data_299D # _entry.id 299D # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 299D pdb_0000299d 10.2210/pdb299d/pdb RCSB URX057 ? ? WWPDB D_1000177712 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1997-01-24 2 'Structure model' 1 1 2008-05-22 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2024-02-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 299D _pdbx_database_status.recvd_initial_deposition_date 1996-12-14 _pdbx_database_status.deposit_site NDB _pdbx_database_status.process_site NDB _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Scott, W.G.' 1 'Murray, J.B.' 2 'Arnold, J.R.P.' 3 'Stoddard, B.L.' 4 'Klug, A.' 5 # _citation.id primary _citation.title 'Capturing the structure of a catalytic RNA intermediate: the hammerhead ribozyme.' _citation.journal_abbrev Science _citation.journal_volume 274 _citation.page_first 2065 _citation.page_last 2069 _citation.year 1996 _citation.journal_id_ASTM SCIEAS _citation.country US _citation.journal_id_ISSN 0036-8075 _citation.journal_id_CSD 0038 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 8953035 _citation.pdbx_database_id_DOI 10.1126/science.274.5295.2065 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Scott, W.G.' 1 ? primary 'Murray, J.B.' 2 ? primary 'Arnold, J.R.' 3 ? primary 'Stoddard, B.L.' 4 ? primary 'Klug, A.' 5 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA HAMMERHEAD RIBOZYME' 5170.103 1 ? ? ? ? 2 polymer syn 'RNA HAMMERHEAD RIBOZYME' 8019.876 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polyribonucleotide no no GUGGUCUGAUGAGGCC GUGGUCUGAUGAGGCC A ? 2 polyribonucleotide no no GGCCGAAACUCGUAAGAGUCACCAC GGCCGAAACUCGUAAGAGUCACCAC B ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 U n 1 3 G n 1 4 G n 1 5 U n 1 6 C n 1 7 U n 1 8 G n 1 9 A n 1 10 U n 1 11 G n 1 12 A n 1 13 G n 1 14 G n 1 15 C n 1 16 C n 2 1 G n 2 2 G n 2 3 C n 2 4 C n 2 5 G n 2 6 A n 2 7 A n 2 8 A n 2 9 C n 2 10 U n 2 11 C n 2 12 G n 2 13 U n 2 14 A n 2 15 A n 2 16 G n 2 17 A n 2 18 G n 2 19 U n 2 20 C n 2 21 A n 2 22 C n 2 23 C n 2 24 A n 2 25 C n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 25 25 G G A . n A 1 2 U 2 24 24 U U A . n A 1 3 G 3 23 23 G G A . n A 1 4 G 4 22 22 G G A . n A 1 5 U 5 21 21 U U A . n A 1 6 C 6 30 30 C C A . n A 1 7 U 7 40 40 U U A . n A 1 8 G 8 50 50 G G A . n A 1 9 A 9 60 60 A A A . n A 1 10 U 10 70 70 U U A . n A 1 11 G 11 80 80 G G A . n A 1 12 A 12 90 90 A A A . n A 1 13 G 13 101 101 G G A . n A 1 14 G 14 102 102 G G A . n A 1 15 C 15 103 103 C C A . n A 1 16 C 16 104 104 C C A . n B 2 1 G 1 114 114 G G B . n B 2 2 G 2 113 113 G G B . n B 2 3 C 3 112 112 C C B . n B 2 4 C 4 111 111 C C B . n B 2 5 G 5 120 120 G G B . n B 2 6 A 6 130 130 A A B . n B 2 7 A 7 140 140 A A B . n B 2 8 A 8 151 151 A A B . n B 2 9 C 9 152 152 C C B . n B 2 10 U 10 153 153 U U B . n B 2 11 C 11 154 154 C C B . n B 2 12 G 12 31 31 G G B L n B 2 13 U 13 32 32 U U B L n B 2 14 A 14 33 33 A A B L n B 2 15 A 15 34 34 A A B L n B 2 16 G 16 164 164 G G B . n B 2 17 A 17 163 163 A A B . n B 2 18 G 18 162 162 G G B . n B 2 19 U 19 161 161 U U B . n B 2 20 C 20 170 170 C C B . n B 2 21 A 21 11 11 A A B . n B 2 22 C 22 12 12 C C B . n B 2 23 C 23 13 13 C C B . n B 2 24 A 24 14 14 A A B . n B 2 25 C 25 15 15 C C B . n # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR refinement 3.1 ? 1 DENZO 'data reduction' . ? 2 # _cell.entry_id 299D _cell.length_a 64.560 _cell.length_b 64.560 _cell.length_c 136.290 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 6 _cell.pdbx_unique_axis ? # _symmetry.entry_id 299D _symmetry.space_group_name_H-M 'P 31 2 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 152 # _exptl.entry_id 299D _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 6.22 _exptl_crystal.density_percent_sol 80.21 _exptl_crystal.description ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.temp ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 6.00 _exptl_crystal_grow.pdbx_details 'pH 6.00, VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.pdbx_pH_range ? # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.details 1 1 1 WATER ? ? ? 1 2 1 'LI SULFATE' ? ? ? 1 3 1 EDTA ? ? ? 1 4 1 'NA CACODYLATE' ? ? ? # _diffrn.id 1 _diffrn.ambient_temp 100.00 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector ? _diffrn_detector.type MARRESEARCH _diffrn_detector.pdbx_collection_date 1995-09-28 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'NSLS BEAMLINE X12C' _diffrn_source.pdbx_synchrotron_site NSLS _diffrn_source.pdbx_synchrotron_beamline X12C _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list ? # _reflns.entry_id 299D _reflns.observed_criterion_sigma_I ? _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 43.000 _reflns.d_resolution_high 3.000 _reflns.number_obs 7003 _reflns.number_all ? _reflns.percent_possible_obs 97.300 _reflns.pdbx_Rmerge_I_obs 0.0680000 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI 15.900 _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 3.400 _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _refine.entry_id 299D _refine.ls_number_reflns_obs 6022 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.000 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 8.000 _refine.ls_d_res_high 3.000 _refine.ls_percent_reflns_obs 85.400 _refine.ls_R_factor_obs 0.2160000 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2160000 _refine.ls_R_factor_R_free 0.2650000 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free ? _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_ls_cross_valid_method ? _refine.details 'NUCLEIC ACID RNA-DNA PARAMETER FILE: G. PARKINSON,ET AL. (1996) ACTA CRYST. D52, 57-64' _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.overall_SU_B ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 873 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 873 _refine_hist.d_res_high 3.000 _refine_hist.d_res_low 8.000 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function x_bond_d 0.007 ? ? ? 'X-RAY DIFFRACTION' ? x_bond_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_bond_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg 1.10 ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d 13.0 ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_mcbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_mcangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_scbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_scangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? # _pdbx_xplor_file.serial_no 1 _pdbx_xplor_file.param_file NDB_PARAMETER_FILE.RNA _pdbx_xplor_file.topol_file NDB_TOPOLOGY_FILE.RNA _pdbx_xplor_file.pdbx_refine_id 'X-RAY DIFFRACTION' # _database_PDB_matrix.entry_id 299D _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 299D _struct.title 'CAPTURING THE STRUCTURE OF A CATALYTIC RNA INTERMEDIATE: THE HAMMERHEAD RIBOZYME' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 299D _struct_keywords.pdbx_keywords RIBOZYME _struct_keywords.text 'RNA HAMMERHEAD RIBOZYME, CATALYTIC RNA, LOOP, RIBOZYME' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # loop_ _struct_ref.id _struct_ref.entity_id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 1 PDB 299D 299D ? ? ? 2 2 PDB 299D 299D ? ? ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 299D A 1 ? 16 ? 299D 25 ? 104 ? 25 104 2 2 299D B 1 ? 25 ? 299D 114 ? 15 ? 114 15 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 B C 25 N3 ? ? A G 25 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 B C 25 O2 ? ? A G 25 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 B C 25 N4 ? ? A G 25 B C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 2 N3 ? ? ? 1_555 B A 24 N1 ? ? A U 24 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A U 2 O4 ? ? ? 1_555 B A 24 N6 ? ? A U 24 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 B C 23 N3 ? ? A G 23 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 B C 23 O2 ? ? A G 23 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 B C 23 N4 ? ? A G 23 B C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 22 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 22 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 22 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 B A 21 N1 ? ? A U 21 B A 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 O4 ? ? ? 1_555 B A 21 N6 ? ? A U 21 B A 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 5 N3 ? ? ? 1_555 B C 22 N3 ? ? A U 21 B C 12 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog15 hydrog ? ? A U 5 O4 ? ? ? 1_555 B C 22 N4 ? ? A U 21 B C 12 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog16 hydrog ? ? A C 6 N3 ? ? ? 1_555 B C 20 N4 ? ? A C 30 B C 170 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog17 hydrog ? ? A U 10 O2 ? ? ? 1_555 B A 7 N6 ? ? A U 70 B A 140 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog18 hydrog ? ? A G 11 N2 ? ? ? 1_555 B A 6 N7 ? ? A G 80 B A 130 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A G 11 N3 ? ? ? 1_555 B A 6 N6 ? ? A G 80 B A 130 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog20 hydrog ? ? A A 12 N7 ? ? ? 1_555 B G 5 N2 ? ? A A 90 B G 120 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog21 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 4 N3 ? ? A G 101 B C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 4 O2 ? ? A G 101 B C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 4 N4 ? ? A G 101 B C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 14 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 102 B C 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 14 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 102 B C 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 14 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 102 B C 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 15 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 103 B G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 15 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 103 B G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 15 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 103 B G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 16 N3 ? ? ? 1_555 B G 1 N1 ? ? A C 104 B G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 16 N4 ? ? ? 1_555 B G 1 O6 ? ? A C 104 B G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 16 O2 ? ? ? 1_555 B G 1 N2 ? ? A C 104 B G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? B A 8 N6 ? ? ? 1_555 B U 19 O4 ? ? B A 151 B U 161 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog34 hydrog ? ? B C 9 N3 ? ? ? 1_555 B G 18 N1 ? ? B C 152 B G 162 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? B C 9 N4 ? ? ? 1_555 B G 18 O6 ? ? B C 152 B G 162 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? B C 9 O2 ? ? ? 1_555 B G 18 N2 ? ? B C 152 B G 162 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? B U 10 N3 ? ? ? 1_555 B A 17 N1 ? ? B U 153 B A 163 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? B U 10 O4 ? ? ? 1_555 B A 17 N6 ? ? B U 153 B A 163 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? B C 11 N3 ? ? ? 1_555 B G 16 N1 ? ? B C 154 B G 164 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? B C 11 N4 ? ? ? 1_555 B G 16 O6 ? ? B C 154 B G 164 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? B C 11 O2 ? ? ? 1_555 B G 16 N2 ? ? B C 154 B G 164 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? B G 12 N2 ? L ? 1_555 B A 15 N7 ? L B G 31 B A 34 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _refine_B_iso.class 'ALL ATOMS' _refine_B_iso.details TR _refine_B_iso.treatment isotropic _refine_B_iso.pdbx_refine_id 'X-RAY DIFFRACTION' # _refine_occupancy.class 'ALL ATOMS' _refine_occupancy.treatment fix _refine_occupancy.pdbx_refine_id 'X-RAY DIFFRACTION' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 299D 'double helix' 299D 'a-form double helix' 299D tetraloop 299D 'mismatched base pair' 299D 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 B C 25 1_555 -0.704 -0.213 -0.185 -10.657 -15.782 -2.872 1 A_G25:C15_B A 25 ? B 15 ? 19 1 1 A U 2 1_555 B A 24 1_555 -0.193 0.259 -0.427 6.511 -20.117 2.153 2 A_U24:A14_B A 24 ? B 14 ? 20 1 1 A G 3 1_555 B C 23 1_555 -0.085 -0.320 -0.104 5.084 -3.440 2.988 3 A_G23:C13_B A 23 ? B 13 ? 19 1 1 A G 4 1_555 B C 22 1_555 0.531 -0.280 -1.086 -8.272 -12.685 4.384 4 A_G22:C12_B A 22 ? B 12 ? 19 1 1 A U 5 1_555 B A 21 1_555 -0.252 -0.318 -1.021 -1.165 -3.570 9.547 5 A_U21:A11_B A 21 ? B 11 ? 20 1 1 A C 6 1_555 B C 20 1_555 1.802 -1.254 0.931 37.507 2.611 21.842 6 A_C30:C170_B A 30 ? B 170 ? ? ? 1 B G 1 1_555 A C 16 1_555 -0.128 -0.047 0.582 0.075 -10.876 6.581 7 B_G114:C104_A B 114 ? A 104 ? 19 1 1 B G 2 1_555 A C 15 1_555 0.209 -0.157 0.249 -1.372 -9.910 2.352 8 B_G113:C103_A B 113 ? A 103 ? 19 1 1 B C 3 1_555 A G 14 1_555 0.322 -0.117 0.322 -3.729 -7.939 0.141 9 B_C112:G102_A B 112 ? A 102 ? 19 1 1 B C 4 1_555 A G 13 1_555 1.373 -0.527 0.006 6.805 -10.633 3.202 10 B_C111:G101_A B 111 ? A 101 ? 19 1 1 B G 5 1_555 A A 12 1_555 7.147 -4.872 -0.210 3.699 -17.501 -19.078 11 B_G120:A90_A B 120 ? A 90 ? ? 10 1 B A 6 1_555 A G 11 1_555 -6.746 -3.848 -0.056 -21.538 17.726 12.360 12 B_A130:G80_A B 130 ? A 80 ? 11 9 1 B A 7 1_555 A U 10 1_555 -6.168 0.266 0.529 26.509 -9.385 61.748 13 B_A140:U70_A B 140 ? A 70 ? ? 5 1 B A 8 1_555 B U 19 1_555 0.814 1.117 -0.570 -5.190 -35.329 -31.757 14 B_A151:U161_B B 151 ? B 161 ? ? ? 1 B C 9 1_555 B G 18 1_555 0.246 -0.250 0.606 -3.003 -18.770 1.402 15 B_C152:G162_B B 152 ? B 162 ? 19 1 1 B U 10 1_555 B A 17 1_555 -0.693 0.086 0.456 7.037 -6.012 -2.938 16 B_U153:A163_B B 153 ? B 163 ? 20 1 1 B C 11 1_555 B G 16 1_555 0.731 -0.384 0.343 10.717 -2.961 2.185 17 B_C154:G164_B B 154 ? B 164 ? 19 1 1 B G 12 1_555 B A 15 1_555 7.750 -6.292 0.425 1.861 -14.336 -44.825 18 B_G31L:A34L_B B 31 L B 34 L ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 B C 25 1_555 A U 2 1_555 B A 24 1_555 -0.558 -0.722 2.706 -0.732 5.151 39.918 -1.526 0.744 2.606 7.506 1.067 40.242 1 AA_G25U24:A14C15_BB A 25 ? B 15 ? A 24 ? B 14 ? 1 A U 2 1_555 B A 24 1_555 A G 3 1_555 B C 23 1_555 0.210 -1.190 3.410 -3.265 2.877 30.146 -2.854 -1.067 3.245 5.495 6.237 30.452 2 AA_U24G23:C13A14_BB A 24 ? B 14 ? A 23 ? B 13 ? 1 A G 3 1_555 B C 23 1_555 A G 4 1_555 B C 22 1_555 0.506 -2.197 3.598 7.781 11.338 32.951 -5.259 0.319 2.763 18.991 -13.034 35.632 3 AA_G23G22:C12C13_BB A 23 ? B 13 ? A 22 ? B 12 ? 1 A G 4 1_555 B C 22 1_555 A U 5 1_555 B A 21 1_555 -0.579 -1.954 2.928 -3.778 5.954 17.759 -8.381 0.163 2.234 18.374 11.658 19.097 4 AA_G22U21:A11C12_BB A 22 ? B 12 ? A 21 ? B 11 ? 1 A U 5 1_555 B A 21 1_555 A C 6 1_555 B C 20 1_555 1.070 -1.336 2.371 -18.053 -6.307 41.015 -1.350 -2.521 1.936 -8.469 24.243 45.079 5 AA_U21C30:C170A11_BB A 21 ? B 11 ? A 30 ? B 170 ? 1 B G 1 1_555 A C 16 1_555 B G 2 1_555 A C 15 1_555 -0.796 -1.433 3.112 -4.445 5.330 34.756 -3.087 0.697 2.943 8.813 7.350 35.421 6 BB_G114G113:C103C104_AA B 114 ? A 104 ? B 113 ? A 103 ? 1 B G 2 1_555 A C 15 1_555 B C 3 1_555 A G 14 1_555 -0.184 -1.579 3.263 -2.827 2.097 38.092 -2.669 -0.069 3.180 3.204 4.320 38.249 7 BB_G113C112:G102C103_AA B 113 ? A 103 ? B 112 ? A 102 ? 1 B C 3 1_555 A G 14 1_555 B C 4 1_555 A G 13 1_555 -0.358 -1.614 2.988 2.158 -4.447 31.955 -2.157 1.003 3.148 -8.018 -3.891 32.325 8 BB_C112C111:G101G102_AA B 112 ? A 102 ? B 111 ? A 101 ? 1 B C 4 1_555 A G 13 1_555 B G 5 1_555 A A 12 1_555 -1.399 -1.143 3.560 4.457 6.713 57.096 -1.568 1.706 3.310 6.985 -4.637 57.615 9 BB_C111G120:A90G101_AA B 111 ? A 101 ? B 120 ? A 90 ? 1 B G 5 1_555 A A 12 1_555 B A 6 1_555 A G 11 1_555 1.652 -1.044 3.750 4.322 -1.173 -17.500 4.049 7.924 3.175 3.776 13.913 -18.060 10 BB_G120A130:G80A90_AA B 120 ? A 90 ? B 130 ? A 80 ? 1 B A 6 1_555 A G 11 1_555 B A 7 1_555 A U 10 1_555 2.570 -0.993 1.954 -17.169 10.324 27.274 -2.271 -5.360 0.006 18.984 31.571 33.728 11 BB_A130A140:U70G80_AA B 130 ? A 80 ? B 140 ? A 70 ? 1 B A 7 1_555 A U 10 1_555 B A 8 1_555 B U 19 1_555 -2.213 -1.338 3.857 -8.919 16.620 76.883 -1.593 1.453 3.751 13.180 7.073 78.814 12 BB_A140A151:U161U70_BA B 140 ? A 70 ? B 151 ? B 161 ? 1 B A 8 1_555 B U 19 1_555 B C 9 1_555 B G 18 1_555 1.394 -1.118 3.089 -12.200 -0.478 26.347 -2.142 -5.093 2.255 -0.985 25.121 28.993 13 BB_A151C152:G162U161_BB B 151 ? B 161 ? B 152 ? B 162 ? 1 B C 9 1_555 B G 18 1_555 B U 10 1_555 B A 17 1_555 -0.469 -1.384 2.969 -4.893 -2.031 31.873 -2.153 0.034 3.085 -3.667 8.834 32.299 14 BB_C152U153:A163G162_BB B 152 ? B 162 ? B 153 ? B 163 ? 1 B U 10 1_555 B A 17 1_555 B C 11 1_555 B G 16 1_555 0.408 -1.547 3.193 0.460 0.503 40.299 -2.301 -0.542 3.178 0.731 -0.668 40.304 15 BB_U153C154:G164A163_BB B 153 ? B 163 ? B 154 ? B 164 ? 1 B C 11 1_555 B G 16 1_555 B G 12 1_555 B A 15 1_555 -4.258 -1.685 3.654 8.054 18.679 52.518 -2.812 4.970 2.350 20.269 -8.740 56.057 16 BB_C154G31L:A34LG164_BB B 154 ? B 164 ? B 31 L B 34 L # _atom_sites.entry_id 299D _atom_sites.fract_transf_matrix[1][1] 0.015489 _atom_sites.fract_transf_matrix[1][2] 0.008943 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.017886 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.007337 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_