AA_G9G10:C15A16_BB  A 9  ? B 16 ? A 10 ? B 15 ? 
1 A G 10 1_555 B C 15 1_555 A U 11 1_555 B A 14 1_555 -0.390 -1.566 3.179 -2.517  4.054  34.397 -3.213 0.287  3.000 6.815  4.232   
34.717 9  AA_G10U11:A14C15_BB A 10 ? B 15 ? A 11 ? B 14 ? 
1 A U 11 1_555 B A 14 1_555 A G 12 1_555 B C 13 1_555 0.077  -1.074 2.849 -0.276  5.166  33.244 -2.570 -0.172 2.656 8.962  0.479   
33.633 10 AA_U11G12:C13A14_BB A 11 ? B 14 ? A 12 ? B 13 ? 
1 A G 12 1_555 B C 13 1_555 A C 13 1_555 B G 12 1_555 -0.385 -1.605 2.993 6.267   3.606  30.369 -3.586 1.761  2.659 6.764  -11.755 
31.198 11 AA_G12C13:G12C13_BB A 12 ? B 13 ? A 13 ? B 12 ? 
1 A C 13 1_555 B G 12 1_555 A A 14 1_555 B U 11 1_555 -0.155 -1.530 3.394 -4.561  12.607 33.796 -4.156 -0.366 2.671 20.702 7.489   
36.286 12 AA_C13A14:U11G12_BB A 13 ? B 12 ? A 14 ? B 11 ? 
1 A A 14 1_555 B U 11 1_555 A C 15 1_555 B G 10 1_555 0.053  -1.671 3.092 1.405   2.627  28.634 -3.904 0.183  2.929 5.293  -2.830  
28.786 13 AA_A14C15:G10U11_BB A 14 ? B 11 ? A 15 ? B 10 ? 
1 A C 15 1_555 B G 10 1_555 A A 16 1_555 B G 9  1_555 0.120  -2.032 3.634 2.899   12.908 37.445 -4.530 0.168  2.811 19.382 -4.353  
39.635 14 AA_C15A16:G9G10_BB  A 15 ? B 10 ? A 16 ? B 9  ? 
1 A A 16 1_555 B G 9  1_555 A C 17 1_555 B G 7  1_555 1.106  -0.478 2.981 -4.129  -2.525 36.988 -0.447 -2.221 2.871 -3.959 6.474   
37.292 15 AA_A16C17:G7G9_BB   A 16 ? B 9  ? A 17 ? B 7  ? 
1 A C 17 1_555 B G 7  1_555 A A 18 1_555 B U 6  1_555 0.447  -1.574 2.924 -1.989  15.882 31.187 -4.494 -0.979 1.894 27.397 3.432   
34.963 16 AA_C17A18:U6G7_BB   A 17 ? B 7  ? A 18 ? B 6  ? 
1 A A 18 1_555 B U 6  1_555 A G 19 1_555 B C 5  1_555 -0.528 -1.592 3.358 -0.170  11.527 25.007 -5.967 1.073  2.405 24.994 0.369   
27.498 17 AA_A18G19:C5U6_BB   A 18 ? B 6  ? A 19 ? B 5  ? 
1 A G 19 1_555 B C 5  1_555 A C 20 1_555 B G 4  1_555 0.772  -1.089 3.056 5.540   4.878  35.376 -2.399 -0.517 2.968 7.920  -8.996  
36.114 18 AA_G19C20:G4C5_BB   A 19 ? B 5  ? A 20 ? B 4  ? 
1 A C 20 1_555 B G 4  1_555 A A 21 1_555 B U 3  1_555 0.238  -1.225 3.580 -0.788  15.067 35.540 -3.772 -0.460 2.844 23.425 1.225   
38.515 19 AA_C20A21:U3G4_BB   A 20 ? B 4  ? A 21 ? B 3  ? 
1 A A 21 1_555 B U 3  1_555 A A 22 1_555 B U 2  1_555 -0.818 -1.053 2.811 -2.838  10.071 30.095 -3.431 1.067  2.408 18.698 5.268   
31.822 20 AA_A21A22:U2U3_BB   A 21 ? B 3  ? A 22 ? B 2  ? 
1 A A 22 1_555 B U 2  1_555 A G 23 1_555 B C 1  1_555 0.713  -1.522 2.943 3.677   11.673 32.912 -3.992 -0.723 2.348 19.772 -6.229  
35.055 21 AA_A22G23:C1U2_BB   A 22 ? B 2  ? A 23 ? B 1  ? 
# 
_atom_sites.entry_id                    1Y6S 
_atom_sites.fract_transf_matrix[1][1]   0.017238 
_atom_sites.fract_transf_matrix[1][2]   0.009953 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.019905 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.015286 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
BA 
C  
N  
O  
P  
# 
loop_