data_23JZ # _entry.id 23JZ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.413 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 23JZ pdb_000023jz 10.2210/pdb23jz/pdb WWPDB D_1300070029 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2026-05-06 ? 2 'Structure model' 1 1 2026-05-20 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_DOI' 2 2 'Structure model' '_citation.pdbx_database_id_PubMed' 3 2 'Structure model' '_citation.title' 4 2 'Structure model' '_citation.year' 5 2 'Structure model' '_citation_author.identifier_ORCID' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 23JZ _pdbx_database_status.recvd_initial_deposition_date 2026-02-09 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email j.kondo@sophia.ac.jp _pdbx_contact_author.name_first Jiro _pdbx_contact_author.name_last Kondo _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5682-3685 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kondo, J.' 1 0000-0002-5682-3685 'Okada, M.' 2 ? 'Tsuzuki, K.' 3 ? 'Onizuka, K.' 4 ? 'Nagasawa, R.' 5 ? 'Miyashita, E.' 6 ? 'Komatsu, K.R.' 7 ? 'Saito, H.' 8 ? 'Nagatsugi, F.' 9 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Rsc Chem Biol' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2633-0679 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'RNA-binding landscape of amiloride: large-scale profiling and structural basis of U-U mismatch recognition.' _citation.year 2026 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1039/d6cb00055j _citation.pdbx_database_id_PubMed 42100640 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tsuzuki, K.' 1 0009-0001-9888-8778 primary 'Onizuka, K.' 2 0000-0001-9713-4619 primary 'Okada, M.' 3 ? primary 'Nagasawa, R.' 4 0009-0002-0474-3218 primary 'Miyashita, E.' 5 ? primary 'Komatsu, K.R.' 6 0000-0002-4505-0840 primary 'Saito, H.' 7 0000-0002-8570-5784 primary 'Kondo, J.' 8 0000-0002-5682-3685 primary 'Nagatsugi, F.' 9 0000-0002-5526-6020 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (35-MER)' 11285.740 1 ? ? ? ? 2 non-polymer syn '3,5-DIAMINO-N-(AMINOIMINOMETHYL)-6-CHLOROPYRAZINECARBOXAMIDE' 229.627 1 ? ? ? ? 3 non-polymer syn 'CALCIUM ION' 40.078 4 ? ? ? ? 4 water nat water 18.015 20 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GCUUGCUCUAAGGCAUGAAAGUGCUAUGAGAUAGC _entity_poly.pdbx_seq_one_letter_code_can GCUUGCUCUAAGGCAUGAAAGUGCUAUGAGAUAGC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 '3,5-DIAMINO-N-(AMINOIMINOMETHYL)-6-CHLOROPYRAZINECARBOXAMIDE' AMR 3 'CALCIUM ION' CA 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 C n 1 3 U n 1 4 U n 1 5 G n 1 6 C n 1 7 U n 1 8 C n 1 9 U n 1 10 A n 1 11 A n 1 12 G n 1 13 G n 1 14 C n 1 15 A n 1 16 U n 1 17 G n 1 18 A n 1 19 A n 1 20 A n 1 21 G n 1 22 U n 1 23 G n 1 24 C n 1 25 U n 1 26 A n 1 27 U n 1 28 G n 1 29 A n 1 30 G n 1 31 A n 1 32 U n 1 33 A n 1 34 G n 1 35 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 35 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 AMR non-polymer . '3,5-DIAMINO-N-(AMINOIMINOMETHYL)-6-CHLOROPYRAZINECARBOXAMIDE' AMILORIDE 'C6 H8 Cl N7 O' 229.627 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CA non-polymer . 'CALCIUM ION' ? 'Ca 2' 40.078 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 C 2 2 2 C C A . n A 1 3 U 3 3 3 U U A . n A 1 4 U 4 4 4 U U A . n A 1 5 G 5 5 5 G G A . n A 1 6 C 6 6 6 C C A . n A 1 7 U 7 7 7 U U A . n A 1 8 C 8 8 8 C C A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 C 14 14 14 C C A . n A 1 15 A 15 15 15 A A A . n A 1 16 U 16 16 16 U U A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 U 22 22 22 U U A . n A 1 23 G 23 23 23 G G A . n A 1 24 C 24 24 24 C C A . n A 1 25 U 25 25 25 U U A . n A 1 26 A 26 26 26 A A A . n A 1 27 U 27 27 27 U U A . n A 1 28 G 28 28 28 G G A . n A 1 29 A 29 29 29 A A A . n A 1 30 G 30 30 30 G G A . n A 1 31 A 31 31 31 A A A . n A 1 32 U 32 32 32 U U A . n A 1 33 A 33 33 33 A A A . n A 1 34 G 34 34 34 G G A . n A 1 35 C 35 35 35 C C A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id AMR _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id AMR _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 AMR 1 101 101 AMR AMR A . C 3 CA 1 102 1 CA CA A . D 3 CA 1 103 2 CA CA A . E 3 CA 1 104 3 CA CA A . F 3 CA 1 105 4 CA CA A . G 4 HOH 1 201 14 HOH HOH A . G 4 HOH 2 202 6 HOH HOH A . G 4 HOH 3 203 19 HOH HOH A . G 4 HOH 4 204 8 HOH HOH A . G 4 HOH 5 205 4 HOH HOH A . G 4 HOH 6 206 12 HOH HOH A . G 4 HOH 7 207 11 HOH HOH A . G 4 HOH 8 208 20 HOH HOH A . G 4 HOH 9 209 7 HOH HOH A . G 4 HOH 10 210 5 HOH HOH A . G 4 HOH 11 211 9 HOH HOH A . G 4 HOH 12 212 10 HOH HOH A . G 4 HOH 13 213 16 HOH HOH A . G 4 HOH 14 214 2 HOH HOH A . G 4 HOH 15 215 1 HOH HOH A . G 4 HOH 16 216 18 HOH HOH A . G 4 HOH 17 217 13 HOH HOH A . G 4 HOH 18 218 3 HOH HOH A . G 4 HOH 19 219 15 HOH HOH A . G 4 HOH 20 220 17 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 3 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 23JZ _cell.details ? _cell.formula_units_Z ? _cell.length_a 65.102 _cell.length_a_esd ? _cell.length_b 65.102 _cell.length_b_esd ? _cell.length_c 69.596 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 23JZ _symmetry.cell_setting ? _symmetry.Int_Tables_number 152 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 31 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 23JZ _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.77 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 67.40 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Potassium chloride, Calcium chloride dihydrate, Sodium cacodylate trihydrate, Polyethylene glycol 4000' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293.15 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 S 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2025-10-19 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.98 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-5A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.98 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-5A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 23JZ _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.90 _reflns.d_resolution_low 29.61 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 3993 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 4.7 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 11.57 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.12 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.90 _reflns_shell.d_res_low 3.00 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 287 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.382 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 23JZ _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.90 _refine.ls_d_res_low 29.61 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 3985 _refine.ls_number_reflns_R_free 389 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.48 _refine.ls_percent_reflns_R_free 9.76 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1939 _refine.ls_R_factor_R_free 0.2198 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1911 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.38 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 19.35 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.11 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 747 _refine_hist.pdbx_number_atoms_ligand 19 _refine_hist.number_atoms_solvent 20 _refine_hist.number_atoms_total 786 _refine_hist.d_res_high 2.90 _refine_hist.d_res_low 29.61 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.006 ? 851 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.997 ? 1323 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 11.567 ? 417 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.045 ? 174 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 37 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.90 3.32 . . 126 1171 99.00 . . . . 0.2353 . . . . . . . . . . . . . . . 0.2911 'X-RAY DIFFRACTION' 3.32 4.18 . . 129 1173 100.00 . . . . 0.1932 . . . . . . . . . . . . . . . 0.2128 'X-RAY DIFFRACTION' 4.18 29.61 . . 134 1252 99.00 . . . . 0.1612 . . . . . . . . . . . . . . . 0.1814 # _struct.entry_id 23JZ _struct.title 'pre-miR-6074 internal loop in complex with amiloride (Form 1)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 23JZ _struct_keywords.text 'pre-miR-6074, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 23JZ _struct_ref.pdbx_db_accession 23JZ _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 23JZ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 35 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 23JZ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 35 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 35 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 90 ? 1 MORE -13 ? 1 'SSA (A^2)' 6410 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A A 10 "O3'" ? ? ? 1_555 E CA . CA ? ? A A 10 A CA 104 1_555 ? ? ? ? ? ? ? 3.080 ? ? metalc2 metalc ? ? A A 10 "O2'" ? ? ? 1_555 E CA . CA ? ? A A 10 A CA 104 1_555 ? ? ? ? ? ? ? 2.607 ? ? metalc3 metalc ? ? A A 11 OP2 ? ? ? 1_555 E CA . CA ? ? A A 11 A CA 104 1_555 ? ? ? ? ? ? ? 3.027 ? ? metalc4 metalc ? ? A G 12 O6 ? ? ? 1_555 E CA . CA ? ? A G 12 A CA 104 1_555 ? ? ? ? ? ? ? 2.872 ? ? metalc5 metalc ? ? A G 13 O6 ? ? ? 1_555 E CA . CA ? ? A G 13 A CA 104 1_555 ? ? ? ? ? ? ? 3.127 ? ? metalc6 metalc ? ? A U 16 O4 ? ? ? 1_555 D CA . CA ? ? A U 16 A CA 103 1_555 ? ? ? ? ? ? ? 2.569 ? ? metalc7 metalc ? ? A G 17 O6 ? ? ? 1_555 D CA . CA ? ? A G 17 A CA 103 1_555 ? ? ? ? ? ? ? 2.556 ? ? metalc8 metalc ? ? A U 22 O4 ? ? ? 1_555 C CA . CA ? ? A U 22 A CA 102 1_555 ? ? ? ? ? ? ? 2.308 ? ? metalc9 metalc ? ? A U 27 OP2 ? ? ? 1_555 F CA . CA ? ? A U 27 A CA 105 1_555 ? ? ? ? ? ? ? 2.970 ? ? metalc10 metalc ? ? C CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 102 A HOH 201 1_555 ? ? ? ? ? ? ? 2.327 ? ? metalc11 metalc ? ? C CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 102 A HOH 206 1_555 ? ? ? ? ? ? ? 2.342 ? ? metalc12 metalc ? ? C CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 102 A HOH 207 1_555 ? ? ? ? ? ? ? 2.449 ? ? metalc13 metalc ? ? C CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 102 A HOH 211 1_555 ? ? ? ? ? ? ? 2.359 ? ? metalc14 metalc ? ? C CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 102 A HOH 212 1_555 ? ? ? ? ? ? ? 2.316 ? ? metalc15 metalc ? ? C CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 102 A HOH 217 1_555 ? ? ? ? ? ? ? 2.550 ? ? metalc16 metalc ? ? D CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 103 A HOH 202 1_555 ? ? ? ? ? ? ? 2.214 ? ? metalc17 metalc ? ? D CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 103 A HOH 204 1_555 ? ? ? ? ? ? ? 2.303 ? ? metalc18 metalc ? ? D CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 103 A HOH 209 1_555 ? ? ? ? ? ? ? 2.894 ? ? metalc19 metalc ? ? D CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 103 A HOH 210 1_555 ? ? ? ? ? ? ? 2.472 ? ? metalc20 metalc ? ? F CA . CA ? ? ? 1_555 G HOH . O ? ? A CA 105 A HOH 208 1_555 ? ? ? ? ? ? ? 2.968 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 1 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 1 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 1 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 34 N1 ? ? A C 2 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 34 O6 ? ? A C 2 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 34 N2 ? ? A C 2 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 33 N1 ? ? A U 3 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 33 N6 ? ? A U 3 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 N1 ? ? ? 1_555 A A 31 N1 ? ? A G 5 A A 31 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog10 hydrog ? ? A G 5 O6 ? ? ? 1_555 A A 31 N6 ? ? A G 5 A A 31 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog11 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 30 N1 ? ? A C 6 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 30 O6 ? ? A C 6 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 30 N2 ? ? A C 6 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 29 N1 ? ? A U 7 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 29 N6 ? ? A U 7 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 8 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 8 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 8 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 26 N7 ? ? A U 9 A A 26 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog20 hydrog ? ? A U 9 O2 ? ? ? 1_555 A A 26 N6 ? ? A U 9 A A 26 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog21 hydrog ? ? A G 12 N1 ? ? ? 1_555 A U 25 O2 ? ? A G 12 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog22 hydrog ? ? A G 12 O6 ? ? ? 1_555 A U 25 N3 ? ? A G 12 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog23 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 13 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 13 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 13 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 14 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 14 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 14 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A A 15 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 15 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 15 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 15 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 16 N3 ? ? ? 1_555 A G 21 O6 ? ? A U 16 A G 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog32 hydrog ? ? A U 16 O2 ? ? ? 1_555 A G 21 N1 ? ? A U 16 A G 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog33 hydrog ? ? A G 17 N2 ? ? ? 1_555 A A 20 N7 ? ? A G 17 A A 20 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 "O3'" ? A A 10 ? A A 10 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 "O2'" ? A A 10 ? A A 10 ? 1_555 56.6 ? 2 "O3'" ? A A 10 ? A A 10 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 OP2 ? A A 11 ? A A 11 ? 1_555 48.1 ? 3 "O2'" ? A A 10 ? A A 10 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 OP2 ? A A 11 ? A A 11 ? 1_555 82.5 ? 4 "O3'" ? A A 10 ? A A 10 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O6 ? A G 12 ? A G 12 ? 1_555 109.7 ? 5 "O2'" ? A A 10 ? A A 10 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O6 ? A G 12 ? A G 12 ? 1_555 74.7 ? 6 OP2 ? A A 11 ? A A 11 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O6 ? A G 12 ? A G 12 ? 1_555 155.4 ? 7 "O3'" ? A A 10 ? A A 10 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O6 ? A G 13 ? A G 13 ? 1_555 153.7 ? 8 "O2'" ? A A 10 ? A A 10 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O6 ? A G 13 ? A G 13 ? 1_555 97.8 ? 9 OP2 ? A A 11 ? A A 11 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O6 ? A G 13 ? A G 13 ? 1_555 130.1 ? 10 O6 ? A G 12 ? A G 12 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O6 ? A G 13 ? A G 13 ? 1_555 63.4 ? 11 O4 ? A U 16 ? A U 16 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O6 ? A G 17 ? A G 17 ? 1_555 63.4 ? 12 O4 ? A U 16 ? A U 16 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 202 ? 1_555 65.4 ? 13 O6 ? A G 17 ? A G 17 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 202 ? 1_555 71.4 ? 14 O4 ? A U 16 ? A U 16 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 204 ? 1_555 122.5 ? 15 O6 ? A G 17 ? A G 17 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 204 ? 1_555 67.7 ? 16 O ? G HOH . ? A HOH 202 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 204 ? 1_555 72.0 ? 17 O4 ? A U 16 ? A U 16 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 209 ? 1_555 78.6 ? 18 O6 ? A G 17 ? A G 17 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 209 ? 1_555 140.3 ? 19 O ? G HOH . ? A HOH 202 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 209 ? 1_555 83.3 ? 20 O ? G HOH . ? A HOH 204 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 209 ? 1_555 132.7 ? 21 O4 ? A U 16 ? A U 16 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 210 ? 1_555 82.2 ? 22 O6 ? A G 17 ? A G 17 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 210 ? 1_555 75.5 ? 23 O ? G HOH . ? A HOH 202 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 210 ? 1_555 141.3 ? 24 O ? G HOH . ? A HOH 204 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 210 ? 1_555 112.9 ? 25 O ? G HOH . ? A HOH 209 ? 1_555 CA ? D CA . ? A CA 103 ? 1_555 O ? G HOH . ? A HOH 210 ? 1_555 111.5 ? 26 O4 ? A U 22 ? A U 22 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 201 ? 1_555 64.0 ? 27 O4 ? A U 22 ? A U 22 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 206 ? 1_555 73.2 ? 28 O ? G HOH . ? A HOH 201 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 206 ? 1_555 109.1 ? 29 O4 ? A U 22 ? A U 22 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 207 ? 1_555 113.8 ? 30 O ? G HOH . ? A HOH 201 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 207 ? 1_555 68.5 ? 31 O ? G HOH . ? A HOH 206 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 207 ? 1_555 82.0 ? 32 O4 ? A U 22 ? A U 22 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 211 ? 1_555 82.9 ? 33 O ? G HOH . ? A HOH 201 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 211 ? 1_555 132.9 ? 34 O ? G HOH . ? A HOH 206 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 211 ? 1_555 90.6 ? 35 O ? G HOH . ? A HOH 207 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 211 ? 1_555 158.5 ? 36 O4 ? A U 22 ? A U 22 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 212 ? 1_555 100.6 ? 37 O ? G HOH . ? A HOH 201 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 212 ? 1_555 73.1 ? 38 O ? G HOH . ? A HOH 206 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 212 ? 1_555 170.9 ? 39 O ? G HOH . ? A HOH 207 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 212 ? 1_555 106.8 ? 40 O ? G HOH . ? A HOH 211 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 212 ? 1_555 81.9 ? 41 O4 ? A U 22 ? A U 22 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 217 ? 1_555 144.8 ? 42 O ? G HOH . ? A HOH 201 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 217 ? 1_555 145.9 ? 43 O ? G HOH . ? A HOH 206 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 217 ? 1_555 76.9 ? 44 O ? G HOH . ? A HOH 207 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 217 ? 1_555 79.6 ? 45 O ? G HOH . ? A HOH 211 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 217 ? 1_555 79.1 ? 46 O ? G HOH . ? A HOH 212 ? 1_555 CA ? C CA . ? A CA 102 ? 1_555 O ? G HOH . ? A HOH 217 ? 1_555 106.4 ? 47 OP2 ? A U 27 ? A U 27 ? 1_555 CA ? F CA . ? A CA 105 ? 1_555 O ? G HOH . ? A HOH 208 ? 1_555 127.9 ? # _pdbx_entry_details.entry_id 23JZ _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 AMR N1 N Y N 38 AMR C1 C Y N 39 AMR C3 C N N 40 AMR N5 N N N 41 AMR C6 C N N 42 AMR N7 N N N 43 AMR N6 N N N 44 AMR O1 O N N 45 AMR C2 C Y N 46 AMR N4 N N N 47 AMR N3 N Y N 48 AMR C4 C Y N 49 AMR N2 N N N 50 AMR C5 C Y N 51 AMR CL1 CL N N 52 AMR HN5 H N N 53 AMR HN71 H N N 54 AMR HN72 H N N 55 AMR HN6 H N N 56 AMR HN41 H N N 57 AMR HN42 H N N 58 AMR HN21 H N N 59 AMR HN22 H N N 60 C OP3 O N N 61 C P P N N 62 C OP1 O N N 63 C OP2 O N N 64 C "O5'" O N N 65 C "C5'" C N N 66 C "C4'" C N R 67 C "O4'" O N N 68 C "C3'" C N S 69 C "O3'" O N N 70 C "C2'" C N R 71 C "O2'" O N N 72 C "C1'" C N R 73 C N1 N N N 74 C C2 C N N 75 C O2 O N N 76 C N3 N N N 77 C C4 C N N 78 C N4 N N N 79 C C5 C N N 80 C C6 C N N 81 C HOP3 H N N 82 C HOP2 H N N 83 C "H5'" H N N 84 C "H5''" H N N 85 C "H4'" H N N 86 C "H3'" H N N 87 C "HO3'" H N N 88 C "H2'" H N N 89 C "HO2'" H N N 90 C "H1'" H N N 91 C H41 H N N 92 C H42 H N N 93 C H5 H N N 94 C H6 H N N 95 CA CA CA N N 96 G OP3 O N N 97 G P P N N 98 G OP1 O N N 99 G OP2 O N N 100 G "O5'" O N N 101 G "C5'" C N N 102 G "C4'" C N R 103 G "O4'" O N N 104 G "C3'" C N S 105 G "O3'" O N N 106 G "C2'" C N R 107 G "O2'" O N N 108 G "C1'" C N R 109 G N9 N Y N 110 G C8 C Y N 111 G N7 N Y N 112 G C5 C Y N 113 G C6 C N N 114 G O6 O N N 115 G N1 N N N 116 G C2 C N N 117 G N2 N N N 118 G N3 N N N 119 G C4 C Y N 120 G HOP3 H N N 121 G HOP2 H N N 122 G "H5'" H N N 123 G "H5''" H N N 124 G "H4'" H N N 125 G "H3'" H N N 126 G "HO3'" H N N 127 G "H2'" H N N 128 G "HO2'" H N N 129 G "H1'" H N N 130 G H8 H N N 131 G H1 H N N 132 G H21 H N N 133 G H22 H N N 134 HOH O O N N 135 HOH H1 H N N 136 HOH H2 H N N 137 U OP3 O N N 138 U P P N N 139 U OP1 O N N 140 U OP2 O N N 141 U "O5'" O N N 142 U "C5'" C N N 143 U "C4'" C N R 144 U "O4'" O N N 145 U "C3'" C N S 146 U "O3'" O N N 147 U "C2'" C N R 148 U "O2'" O N N 149 U "C1'" C N R 150 U N1 N N N 151 U C2 C N N 152 U O2 O N N 153 U N3 N N N 154 U C4 C N N 155 U O4 O N N 156 U C5 C N N 157 U C6 C N N 158 U HOP3 H N N 159 U HOP2 H N N 160 U "H5'" H N N 161 U "H5''" H N N 162 U "H4'" H N N 163 U "H3'" H N N 164 U "HO3'" H N N 165 U "H2'" H N N 166 U "HO2'" H N N 167 U "H1'" H N N 168 U H3 H N N 169 U H5 H N N 170 U H6 H N N 171 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 AMR N1 C1 doub Y N 40 AMR N1 C5 sing Y N 41 AMR C1 C3 sing N N 42 AMR C1 C2 sing Y N 43 AMR C3 N5 sing N N 44 AMR C3 O1 doub N N 45 AMR N5 C6 sing N N 46 AMR N5 HN5 sing N N 47 AMR C6 N7 sing N N 48 AMR C6 N6 doub N N 49 AMR N7 HN71 sing N N 50 AMR N7 HN72 sing N N 51 AMR N6 HN6 sing N N 52 AMR C2 N4 sing N N 53 AMR C2 N3 doub Y N 54 AMR N4 HN41 sing N N 55 AMR N4 HN42 sing N N 56 AMR N3 C4 sing Y N 57 AMR C4 N2 sing N N 58 AMR C4 C5 doub Y N 59 AMR N2 HN21 sing N N 60 AMR N2 HN22 sing N N 61 AMR C5 CL1 sing N N 62 C OP3 P sing N N 63 C OP3 HOP3 sing N N 64 C P OP1 doub N N 65 C P OP2 sing N N 66 C P "O5'" sing N N 67 C OP2 HOP2 sing N N 68 C "O5'" "C5'" sing N N 69 C "C5'" "C4'" sing N N 70 C "C5'" "H5'" sing N N 71 C "C5'" "H5''" sing N N 72 C "C4'" "O4'" sing N N 73 C "C4'" "C3'" sing N N 74 C "C4'" "H4'" sing N N 75 C "O4'" "C1'" sing N N 76 C "C3'" "O3'" sing N N 77 C "C3'" "C2'" sing N N 78 C "C3'" "H3'" sing N N 79 C "O3'" "HO3'" sing N N 80 C "C2'" "O2'" sing N N 81 C "C2'" "C1'" sing N N 82 C "C2'" "H2'" sing N N 83 C "O2'" "HO2'" sing N N 84 C "C1'" N1 sing N N 85 C "C1'" "H1'" sing N N 86 C N1 C2 sing N N 87 C N1 C6 sing N N 88 C C2 O2 doub N N 89 C C2 N3 sing N N 90 C N3 C4 doub N N 91 C C4 N4 sing N N 92 C C4 C5 sing N N 93 C N4 H41 sing N N 94 C N4 H42 sing N N 95 C C5 C6 doub N N 96 C C5 H5 sing N N 97 C C6 H6 sing N N 98 G OP3 P sing N N 99 G OP3 HOP3 sing N N 100 G P OP1 doub N N 101 G P OP2 sing N N 102 G P "O5'" sing N N 103 G OP2 HOP2 sing N N 104 G "O5'" "C5'" sing N N 105 G "C5'" "C4'" sing N N 106 G "C5'" "H5'" sing N N 107 G "C5'" "H5''" sing N N 108 G "C4'" "O4'" sing N N 109 G "C4'" "C3'" sing N N 110 G "C4'" "H4'" sing N N 111 G "O4'" "C1'" sing N N 112 G "C3'" "O3'" sing N N 113 G "C3'" "C2'" sing N N 114 G "C3'" "H3'" sing N N 115 G "O3'" "HO3'" sing N N 116 G "C2'" "O2'" sing N N 117 G "C2'" "C1'" sing N N 118 G "C2'" "H2'" sing N N 119 G "O2'" "HO2'" sing N N 120 G "C1'" N9 sing N N 121 G "C1'" "H1'" sing N N 122 G N9 C8 sing Y N 123 G N9 C4 sing Y N 124 G C8 N7 doub Y N 125 G C8 H8 sing N N 126 G N7 C5 sing Y N 127 G C5 C6 sing N N 128 G C5 C4 doub Y N 129 G C6 O6 doub N N 130 G C6 N1 sing N N 131 G N1 C2 sing N N 132 G N1 H1 sing N N 133 G C2 N2 sing N N 134 G C2 N3 doub N N 135 G N2 H21 sing N N 136 G N2 H22 sing N N 137 G N3 C4 sing N N 138 HOH O H1 sing N N 139 HOH O H2 sing N N 140 U OP3 P sing N N 141 U OP3 HOP3 sing N N 142 U P OP1 doub N N 143 U P OP2 sing N N 144 U P "O5'" sing N N 145 U OP2 HOP2 sing N N 146 U "O5'" "C5'" sing N N 147 U "C5'" "C4'" sing N N 148 U "C5'" "H5'" sing N N 149 U "C5'" "H5''" sing N N 150 U "C4'" "O4'" sing N N 151 U "C4'" "C3'" sing N N 152 U "C4'" "H4'" sing N N 153 U "O4'" "C1'" sing N N 154 U "C3'" "O3'" sing N N 155 U "C3'" "C2'" sing N N 156 U "C3'" "H3'" sing N N 157 U "O3'" "HO3'" sing N N 158 U "C2'" "O2'" sing N N 159 U "C2'" "C1'" sing N N 160 U "C2'" "H2'" sing N N 161 U "O2'" "HO2'" sing N N 162 U "C1'" N1 sing N N 163 U "C1'" "H1'" sing N N 164 U N1 C2 sing N N 165 U N1 C6 sing N N 166 U C2 O2 doub N N 167 U C2 N3 sing N N 168 U N3 C4 sing N N 169 U N3 H3 sing N N 170 U C4 O4 doub N N 171 U C4 C5 sing N N 172 U C5 C6 doub N N 173 U C5 H5 sing N N 174 U C6 H6 sing N N 175 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 23JZ 'double helix' 23JZ 'a-form double helix' 23JZ tetraloop 23JZ 'mismatched base pair' 23JZ 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 35 1_555 -0.212 -0.267 -0.227 -7.733 -4.744 0.157 1 A_G1:C35_A A 1 ? A 35 ? 19 1 1 A C 2 1_555 A G 34 1_555 0.560 -0.102 0.069 7.435 -11.909 5.220 2 A_C2:G34_A A 2 ? A 34 ? 19 1 1 A U 3 1_555 A A 33 1_555 -0.075 -0.158 -0.381 20.702 7.655 1.612 3 A_U3:A33_A A 3 ? A 33 ? 20 1 1 A G 5 1_555 A A 31 1_555 0.096 1.496 -0.279 9.701 -20.200 -16.544 4 A_G5:A31_A A 5 ? A 31 ? 8 1 1 A C 6 1_555 A G 30 1_555 0.231 -0.383 0.174 0.114 -10.251 -1.812 5 A_C6:G30_A A 6 ? A 30 ? 19 1 1 A U 7 1_555 A A 29 1_555 -0.371 -0.171 0.213 0.131 -11.095 1.160 6 A_U7:A29_A A 7 ? A 29 ? 20 1 1 A C 8 1_555 A G 28 1_555 0.407 -0.322 0.220 0.729 -10.009 -2.288 7 A_C8:G28_A A 8 ? A 28 ? 19 1 1 A U 9 1_555 A A 26 1_555 4.437 -2.628 -0.122 -20.319 -0.386 -86.038 8 A_U9:A26_A A 9 ? A 26 ? 24 4 1 A G 12 1_555 A U 25 1_555 -2.574 -0.725 0.193 1.573 -15.856 -1.096 9 A_G12:U25_A A 12 ? A 25 ? 28 1 1 A G 13 1_555 A C 24 1_555 -0.625 -0.226 0.093 -4.490 -15.704 4.755 10 A_G13:C24_A A 13 ? A 24 ? 19 1 1 A C 14 1_555 A G 23 1_555 0.076 -0.390 -0.103 -1.137 -18.587 0.280 11 A_C14:G23_A A 14 ? A 23 ? 19 1 1 A A 15 1_555 A U 22 1_555 -0.232 -0.063 0.148 -4.404 -16.883 6.486 12 A_A15:U22_A A 15 ? A 22 ? 20 1 1 A U 16 1_555 A G 21 1_555 2.411 -0.363 -0.009 1.407 -0.718 8.210 13 A_U16:G21_A A 16 ? A 21 ? 28 1 1 A G 17 1_555 A A 20 1_555 6.954 -5.407 1.157 19.349 5.477 -10.726 14 A_G17:A20_A A 17 ? A 20 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 35 1_555 A C 2 1_555 A G 34 1_555 -0.215 -1.682 2.984 -3.311 2.588 34.657 -3.156 -0.091 2.863 4.325 5.533 34.904 1 AA_G1C2:G34C35_AA A 1 ? A 35 ? A 2 ? A 34 ? 1 A C 2 1_555 A G 34 1_555 A U 3 1_555 A A 33 1_555 -0.844 -1.884 2.966 1.299 12.925 21.157 -7.295 2.259 1.522 31.646 -3.180 24.788 2 AA_C2U3:A33G34_AA A 2 ? A 34 ? A 3 ? A 33 ? 1 A U 3 1_555 A A 33 1_555 A G 5 1_555 A A 31 1_555 -1.307 -1.920 6.684 -8.617 16.513 57.176 -3.573 0.448 6.095 16.772 8.752 59.889 3 AA_U3G5:A31A33_AA A 3 ? A 33 ? A 5 ? A 31 ? 1 A G 5 1_555 A A 31 1_555 A C 6 1_555 A G 30 1_555 0.522 -1.686 3.376 -5.282 3.626 35.778 -3.209 -1.572 3.091 5.844 8.514 36.329 4 AA_G5C6:G30A31_AA A 5 ? A 31 ? A 6 ? A 30 ? 1 A C 6 1_555 A G 30 1_555 A U 7 1_555 A A 29 1_555 0.405 -1.792 3.144 -2.008 4.364 32.424 -3.869 -1.036 2.855 7.763 3.571 32.768 5 AA_C6U7:A29G30_AA A 6 ? A 30 ? A 7 ? A 29 ? 1 A U 7 1_555 A A 29 1_555 A C 8 1_555 A G 28 1_555 -0.854 -2.262 3.007 -2.560 4.737 32.239 -4.744 1.127 2.714 8.456 4.570 32.674 6 AA_U7C8:G28A29_AA A 7 ? A 29 ? A 8 ? A 28 ? 1 A C 8 1_555 A G 28 1_555 A U 9 1_555 A A 26 1_555 -2.731 -2.008 3.705 8.651 7.761 74.282 -1.901 2.523 3.225 6.389 -7.121 75.056 7 AA_C8U9:A26G28_AA A 8 ? A 28 ? A 9 ? A 26 ? 1 A U 9 1_555 A A 26 1_555 A G 12 1_555 A U 25 1_555 -0.268 0.115 6.473 9.377 -5.291 43.791 1.089 2.014 6.237 -6.969 -12.352 45.032 8 AA_U9G12:U25A26_AA A 9 ? A 26 ? A 12 ? A 25 ? 1 A G 12 1_555 A U 25 1_555 A G 13 1_555 A C 24 1_555 0.493 -1.214 3.293 -3.215 9.396 38.407 -2.846 -1.088 2.880 13.999 4.791 39.623 9 AA_G12G13:C24U25_AA A 12 ? A 25 ? A 13 ? A 24 ? 1 A G 13 1_555 A C 24 1_555 A C 14 1_555 A G 23 1_555 -0.499 -1.213 3.049 0.843 5.986 37.196 -2.579 0.872 2.816 9.308 -1.311 37.667 10 AA_G13C14:G23C24_AA A 13 ? A 24 ? A 14 ? A 23 ? 1 A C 14 1_555 A G 23 1_555 A A 15 1_555 A U 22 1_555 0.768 -1.469 3.141 0.423 12.710 31.005 -4.396 -1.272 2.382 22.620 -0.754 33.452 11 AA_C14A15:U22G23_AA A 14 ? A 23 ? A 15 ? A 22 ? 1 A A 15 1_555 A U 22 1_555 A U 16 1_555 A G 21 1_555 0.287 -0.953 3.195 -0.211 9.101 39.813 -2.316 -0.434 2.916 13.156 0.305 40.799 12 AA_A15U16:G21U22_AA A 15 ? A 22 ? A 16 ? A 21 ? 1 A U 16 1_555 A G 21 1_555 A G 17 1_555 A A 20 1_555 -2.095 -0.780 2.795 -2.548 12.558 46.406 -1.792 2.404 2.617 15.591 3.163 48.049 13 AA_U16G17:A20G21_AA A 16 ? A 21 ? A 17 ? A 20 ? # _pdbx_audit_support.funding_organization 'Japan Agency for Medical Research and Development (AMED)' _pdbx_audit_support.country Japan _pdbx_audit_support.grant_number JP25ama121014 _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 4FNJ _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 23JZ _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.015361 _atom_sites.fract_transf_matrix[1][2] 0.008868 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.017737 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.014369 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C CA CL N O P # loop_ #