data_22MW # _entry.id 22MW # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 22MW pdb_000022mw 10.2210/pdb22mw/pdb WWPDB D_1300068799 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-10-21 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 22MW _pdbx_database_status.recvd_initial_deposition_date 2026-01-16 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Xu, X.C.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title ;Crystal structure of a variant c-di-GMP-II Riboswitch BhP1-5delC A9G/U55C bound with 3',3'-cGAMP ; _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Xu, X.C.' 1 ? primary 'Ren, A.M.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (76-MER)' 24679.512 1 ? A9G/U55C ? ? 2 non-polymer syn ;2-amino-9-[(2R,3R,3aS,5R,7aR,9R,10R,10aS,12R,14aR)-9-(6-amino-9H-purin-9-yl)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecin-2-yl]-1,9-dihydro-6H-purin-6-one ; 674.411 3 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 4 ? ? ? ? 4 water nat water 18.015 24 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GUAGGGAGGCAACGAAGCAUAGCCUUUAUAUGGACACUUGGGUUAUGUGGAGCCACUAGUGUAACCGGCCCUCUC' _entity_poly.pdbx_seq_one_letter_code_can GGUAGGGAGGCAACGAAGCAUAGCCUUUAUAUGGACACUUGGGUUAUGUGGAGCCACUAGUGUAACCGGCCCUCUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ;2-amino-9-[(2R,3R,3aS,5R,7aR,9R,10R,10aS,12R,14aR)-9-(6-amino-9H-purin-9-yl)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecin-2-yl]-1,9-dihydro-6H-purin-6-one ; 4BW 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 U n 1 4 A n 1 5 G n 1 6 G n 1 7 G n 1 8 A n 1 9 G n 1 10 G n 1 11 C n 1 12 A n 1 13 A n 1 14 C n 1 15 G n 1 16 A n 1 17 A n 1 18 G n 1 19 C n 1 20 A n 1 21 U n 1 22 A n 1 23 G n 1 24 C n 1 25 C n 1 26 U n 1 27 U n 1 28 U n 1 29 A n 1 30 U n 1 31 A n 1 32 U n 1 33 G n 1 34 G n 1 35 A n 1 36 C n 1 37 A n 1 38 C n 1 39 U n 1 40 U n 1 41 G n 1 42 G n 1 43 G n 1 44 U n 1 45 U n 1 46 A n 1 47 U n 1 48 G n 1 49 U n 1 50 G n 1 51 G n 1 52 A n 1 53 G n 1 54 C n 1 55 C n 1 56 A n 1 57 C n 1 58 U n 1 59 A n 1 60 G n 1 61 U n 1 62 G n 1 63 U n 1 64 A n 1 65 A n 1 66 C n 1 67 C n 1 68 G n 1 69 G n 1 70 C n 1 71 C n 1 72 C n 1 73 U n 1 74 C n 1 75 U n 1 76 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 76 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Halalkalibacterium halodurans C-125' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 272558 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 4BW non-polymer . ;2-amino-9-[(2R,3R,3aS,5R,7aR,9R,10R,10aS,12R,14aR)-9-(6-amino-9H-purin-9-yl)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecin-2-yl]-1,9-dihydro-6H-purin-6-one ; ;3',3' cGAMP; c-GMP-AMP; c[G(3',5')pA(3',5')p] ; 'C20 H24 N10 O13 P2' 674.411 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 A 4 4 4 A A A . n A 1 5 G 5 5 5 G G A . n A 1 6 G 6 6 6 G G A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 A 12 12 12 A A A . n A 1 13 A 13 13 13 A A A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 G 18 18 18 G G A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 A 22 22 22 A A A . n A 1 23 G 23 23 23 G G A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 U 26 26 26 U U A . n A 1 27 U 27 27 27 U U A . n A 1 28 U 28 28 28 U U A . n A 1 29 A 29 29 29 A A A . n A 1 30 U 30 30 30 U U A . n A 1 31 A 31 31 31 A A A . n A 1 32 U 32 32 32 U U A . n A 1 33 G 33 33 33 G G A . n A 1 34 G 34 34 34 G G A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 A 37 37 37 A A A . n A 1 38 C 38 38 38 C C A . n A 1 39 U 39 39 39 U U A . n A 1 40 U 40 40 40 U U A . n A 1 41 G 41 41 41 G G A . n A 1 42 G 42 42 42 G G A . n A 1 43 G 43 43 43 G G A . n A 1 44 U 44 44 44 U U A . n A 1 45 U 45 45 45 U U A . n A 1 46 A 46 46 46 A A A . n A 1 47 U 47 47 47 U U A . n A 1 48 G 48 48 48 G G A . n A 1 49 U 49 49 49 U U A . n A 1 50 G 50 50 50 G G A . n A 1 51 G 51 51 51 G G A . n A 1 52 A 52 52 52 A A A . n A 1 53 G 53 53 53 G G A . n A 1 54 C 54 54 54 C C A . n A 1 55 C 55 55 55 C C A . n A 1 56 A 56 56 56 A A A . n A 1 57 C 57 57 57 C C A . n A 1 58 U 58 58 58 U U A . n A 1 59 A 59 59 59 A A A . n A 1 60 G 60 60 60 G G A . n A 1 61 U 61 61 61 U U A . n A 1 62 G 62 62 62 G G A . n A 1 63 U 63 63 63 U U A . n A 1 64 A 64 64 64 A A A . n A 1 65 A 65 65 65 A A A . n A 1 66 C 66 66 66 C C A . n A 1 67 C 67 67 67 C C A . n A 1 68 G 68 68 68 G G A . n A 1 69 G 69 69 69 G G A . n A 1 70 C 70 70 70 C C A . n A 1 71 C 71 71 71 C C A . n A 1 72 C 72 72 72 C C A . n A 1 73 U 73 73 73 U U A . n A 1 74 C 74 74 74 C C A . n A 1 75 U 75 75 75 U U A . n A 1 76 C 76 76 76 C C A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id 4BW _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id 4BW _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 4BW 1 101 1 4BW 4BW A . C 2 4BW 1 102 2 4BW 4BW A . D 2 4BW 1 103 3 4BW 4BW A . E 3 MG 1 104 1 MG MG A . F 3 MG 1 105 2 MG MG A . G 3 MG 1 106 3 MG MG A . H 3 MG 1 107 4 MG MG A . I 4 HOH 1 201 14 HOH HOH A . I 4 HOH 2 202 12 HOH HOH A . I 4 HOH 3 203 22 HOH HOH A . I 4 HOH 4 204 9 HOH HOH A . I 4 HOH 5 205 8 HOH HOH A . I 4 HOH 6 206 4 HOH HOH A . I 4 HOH 7 207 13 HOH HOH A . I 4 HOH 8 208 1 HOH HOH A . I 4 HOH 9 209 10 HOH HOH A . I 4 HOH 10 210 17 HOH HOH A . I 4 HOH 11 211 18 HOH HOH A . I 4 HOH 12 212 2 HOH HOH A . I 4 HOH 13 213 5 HOH HOH A . I 4 HOH 14 214 19 HOH HOH A . I 4 HOH 15 215 20 HOH HOH A . I 4 HOH 16 216 3 HOH HOH A . I 4 HOH 17 217 25 HOH HOH A . I 4 HOH 18 218 15 HOH HOH A . I 4 HOH 19 219 23 HOH HOH A . I 4 HOH 20 220 6 HOH HOH A . I 4 HOH 21 221 7 HOH HOH A . I 4 HOH 22 222 16 HOH HOH A . I 4 HOH 23 223 24 HOH HOH A . I 4 HOH 24 224 21 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.18.2_3874: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 22MW _cell.details ? _cell.formula_units_Z ? _cell.length_a 31.316 _cell.length_a_esd ? _cell.length_b 42.589 _cell.length_b_esd ? _cell.length_c 183.418 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 22MW _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 22MW _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.48 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 50.36 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.2M Mg(COOH)2, 20% PEG 3350' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2019-11-09 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 22MW _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2 _reflns.d_resolution_low 50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 16272 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 11.9 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 28.9 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.0 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.0 _reflns_shell.d_res_low 2.0 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 16272 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 1.0 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 22MW _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.04 _refine.ls_d_res_low 45.85 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 16272 _refine.ls_number_reflns_R_free 854 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.92 _refine.ls_percent_reflns_R_free 5.25 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2216 _refine.ls_R_factor_R_free 0.2747 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2189 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 37.67 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.41 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.04 _refine_hist.d_res_low 45.85 _refine_hist.number_atoms_solvent 24 _refine_hist.number_atoms_total 1797 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1634 _refine_hist.pdbx_number_atoms_ligand 139 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.008 ? 1978 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 1.695 ? 3084 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 16.883 ? 1037 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.068 ? 409 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.010 ? 88 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.04 2.17 . . 130 2386 95.00 . . . . 0.3966 . . . . . . . . . . . . . . . 0.4582 'X-RAY DIFFRACTION' 2.17 2.34 . . 144 2521 100.00 . . . . 0.3591 . . . . . . . . . . . . . . . 0.4537 'X-RAY DIFFRACTION' 2.34 2.57 . . 139 2565 100.00 . . . . 0.3126 . . . . . . . . . . . . . . . 0.3671 'X-RAY DIFFRACTION' 2.57 2.94 . . 159 2574 100.00 . . . . 0.3169 . . . . . . . . . . . . . . . 0.4014 'X-RAY DIFFRACTION' 2.94 3.71 . . 153 2574 100.00 . . . . 0.2089 . . . . . . . . . . . . . . . 0.2463 'X-RAY DIFFRACTION' 3.71 45.85 . . 129 2798 100.00 . . . . 0.1701 . . . . . . . . . . . . . . . 0.2142 # _struct.entry_id 22MW _struct.title ;Crystal structure of a variant c-di-GMP-II Riboswitch c-di-GMP-II-Bh_A9G/U55C bound with 3',3'-cGAMP ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 22MW _struct_keywords.text ;riboswitch, RNA, 3', 3'-cGAMP ; _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 4 ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code BA000004.3 _struct_ref.pdbx_db_accession 47118318 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code UAGGGAAGCAACGAAGCAUAGCCUUUAUAUGGACACUUGGGUUAUGUGGAGCUACUAGUGUAACCGGCCCUC _struct_ref.pdbx_align_begin 387924 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 22MW _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 3 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 74 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 47118318 _struct_ref_seq.db_align_beg 387924 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 387995 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 3 _struct_ref_seq.pdbx_auth_seq_align_end 74 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 22MW GTP A 1 ? GB 47118318 ? ? 'expression tag' 1 1 1 22MW G A 2 ? GB 47118318 ? ? 'expression tag' 2 2 1 22MW G A 9 ? GB 47118318 A 387930 'engineered mutation' 9 3 1 22MW C A 55 ? GB 47118318 U 387976 'engineered mutation' 55 4 1 22MW U A 75 ? GB 47118318 ? ? 'expression tag' 75 5 1 22MW C A 76 ? GB 47118318 ? ? 'expression tag' 76 6 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 460 ? 1 MORE -10 ? 1 'SSA (A^2)' 13360 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.564 ? ? metalc1 metalc ? ? A A 56 OP2 ? ? ? 1_555 H MG . MG ? ? A A 56 A MG 107 1_555 ? ? ? ? ? ? ? 2.049 ? ? metalc2 metalc ? ? C 4BW . NAR ? ? ? 1_555 G MG . MG ? ? A 4BW 102 A MG 106 1_555 ? ? ? ? ? ? ? 2.328 ? ? metalc3 metalc ? ? D 4BW . NAR ? ? ? 1_555 G MG . MG ? ? A 4BW 103 A MG 106 3_554 ? ? ? ? ? ? ? 2.266 ? ? metalc4 metalc ? ? E MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 104 A HOH 203 1_555 ? ? ? ? ? ? ? 2.137 ? ? metalc5 metalc ? ? E MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 104 A HOH 219 1_555 ? ? ? ? ? ? ? 1.957 ? ? metalc6 metalc ? ? F MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 105 A HOH 218 1_555 ? ? ? ? ? ? ? 2.353 ? ? metalc7 metalc ? ? F MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 105 A HOH 222 1_555 ? ? ? ? ? ? ? 2.064 ? ? metalc8 metalc ? ? F MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 105 A HOH 224 1_555 ? ? ? ? ? ? ? 2.005 ? ? metalc9 metalc ? ? G MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 106 A HOH 204 3_544 ? ? ? ? ? ? ? 2.203 ? ? metalc10 metalc ? ? G MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 106 A HOH 205 1_555 ? ? ? ? ? ? ? 2.220 ? ? metalc11 metalc ? ? G MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 106 A HOH 209 1_555 ? ? ? ? ? ? ? 2.116 ? ? metalc12 metalc ? ? G MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 106 A HOH 221 1_555 ? ? ? ? ? ? ? 1.939 ? ? metalc13 metalc ? ? H MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 107 A HOH 210 1_555 ? ? ? ? ? ? ? 2.161 ? ? metalc14 metalc ? ? H MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 107 A HOH 211 1_555 ? ? ? ? ? ? ? 2.080 ? ? metalc15 metalc ? ? H MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 107 A HOH 214 1_555 ? ? ? ? ? ? ? 2.396 ? ? metalc16 metalc ? ? H MG . MG ? ? ? 1_555 I HOH . O ? ? A MG 107 A HOH 215 1_555 ? ? ? ? ? ? ? 2.079 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 76 N3 ? ? A GTP 1 A C 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 76 O2 ? ? A GTP 1 A C 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 76 N4 ? ? A GTP 1 A C 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A U 75 O2 ? ? A G 2 A U 75 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 75 N3 ? ? A G 2 A U 75 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A U 3 O4 ? ? ? 1_555 A C 74 N4 ? ? A U 3 A C 74 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog7 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 73 N3 ? ? A A 4 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 73 O4 ? ? A A 4 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 72 N3 ? ? A G 5 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 72 O2 ? ? A G 5 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 72 N4 ? ? A G 5 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 71 N3 ? ? A G 6 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 71 O2 ? ? A G 6 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 71 N4 ? ? A G 6 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 7 N1 ? ? ? 1_555 A C 70 N3 ? ? A G 7 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 7 N2 ? ? ? 1_555 A C 70 O2 ? ? A G 7 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 7 O6 ? ? ? 1_555 A C 70 N4 ? ? A G 7 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 8 N1 ? ? ? 1_555 A G 69 N1 ? ? A A 8 A G 69 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog19 hydrog ? ? A A 8 N6 ? ? ? 1_555 A G 69 O6 ? ? A A 8 A G 69 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog20 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 55 N3 ? ? A G 9 A C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 55 O2 ? ? A G 9 A C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 55 N4 ? ? A G 9 A C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 54 N3 ? ? A G 10 A C 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 54 O2 ? ? A G 10 A C 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 54 N4 ? ? A G 10 A C 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 53 N1 ? ? A C 11 A G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 53 O6 ? ? A C 11 A G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 53 N2 ? ? A C 11 A G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 15 N2 ? ? ? 1_555 A A 52 N7 ? ? A G 15 A A 52 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog30 hydrog ? ? A G 15 N3 ? ? ? 1_555 A A 52 N6 ? ? A G 15 A A 52 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog31 hydrog ? ? A A 16 N6 ? ? ? 1_555 A G 51 N3 ? ? A A 16 A G 51 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog32 hydrog ? ? A A 16 N7 ? ? ? 1_555 A G 51 N2 ? ? A A 16 A G 51 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog33 hydrog ? ? A A 17 N6 ? ? ? 1_555 A G 50 N3 ? ? A A 17 A G 50 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog34 hydrog ? ? A A 17 N7 ? ? ? 1_555 A G 50 N2 ? ? A A 17 A G 50 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog35 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 49 O2 ? ? A G 18 A U 49 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 49 N3 ? ? A G 18 A U 49 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog37 hydrog ? ? A C 19 N3 ? ? ? 1_555 A G 48 N1 ? ? A C 19 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 19 N4 ? ? ? 1_555 A G 48 O6 ? ? A C 19 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 48 N2 ? ? A C 19 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 20 N1 ? ? ? 1_555 A U 47 N3 ? ? A A 20 A U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 20 N6 ? ? ? 1_555 A U 47 O4 ? ? A A 20 A U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 46 N1 ? ? A U 21 A A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A U 21 O4 ? ? ? 1_555 A A 46 N6 ? ? A U 21 A A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 22 N1 ? ? ? 1_555 A U 45 N3 ? ? A A 22 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A A 22 N6 ? ? ? 1_555 A U 45 O4 ? ? A A 22 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 23 N1 ? ? ? 1_555 A U 44 O2 ? ? A G 23 A U 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog47 hydrog ? ? A G 23 O6 ? ? ? 1_555 A U 44 N3 ? ? A G 23 A U 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog48 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 43 N1 ? ? A C 24 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 43 O6 ? ? A C 24 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 43 N2 ? ? A C 24 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 42 N1 ? ? A C 25 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 42 O6 ? ? A C 25 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 42 N2 ? ? A C 25 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A U 26 N3 ? ? ? 1_555 A G 41 O6 ? ? A U 26 A G 41 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog55 hydrog ? ? A U 26 O2 ? ? ? 1_555 A G 41 N1 ? ? A U 26 A G 41 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog56 hydrog ? ? A A 29 N6 ? ? ? 1_555 A U 40 O2 ? ? A A 29 A U 40 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog57 hydrog ? ? A A 29 N7 ? ? ? 1_555 A U 40 N3 ? ? A A 29 A U 40 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog58 hydrog ? ? A A 29 N1 ? ? ? 1_555 A G 41 N2 ? ? A A 29 A G 41 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog59 hydrog ? ? A A 29 N6 ? ? ? 1_555 A G 41 N3 ? ? A A 29 A G 41 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog60 hydrog ? ? A A 31 N6 ? ? ? 1_555 A A 37 N7 ? ? A A 31 A A 37 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog61 hydrog ? ? A A 31 N7 ? ? ? 1_555 A A 37 N6 ? ? A A 31 A A 37 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog62 hydrog ? ? A U 32 N3 ? ? ? 1_555 A A 64 N1 ? ? A U 32 A A 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A U 32 O4 ? ? ? 1_555 A A 64 N6 ? ? A U 32 A A 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 33 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 33 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 33 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 33 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 33 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 33 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 66 N3 ? ? A G 34 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 66 O2 ? ? A G 34 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 66 N4 ? ? A G 34 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 35 N1 ? ? ? 1_555 A U 63 N3 ? ? A A 35 A U 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 35 N6 ? ? ? 1_555 A U 63 O4 ? ? A A 35 A U 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 36 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 36 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 36 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 36 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 36 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 36 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A A 37 N1 ? ? ? 1_555 A U 61 N3 ? ? A A 37 A U 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A A 37 N6 ? ? ? 1_555 A U 61 O4 ? ? A A 37 A U 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A C 38 N3 ? ? ? 1_555 A G 60 N1 ? ? A C 38 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A C 38 N4 ? ? ? 1_555 A G 60 O6 ? ? A C 38 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 38 O2 ? ? ? 1_555 A G 60 N2 ? ? A C 38 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A U 39 N3 ? ? ? 1_555 A A 59 N1 ? ? A U 39 A A 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A U 39 O4 ? ? ? 1_555 A A 59 N6 ? ? A U 39 A A 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A A 56 N6 ? ? ? 1_555 A U 63 O4 ? ? A A 56 A U 63 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog83 hydrog ? ? A A 65 N3 ? ? ? 1_555 A C 67 N4 ? ? A A 65 A C 67 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP2 ? A A 56 ? A A 56 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 210 ? 1_555 85.6 ? 2 OP2 ? A A 56 ? A A 56 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 211 ? 1_555 176.6 ? 3 O ? I HOH . ? A HOH 210 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 211 ? 1_555 91.6 ? 4 OP2 ? A A 56 ? A A 56 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 214 ? 1_555 104.3 ? 5 O ? I HOH . ? A HOH 210 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 214 ? 1_555 167.9 ? 6 O ? I HOH . ? A HOH 211 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 214 ? 1_555 78.7 ? 7 OP2 ? A A 56 ? A A 56 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 215 ? 1_555 83.9 ? 8 O ? I HOH . ? A HOH 210 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 215 ? 1_555 94.7 ? 9 O ? I HOH . ? A HOH 211 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 215 ? 1_555 94.6 ? 10 O ? I HOH . ? A HOH 214 ? 1_555 MG ? H MG . ? A MG 107 ? 1_555 O ? I HOH . ? A HOH 215 ? 1_555 93.3 ? 11 NAR ? C 4BW . ? A 4BW 102 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 NAR ? D 4BW . ? A 4BW 103 ? 1_555 122.7 ? 12 NAR ? C 4BW . ? A 4BW 102 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 204 ? 3_544 86.7 ? 13 NAR ? D 4BW . ? A 4BW 103 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 204 ? 3_544 39.9 ? 14 NAR ? C 4BW . ? A 4BW 102 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 205 ? 1_555 84.2 ? 15 NAR ? D 4BW . ? A 4BW 103 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 205 ? 1_555 149.7 ? 16 O ? I HOH . ? A HOH 204 ? 3_544 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 205 ? 1_555 170.4 ? 17 NAR ? C 4BW . ? A 4BW 102 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 209 ? 1_555 171.2 ? 18 NAR ? D 4BW . ? A 4BW 103 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 209 ? 1_555 65.0 ? 19 O ? I HOH . ? A HOH 204 ? 3_544 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 209 ? 1_555 99.2 ? 20 O ? I HOH . ? A HOH 205 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 209 ? 1_555 89.5 ? 21 NAR ? C 4BW . ? A 4BW 102 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 221 ? 1_555 97.0 ? 22 NAR ? D 4BW . ? A 4BW 103 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 221 ? 1_555 72.0 ? 23 O ? I HOH . ? A HOH 204 ? 3_544 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 221 ? 1_555 91.5 ? 24 O ? I HOH . ? A HOH 205 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 221 ? 1_555 92.6 ? 25 O ? I HOH . ? A HOH 209 ? 1_555 MG ? G MG . ? A MG 106 ? 1_555 O ? I HOH . ? A HOH 221 ? 1_555 89.4 ? 26 O ? I HOH . ? A HOH 203 ? 1_555 MG ? E MG . ? A MG 104 ? 1_555 O ? I HOH . ? A HOH 219 ? 1_555 101.2 ? 27 O ? I HOH . ? A HOH 218 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? I HOH . ? A HOH 222 ? 1_555 90.5 ? 28 O ? I HOH . ? A HOH 218 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? I HOH . ? A HOH 224 ? 1_555 147.6 ? 29 O ? I HOH . ? A HOH 222 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? I HOH . ? A HOH 224 ? 1_555 72.4 ? # _pdbx_entry_details.entry_id 22MW _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 OP1 A A 56 ? ? O A HOH 201 ? ? 2.01 2 1 OP2 A C 57 ? ? O A HOH 201 ? ? 2.12 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O3'" A GTP 1 ? ? P A G 2 ? ? "O5'" A G 2 ? ? 85.97 104.00 -18.03 1.90 Y 2 1 "O3'" A GTP 1 ? ? P A G 2 ? ? OP2 A G 2 ? ? 145.24 110.50 34.74 1.10 Y 3 1 "O3'" A GTP 1 ? ? P A G 2 ? ? OP1 A G 2 ? ? 81.37 105.20 -23.83 2.20 Y 4 1 C5 A C 24 ? ? C4 A C 24 ? ? N4 A C 24 ? ? 124.43 120.20 4.23 0.70 N 5 1 C5 A U 27 ? ? C6 A U 27 ? ? N1 A U 27 ? ? 118.53 122.70 -4.17 0.50 N 6 1 "O5'" A G 51 ? ? P A G 51 ? ? OP2 A G 51 ? ? 99.81 105.70 -5.89 0.90 N 7 1 "O3'" A G 51 ? ? P A A 52 ? ? OP1 A A 52 ? ? 117.39 110.50 6.89 1.10 Y # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 4BW OAC O N N 1 4BW CBC C N N 2 4BW NAT N N N 3 4BW CBA C N N 4 4BW NAA N N N 5 4BW NAS N N N 6 4BW CBG C Y N 7 4BW CBE C Y N 8 4BW NAR N Y N 9 4BW CAL C Y N 10 4BW NBQ N Y N 11 4BW CBO C N R 12 4BW CBI C N R 13 4BW OAG O N N 14 4BW OAX O N N 15 4BW CBK C N R 16 4BW CAN C N N 17 4BW OAV O N N 18 4BW PBR P N N 19 4BW "O3'" O N N 20 4BW OAH O N N 21 4BW OAD O N N 22 4BW CBM C N S 23 4BW OAZ O N N 24 4BW PBS P N N 25 4BW OAI O N N 26 4BW OAE O N N 27 4BW "O5'" O N N 28 4BW "C5'" C N N 29 4BW "C4'" C N R 30 4BW "O4'" O N N 31 4BW "C3'" C N S 32 4BW "C2'" C N R 33 4BW "O2'" O N N 34 4BW "C1'" C N R 35 4BW N9 N Y N 36 4BW C8 C Y N 37 4BW N7 N Y N 38 4BW C5 C Y N 39 4BW C4 C Y N 40 4BW N3 N Y N 41 4BW C2 C Y N 42 4BW N1 N Y N 43 4BW C6 C Y N 44 4BW N6 N N N 45 4BW H1 H N N 46 4BW H2 H N N 47 4BW H3 H N N 48 4BW H4 H N N 49 4BW H5 H N N 50 4BW H6 H N N 51 4BW H7 H N N 52 4BW H8 H N N 53 4BW H9 H N N 54 4BW H10 H N N 55 4BW H11 H N N 56 4BW H12 H N N 57 4BW H13 H N N 58 4BW H14 H N N 59 4BW H15 H N N 60 4BW H16 H N N 61 4BW H17 H N N 62 4BW H18 H N N 63 4BW H19 H N N 64 4BW H20 H N N 65 4BW H21 H N N 66 4BW H22 H N N 67 4BW H23 H N N 68 4BW H24 H N N 69 A OP3 O N N 70 A P P N N 71 A OP1 O N N 72 A OP2 O N N 73 A "O5'" O N N 74 A "C5'" C N N 75 A "C4'" C N R 76 A "O4'" O N N 77 A "C3'" C N S 78 A "O3'" O N N 79 A "C2'" C N R 80 A "O2'" O N N 81 A "C1'" C N R 82 A N9 N Y N 83 A C8 C Y N 84 A N7 N Y N 85 A C5 C Y N 86 A C6 C Y N 87 A N6 N N N 88 A N1 N Y N 89 A C2 C Y N 90 A N3 N Y N 91 A C4 C Y N 92 A HOP3 H N N 93 A HOP2 H N N 94 A "H5'" H N N 95 A "H5''" H N N 96 A "H4'" H N N 97 A "H3'" H N N 98 A "HO3'" H N N 99 A "H2'" H N N 100 A "HO2'" H N N 101 A "H1'" H N N 102 A H8 H N N 103 A H61 H N N 104 A H62 H N N 105 A H2 H N N 106 C OP3 O N N 107 C P P N N 108 C OP1 O N N 109 C OP2 O N N 110 C "O5'" O N N 111 C "C5'" C N N 112 C "C4'" C N R 113 C "O4'" O N N 114 C "C3'" C N S 115 C "O3'" O N N 116 C "C2'" C N R 117 C "O2'" O N N 118 C "C1'" C N R 119 C N1 N N N 120 C C2 C N N 121 C O2 O N N 122 C N3 N N N 123 C C4 C N N 124 C N4 N N N 125 C C5 C N N 126 C C6 C N N 127 C HOP3 H N N 128 C HOP2 H N N 129 C "H5'" H N N 130 C "H5''" H N N 131 C "H4'" H N N 132 C "H3'" H N N 133 C "HO3'" H N N 134 C "H2'" H N N 135 C "HO2'" H N N 136 C "H1'" H N N 137 C H41 H N N 138 C H42 H N N 139 C H5 H N N 140 C H6 H N N 141 G OP3 O N N 142 G P P N N 143 G OP1 O N N 144 G OP2 O N N 145 G "O5'" O N N 146 G "C5'" C N N 147 G "C4'" C N R 148 G "O4'" O N N 149 G "C3'" C N S 150 G "O3'" O N N 151 G "C2'" C N R 152 G "O2'" O N N 153 G "C1'" C N R 154 G N9 N Y N 155 G C8 C Y N 156 G N7 N Y N 157 G C5 C Y N 158 G C6 C N N 159 G O6 O N N 160 G N1 N N N 161 G C2 C N N 162 G N2 N N N 163 G N3 N N N 164 G C4 C Y N 165 G HOP3 H N N 166 G HOP2 H N N 167 G "H5'" H N N 168 G "H5''" H N N 169 G "H4'" H N N 170 G "H3'" H N N 171 G "HO3'" H N N 172 G "H2'" H N N 173 G "HO2'" H N N 174 G "H1'" H N N 175 G H8 H N N 176 G H1 H N N 177 G H21 H N N 178 G H22 H N N 179 GTP PG P N N 180 GTP O1G O N N 181 GTP O2G O N N 182 GTP O3G O N N 183 GTP O3B O N N 184 GTP PB P N N 185 GTP O1B O N N 186 GTP O2B O N N 187 GTP O3A O N N 188 GTP PA P N N 189 GTP O1A O N N 190 GTP O2A O N N 191 GTP "O5'" O N N 192 GTP "C5'" C N N 193 GTP "C4'" C N R 194 GTP "O4'" O N N 195 GTP "C3'" C N S 196 GTP "O3'" O N N 197 GTP "C2'" C N R 198 GTP "O2'" O N N 199 GTP "C1'" C N R 200 GTP N9 N Y N 201 GTP C8 C Y N 202 GTP N7 N Y N 203 GTP C5 C Y N 204 GTP C6 C N N 205 GTP O6 O N N 206 GTP N1 N N N 207 GTP C2 C N N 208 GTP N2 N N N 209 GTP N3 N N N 210 GTP C4 C Y N 211 GTP HOG2 H N N 212 GTP HOG3 H N N 213 GTP HOB2 H N N 214 GTP HOA2 H N N 215 GTP "H5'" H N N 216 GTP "H5''" H N N 217 GTP "H4'" H N N 218 GTP "H3'" H N N 219 GTP "HO3'" H N N 220 GTP "H2'" H N N 221 GTP "HO2'" H N N 222 GTP "H1'" H N N 223 GTP H8 H N N 224 GTP HN1 H N N 225 GTP HN21 H N N 226 GTP HN22 H N N 227 HOH O O N N 228 HOH H1 H N N 229 HOH H2 H N N 230 MG MG MG N N 231 U OP3 O N N 232 U P P N N 233 U OP1 O N N 234 U OP2 O N N 235 U "O5'" O N N 236 U "C5'" C N N 237 U "C4'" C N R 238 U "O4'" O N N 239 U "C3'" C N S 240 U "O3'" O N N 241 U "C2'" C N R 242 U "O2'" O N N 243 U "C1'" C N R 244 U N1 N N N 245 U C2 C N N 246 U O2 O N N 247 U N3 N N N 248 U C4 C N N 249 U O4 O N N 250 U C5 C N N 251 U C6 C N N 252 U HOP3 H N N 253 U HOP2 H N N 254 U "H5'" H N N 255 U "H5''" H N N 256 U "H4'" H N N 257 U "H3'" H N N 258 U "HO3'" H N N 259 U "H2'" H N N 260 U "HO2'" H N N 261 U "H1'" H N N 262 U H3 H N N 263 U H5 H N N 264 U H6 H N N 265 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 4BW NAA CBA sing N N 1 4BW CBA NAS doub N N 2 4BW CBA NAT sing N N 3 4BW NAS CBG sing N N 4 4BW NAT CBC sing N N 5 4BW OAG CBI sing N N 6 4BW CBG NBQ sing Y N 7 4BW CBG CBE doub Y N 8 4BW CBC CBE sing N N 9 4BW CBC OAC doub N N 10 4BW OAI PBS doub N N 11 4BW CBI CBO sing N N 12 4BW CBI CBM sing N N 13 4BW CBO NBQ sing N N 14 4BW CBO OAX sing N N 15 4BW NBQ CAL sing Y N 16 4BW CBE NAR sing Y N 17 4BW OAE PBS sing N N 18 4BW OAX CBK sing N N 19 4BW PBS OAZ sing N N 20 4BW PBS "O5'" sing N N 21 4BW OAZ CBM sing N N 22 4BW CBM CBK sing N N 23 4BW CAL NAR doub Y N 24 4BW CBK CAN sing N N 25 4BW N6 C6 sing N N 26 4BW N7 C8 doub Y N 27 4BW N7 C5 sing Y N 28 4BW "O5'" "C5'" sing N N 29 4BW C8 N9 sing Y N 30 4BW C6 C5 doub Y N 31 4BW C6 N1 sing Y N 32 4BW C5 C4 sing Y N 33 4BW CAN OAV sing N N 34 4BW "C5'" "C4'" sing N N 35 4BW OAV PBR sing N N 36 4BW N9 C4 sing Y N 37 4BW N9 "C1'" sing N N 38 4BW N1 C2 doub Y N 39 4BW C4 N3 doub Y N 40 4BW "O4'" "C4'" sing N N 41 4BW "O4'" "C1'" sing N N 42 4BW "C4'" "C3'" sing N N 43 4BW "C3'" "C2'" sing N N 44 4BW "C3'" "O3'" sing N N 45 4BW "C1'" "C2'" sing N N 46 4BW C2 N3 sing Y N 47 4BW PBR OAD doub N N 48 4BW PBR "O3'" sing N N 49 4BW PBR OAH sing N N 50 4BW "C2'" "O2'" sing N N 51 4BW NAT H1 sing N N 52 4BW NAA H2 sing N N 53 4BW NAA H3 sing N N 54 4BW CAL H4 sing N N 55 4BW CBO H5 sing N N 56 4BW CBI H6 sing N N 57 4BW OAG H7 sing N N 58 4BW CBK H8 sing N N 59 4BW CAN H9 sing N N 60 4BW CAN H10 sing N N 61 4BW OAH H11 sing N N 62 4BW CBM H12 sing N N 63 4BW OAE H13 sing N N 64 4BW "C5'" H14 sing N N 65 4BW "C5'" H15 sing N N 66 4BW "C4'" H16 sing N N 67 4BW "C3'" H17 sing N N 68 4BW "C2'" H18 sing N N 69 4BW "O2'" H19 sing N N 70 4BW "C1'" H20 sing N N 71 4BW C8 H21 sing N N 72 4BW C2 H22 sing N N 73 4BW N6 H23 sing N N 74 4BW N6 H24 sing N N 75 A OP3 P sing N N 76 A OP3 HOP3 sing N N 77 A P OP1 doub N N 78 A P OP2 sing N N 79 A P "O5'" sing N N 80 A OP2 HOP2 sing N N 81 A "O5'" "C5'" sing N N 82 A "C5'" "C4'" sing N N 83 A "C5'" "H5'" sing N N 84 A "C5'" "H5''" sing N N 85 A "C4'" "O4'" sing N N 86 A "C4'" "C3'" sing N N 87 A "C4'" "H4'" sing N N 88 A "O4'" "C1'" sing N N 89 A "C3'" "O3'" sing N N 90 A "C3'" "C2'" sing N N 91 A "C3'" "H3'" sing N N 92 A "O3'" "HO3'" sing N N 93 A "C2'" "O2'" sing N N 94 A "C2'" "C1'" sing N N 95 A "C2'" "H2'" sing N N 96 A "O2'" "HO2'" sing N N 97 A "C1'" N9 sing N N 98 A "C1'" "H1'" sing N N 99 A N9 C8 sing Y N 100 A N9 C4 sing Y N 101 A C8 N7 doub Y N 102 A C8 H8 sing N N 103 A N7 C5 sing Y N 104 A C5 C6 sing Y N 105 A C5 C4 doub Y N 106 A C6 N6 sing N N 107 A C6 N1 doub Y N 108 A N6 H61 sing N N 109 A N6 H62 sing N N 110 A N1 C2 sing Y N 111 A C2 N3 doub Y N 112 A C2 H2 sing N N 113 A N3 C4 sing Y N 114 C OP3 P sing N N 115 C OP3 HOP3 sing N N 116 C P OP1 doub N N 117 C P OP2 sing N N 118 C P "O5'" sing N N 119 C OP2 HOP2 sing N N 120 C "O5'" "C5'" sing N N 121 C "C5'" "C4'" sing N N 122 C "C5'" "H5'" sing N N 123 C "C5'" "H5''" sing N N 124 C "C4'" "O4'" sing N N 125 C "C4'" "C3'" sing N N 126 C "C4'" "H4'" sing N N 127 C "O4'" "C1'" sing N N 128 C "C3'" "O3'" sing N N 129 C "C3'" "C2'" sing N N 130 C "C3'" "H3'" sing N N 131 C "O3'" "HO3'" sing N N 132 C "C2'" "O2'" sing N N 133 C "C2'" "C1'" sing N N 134 C "C2'" "H2'" sing N N 135 C "O2'" "HO2'" sing N N 136 C "C1'" N1 sing N N 137 C "C1'" "H1'" sing N N 138 C N1 C2 sing N N 139 C N1 C6 sing N N 140 C C2 O2 doub N N 141 C C2 N3 sing N N 142 C N3 C4 doub N N 143 C C4 N4 sing N N 144 C C4 C5 sing N N 145 C N4 H41 sing N N 146 C N4 H42 sing N N 147 C C5 C6 doub N N 148 C C5 H5 sing N N 149 C C6 H6 sing N N 150 G OP3 P sing N N 151 G OP3 HOP3 sing N N 152 G P OP1 doub N N 153 G P OP2 sing N N 154 G P "O5'" sing N N 155 G OP2 HOP2 sing N N 156 G "O5'" "C5'" sing N N 157 G "C5'" "C4'" sing N N 158 G "C5'" "H5'" sing N N 159 G "C5'" "H5''" sing N N 160 G "C4'" "O4'" sing N N 161 G "C4'" "C3'" sing N N 162 G "C4'" "H4'" sing N N 163 G "O4'" "C1'" sing N N 164 G "C3'" "O3'" sing N N 165 G "C3'" "C2'" sing N N 166 G "C3'" "H3'" sing N N 167 G "O3'" "HO3'" sing N N 168 G "C2'" "O2'" sing N N 169 G "C2'" "C1'" sing N N 170 G "C2'" "H2'" sing N N 171 G "O2'" "HO2'" sing N N 172 G "C1'" N9 sing N N 173 G "C1'" "H1'" sing N N 174 G N9 C8 sing Y N 175 G N9 C4 sing Y N 176 G C8 N7 doub Y N 177 G C8 H8 sing N N 178 G N7 C5 sing Y N 179 G C5 C6 sing N N 180 G C5 C4 doub Y N 181 G C6 O6 doub N N 182 G C6 N1 sing N N 183 G N1 C2 sing N N 184 G N1 H1 sing N N 185 G C2 N2 sing N N 186 G C2 N3 doub N N 187 G N2 H21 sing N N 188 G N2 H22 sing N N 189 G N3 C4 sing N N 190 GTP PG O1G doub N N 191 GTP PG O2G sing N N 192 GTP PG O3G sing N N 193 GTP PG O3B sing N N 194 GTP O2G HOG2 sing N N 195 GTP O3G HOG3 sing N N 196 GTP O3B PB sing N N 197 GTP PB O1B doub N N 198 GTP PB O2B sing N N 199 GTP PB O3A sing N N 200 GTP O2B HOB2 sing N N 201 GTP O3A PA sing N N 202 GTP PA O1A doub N N 203 GTP PA O2A sing N N 204 GTP PA "O5'" sing N N 205 GTP O2A HOA2 sing N N 206 GTP "O5'" "C5'" sing N N 207 GTP "C5'" "C4'" sing N N 208 GTP "C5'" "H5'" sing N N 209 GTP "C5'" "H5''" sing N N 210 GTP "C4'" "O4'" sing N N 211 GTP "C4'" "C3'" sing N N 212 GTP "C4'" "H4'" sing N N 213 GTP "O4'" "C1'" sing N N 214 GTP "C3'" "O3'" sing N N 215 GTP "C3'" "C2'" sing N N 216 GTP "C3'" "H3'" sing N N 217 GTP "O3'" "HO3'" sing N N 218 GTP "C2'" "O2'" sing N N 219 GTP "C2'" "C1'" sing N N 220 GTP "C2'" "H2'" sing N N 221 GTP "O2'" "HO2'" sing N N 222 GTP "C1'" N9 sing N N 223 GTP "C1'" "H1'" sing N N 224 GTP N9 C8 sing Y N 225 GTP N9 C4 sing Y N 226 GTP C8 N7 doub Y N 227 GTP C8 H8 sing N N 228 GTP N7 C5 sing Y N 229 GTP C5 C6 sing N N 230 GTP C5 C4 doub Y N 231 GTP C6 O6 doub N N 232 GTP C6 N1 sing N N 233 GTP N1 C2 sing N N 234 GTP N1 HN1 sing N N 235 GTP C2 N2 sing N N 236 GTP C2 N3 doub N N 237 GTP N2 HN21 sing N N 238 GTP N2 HN22 sing N N 239 GTP N3 C4 sing N N 240 HOH O H1 sing N N 241 HOH O H2 sing N N 242 U OP3 P sing N N 243 U OP3 HOP3 sing N N 244 U P OP1 doub N N 245 U P OP2 sing N N 246 U P "O5'" sing N N 247 U OP2 HOP2 sing N N 248 U "O5'" "C5'" sing N N 249 U "C5'" "C4'" sing N N 250 U "C5'" "H5'" sing N N 251 U "C5'" "H5''" sing N N 252 U "C4'" "O4'" sing N N 253 U "C4'" "C3'" sing N N 254 U "C4'" "H4'" sing N N 255 U "O4'" "C1'" sing N N 256 U "C3'" "O3'" sing N N 257 U "C3'" "C2'" sing N N 258 U "C3'" "H3'" sing N N 259 U "O3'" "HO3'" sing N N 260 U "C2'" "O2'" sing N N 261 U "C2'" "C1'" sing N N 262 U "C2'" "H2'" sing N N 263 U "O2'" "HO2'" sing N N 264 U "C1'" N1 sing N N 265 U "C1'" "H1'" sing N N 266 U N1 C2 sing N N 267 U N1 C6 sing N N 268 U C2 O2 doub N N 269 U C2 N3 sing N N 270 U N3 C4 sing N N 271 U N3 H3 sing N N 272 U C4 O4 doub N N 273 U C4 C5 sing N N 274 U C5 C6 doub N N 275 U C5 H5 sing N N 276 U C6 H6 sing N N 277 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 22MW 'double helix' 22MW 'a-form double helix' 22MW 'bulge loop' 22MW 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 76 1_555 0.472 -0.110 -0.125 -2.779 -5.935 -2.980 1 A_GTP1:C76_A A 1 ? A 76 ? 19 1 1 A G 2 1_555 A U 75 1_555 -2.715 -0.558 0.090 4.480 -12.872 7.041 2 A_G2:U75_A A 2 ? A 75 ? 28 1 1 A U 3 1_555 A C 74 1_555 -0.831 -0.763 -0.253 1.090 -18.491 -11.049 3 A_U3:C74_A A 3 ? A 74 ? ? ? 1 A A 4 1_555 A U 73 1_555 0.207 -0.307 0.329 -5.338 -8.273 2.744 4 A_A4:U73_A A 4 ? A 73 ? 20 1 1 A G 5 1_555 A C 72 1_555 0.221 -0.321 0.189 -7.560 -9.012 -0.586 5 A_G5:C72_A A 5 ? A 72 ? 19 1 1 A G 6 1_555 A C 71 1_555 0.162 -0.189 0.193 -5.251 -9.673 -2.052 6 A_G6:C71_A A 6 ? A 71 ? 19 1 1 A G 7 1_555 A C 70 1_555 -0.090 0.024 -0.157 -13.844 -16.571 -3.626 7 A_G7:C70_A A 7 ? A 70 ? 19 1 1 A A 8 1_555 A G 69 1_555 -0.060 1.612 -0.329 -14.368 -9.714 -15.205 8 A_A8:G69_A A 8 ? A 69 ? 8 1 1 A G 9 1_555 A C 55 1_555 -0.438 -0.202 -0.354 -7.719 5.676 -1.731 9 A_G9:C55_A A 9 ? A 55 ? 19 1 1 A G 10 1_555 A C 54 1_555 -0.205 -0.240 -0.330 -6.749 -5.219 0.832 10 A_G10:C54_A A 10 ? A 54 ? 19 1 1 A C 11 1_555 A G 53 1_555 0.247 -0.251 -0.137 0.887 1.699 1.401 11 A_C11:G53_A A 11 ? A 53 ? 19 1 1 A G 15 1_555 A A 52 1_555 6.337 -4.208 0.282 25.190 29.368 5.374 12 A_G15:A52_A A 15 ? A 52 ? 11 9 1 A A 16 1_555 A G 51 1_555 -6.618 -4.794 0.101 -32.133 -5.850 -7.252 13 A_A16:G51_A A 16 ? A 51 ? 11 10 1 A A 17 1_555 A G 50 1_555 -6.773 -4.169 -0.366 6.078 -9.057 -3.002 14 A_A17:G50_A A 17 ? A 50 ? 11 10 1 A G 18 1_555 A U 49 1_555 -2.574 -0.663 0.006 9.100 -19.396 2.244 15 A_G18:U49_A A 18 ? A 49 ? 28 1 1 A C 19 1_555 A G 48 1_555 0.213 -0.105 -0.050 2.259 -21.605 3.488 16 A_C19:G48_A A 19 ? A 48 ? 19 1 1 A A 20 1_555 A U 47 1_555 0.001 -0.208 0.323 -5.577 -10.666 1.278 17 A_A20:U47_A A 20 ? A 47 ? 20 1 1 A U 21 1_555 A A 46 1_555 0.053 -0.056 -0.193 0.404 -15.319 5.792 18 A_U21:A46_A A 21 ? A 46 ? 20 1 1 A A 22 1_555 A U 45 1_555 0.012 -0.273 -0.071 -0.744 -11.139 0.416 19 A_A22:U45_A A 22 ? A 45 ? 20 1 1 A G 23 1_555 A U 44 1_555 -2.072 -0.497 0.422 8.603 -6.002 -1.625 20 A_G23:U44_A A 23 ? A 44 ? 28 1 1 A C 24 1_555 A G 43 1_555 0.217 -0.165 0.084 9.489 -14.234 -0.548 21 A_C24:G43_A A 24 ? A 43 ? 19 1 1 A C 25 1_555 A G 42 1_555 0.332 -0.288 0.297 1.734 -12.428 -0.570 22 A_C25:G42_A A 25 ? A 42 ? 19 1 1 A U 26 1_555 A G 41 1_555 2.267 -0.514 0.543 -7.212 -16.237 -4.101 23 A_U26:G41_A A 26 ? A 41 ? 28 1 1 A A 29 1_555 A U 40 1_555 -4.127 -1.893 -0.327 -3.506 -4.714 -99.107 24 A_A29:U40_A A 29 ? A 40 ? 24 4 1 A A 59 1_555 A U 39 1_555 0.092 -0.124 0.530 10.833 -13.387 2.614 25 A_A59:U39_A A 59 ? A 39 ? 20 1 1 A G 60 1_555 A C 38 1_555 -0.249 -0.155 0.388 4.316 -14.866 0.741 26 A_G60:C38_A A 60 ? A 38 ? 19 1 1 A U 61 1_555 A A 37 1_555 -0.062 -0.040 0.286 0.446 -24.349 3.940 27 A_U61:A37_A A 61 ? A 37 ? 20 1 1 A G 62 1_555 A C 36 1_555 -0.081 -0.108 0.256 -4.332 -13.453 -3.118 28 A_G62:C36_A A 62 ? A 36 ? 19 1 1 A U 63 1_555 A A 35 1_555 -0.316 0.054 -0.204 -6.521 9.255 3.649 29 A_U63:A35_A A 63 ? A 35 ? 20 1 1 A A 64 1_555 A U 32 1_555 0.127 0.090 0.006 -4.507 -7.886 -1.631 30 A_A64:U32_A A 64 ? A 32 ? 20 1 1 A C 66 1_555 A G 34 1_555 -0.223 0.101 0.074 14.501 -8.472 8.754 31 A_C66:G34_A A 66 ? A 34 ? 19 1 1 A C 67 1_555 A G 33 1_555 0.603 -0.162 0.184 1.034 -14.627 0.888 32 A_C67:G33_A A 67 ? A 33 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 76 1_555 A G 2 1_555 A U 75 1_555 0.305 -1.934 2.812 -7.785 13.572 18.496 -7.470 -2.363 0.984 35.156 20.165 24.182 1 AA_GTP1G2:U75C76_AA A 1 ? A 76 ? A 2 ? A 75 ? 1 A G 2 1_555 A U 75 1_555 A U 3 1_555 A C 74 1_555 -0.958 -1.736 3.379 -2.072 6.718 39.171 -3.329 1.169 3.096 9.923 3.060 39.772 2 AA_G2U3:C74U75_AA A 2 ? A 75 ? A 3 ? A 74 ? 1 A U 3 1_555 A C 74 1_555 A A 4 1_555 A U 73 1_555 0.962 -1.596 3.321 -1.292 7.901 37.033 -3.435 -1.642 2.898 12.264 2.005 37.859 3 AA_U3A4:U73C74_AA A 3 ? A 74 ? A 4 ? A 73 ? 1 A A 4 1_555 A U 73 1_555 A G 5 1_555 A C 72 1_555 0.055 -1.822 3.251 3.160 3.704 28.480 -4.442 0.564 2.983 7.459 -6.364 28.884 4 AA_A4G5:C72U73_AA A 4 ? A 73 ? A 5 ? A 72 ? 1 A G 5 1_555 A C 72 1_555 A G 6 1_555 A C 71 1_555 0.397 -1.808 3.181 3.227 2.432 31.612 -3.718 -0.159 3.061 4.442 -5.893 31.862 5 AA_G5G6:C71C72_AA A 5 ? A 72 ? A 6 ? A 71 ? 1 A G 6 1_555 A C 71 1_555 A G 7 1_555 A C 70 1_555 0.317 -2.154 3.483 7.219 4.790 30.576 -4.840 0.783 3.110 8.861 -13.357 31.751 6 AA_G6G7:C70C71_AA A 6 ? A 71 ? A 7 ? A 70 ? 1 A G 7 1_555 A C 70 1_555 A A 8 1_555 A G 69 1_555 -0.886 -1.251 3.131 5.005 4.514 37.237 -2.463 1.958 2.827 6.999 -7.760 37.821 7 AA_G7A8:G69C70_AA A 7 ? A 70 ? A 8 ? A 69 ? 1 A G 9 1_555 A C 55 1_555 A G 10 1_555 A C 54 1_555 -0.186 -2.119 3.507 -0.685 2.304 29.037 -4.739 0.212 3.336 4.585 1.364 29.134 8 AA_G9G10:C54C55_AA A 9 ? A 55 ? A 10 ? A 54 ? 1 A G 10 1_555 A C 54 1_555 A C 11 1_555 A G 53 1_555 -0.016 -2.194 3.162 -2.243 1.011 30.926 -4.287 -0.382 3.084 1.892 4.198 31.021 9 AA_G10C11:G53C54_AA A 10 ? A 54 ? A 11 ? A 53 ? 1 A G 15 1_555 A A 52 1_555 A A 16 1_555 A G 51 1_555 -1.454 -1.407 4.719 -7.053 -1.859 -4.203 15.156 -31.018 0.829 15.319 -58.103 -8.416 10 AA_G15A16:G51A52_AA A 15 ? A 52 ? A 16 ? A 51 ? 1 A A 16 1_555 A G 51 1_555 A A 17 1_555 A G 50 1_555 -1.249 0.011 3.108 -15.325 -2.440 24.099 0.612 -1.174 3.285 -5.210 32.721 28.601 11 AA_A16A17:G50G51_AA A 16 ? A 51 ? A 17 ? A 50 ? 1 A A 17 1_555 A G 50 1_555 A G 18 1_555 A U 49 1_555 0.403 -0.996 3.335 -10.223 3.627 55.206 -1.265 -1.010 3.155 3.872 10.914 56.179 12 AA_A17G18:U49G50_AA A 17 ? A 50 ? A 18 ? A 49 ? 1 A G 18 1_555 A U 49 1_555 A C 19 1_555 A G 48 1_555 -0.072 -1.260 3.398 -1.350 4.562 44.831 -2.062 -0.030 3.262 5.962 1.764 45.070 13 AA_G18C19:G48U49_AA A 18 ? A 49 ? A 19 ? A 48 ? 1 A C 19 1_555 A G 48 1_555 A A 20 1_555 A U 47 1_555 -0.809 -1.872 3.309 -3.328 14.640 29.606 -5.500 0.915 2.237 26.604 6.048 33.119 14 AA_C19A20:U47G48_AA A 19 ? A 48 ? A 20 ? A 47 ? 1 A A 20 1_555 A U 47 1_555 A U 21 1_555 A A 46 1_555 0.068 -1.028 3.231 5.068 9.726 29.207 -3.661 0.785 2.730 18.486 -9.633 31.157 15 AA_A20U21:A46U47_AA A 20 ? A 47 ? A 21 ? A 46 ? 1 A U 21 1_555 A A 46 1_555 A A 22 1_555 A U 45 1_555 -0.074 -1.185 3.309 -1.240 15.359 29.448 -4.479 -0.064 2.414 27.935 2.256 33.157 16 AA_U21A22:U45A46_AA A 21 ? A 46 ? A 22 ? A 45 ? 1 A A 22 1_555 A U 45 1_555 A G 23 1_555 A U 44 1_555 -0.021 -1.824 2.779 -6.576 5.846 24.098 -5.414 -1.417 2.211 13.442 15.121 25.632 17 AA_A22G23:U44U45_AA A 22 ? A 45 ? A 23 ? A 44 ? 1 A G 23 1_555 A U 44 1_555 A C 24 1_555 A G 43 1_555 -0.025 -1.350 3.330 1.655 3.421 38.923 -2.428 0.237 3.201 5.119 -2.477 39.101 18 AA_G23C24:G43U44_AA A 23 ? A 44 ? A 24 ? A 43 ? 1 A C 24 1_555 A G 43 1_555 A C 25 1_555 A G 42 1_555 -0.061 -1.877 3.375 -2.063 8.006 32.834 -4.475 -0.217 2.850 13.891 3.579 33.831 19 AA_C24C25:G42G43_AA A 24 ? A 43 ? A 25 ? A 42 ? 1 A C 25 1_555 A G 42 1_555 A U 26 1_555 A G 41 1_555 -0.264 -1.890 3.525 -1.034 5.680 38.717 -3.529 0.265 3.232 8.509 1.549 39.129 20 AA_C25U26:G41G42_AA A 25 ? A 42 ? A 26 ? A 41 ? 1 A A 29 1_555 A U 40 1_555 A A 59 1_555 A U 39 1_555 3.332 -0.860 2.882 -8.052 4.256 73.847 -0.822 -2.966 2.514 3.529 6.677 74.327 21 AA_A29A59:U39U40_AA A 29 ? A 40 ? A 59 ? A 39 ? 1 A A 59 1_555 A U 39 1_555 A G 60 1_555 A C 38 1_555 -0.041 -1.144 3.412 -0.796 2.834 32.489 -2.543 -0.069 3.303 5.053 1.420 32.618 22 AA_A59G60:C38U39_AA A 59 ? A 39 ? A 60 ? A 38 ? 1 A G 60 1_555 A C 38 1_555 A U 61 1_555 A A 37 1_555 0.065 -1.789 3.344 2.327 1.239 33.946 -3.255 0.264 3.276 2.118 -3.979 34.046 23 AA_G60U61:A37C38_AA A 60 ? A 38 ? A 61 ? A 37 ? 1 A U 61 1_555 A A 37 1_555 A G 62 1_555 A C 36 1_555 -0.464 -1.609 3.305 0.146 8.309 33.708 -3.913 0.800 2.838 14.066 -0.247 34.688 24 AA_U61G62:C36A37_AA A 61 ? A 37 ? A 62 ? A 36 ? 1 A G 62 1_555 A C 36 1_555 A U 63 1_555 A A 35 1_555 1.026 -0.910 3.416 5.557 3.389 28.921 -2.538 -0.764 3.422 6.679 -10.951 29.629 25 AA_G62U63:A35C36_AA A 62 ? A 36 ? A 63 ? A 35 ? 1 A U 63 1_555 A A 35 1_555 A A 64 1_555 A U 32 1_555 -3.316 -0.625 -0.413 -17.365 173.429 108.746 -0.166 1.674 -0.506 87.245 8.736 176.679 26 AA_U63A64:U32A35_AA A 63 ? A 35 ? A 64 ? A 32 ? 1 A A 64 1_555 A U 32 1_555 A C 66 1_555 A G 34 1_555 -3.115 -0.273 1.176 17.727 -177.524 75.699 0.318 1.603 0.692 -89.068 -8.894 178.742 27 AA_A64C66:G34U32_AA A 64 ? A 32 ? A 66 ? A 34 ? 1 A C 66 1_555 A G 34 1_555 A C 67 1_555 A G 33 1_555 0.452 -1.378 3.301 3.943 8.269 44.170 -2.526 -0.242 3.036 10.858 -5.177 45.064 28 AA_C66C67:G33G34_AA A 66 ? A 34 ? A 67 ? A 33 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 3Q3Z _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 22MW _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.031933 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.023480 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.005452 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ #