data_2A9L # _entry.id 2A9L # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2A9L pdb_00002a9l 10.2210/pdb2a9l/pdb WWPDB D_1000177718 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1998-06-17 2 'Structure model' 1 1 2008-03-05 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-09 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' Other 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.process_site' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2A9L _pdbx_database_status.recvd_initial_deposition_date 1998-04-07 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 1A9L _pdbx_database_related.details 'ENSEMBLE OF 12 STRUCTURES' _pdbx_database_related.content_type ensemble # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Diener, J.L.' 1 'Moore, P.B.' 2 # _citation.id primary _citation.title 'Solution structure of a substrate for the archaeal pre-tRNA splicing endonucleases: the bulge-helix-bulge motif.' _citation.journal_abbrev Mol.Cell _citation.journal_volume 1 _citation.page_first 883 _citation.page_last 894 _citation.year 1998 _citation.journal_id_ASTM MOCEFL _citation.country US _citation.journal_id_ISSN 1097-2765 _citation.journal_id_CSD 2168 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 9660971 _citation.pdbx_database_id_DOI '10.1016/S1097-2765(00)80087-8' # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Diener, J.L.' 1 ? primary 'Moore, P.B.' 2 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'ABISS7 RNA' _entity.formula_weight 12317.423 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGUGACUCCAGAGGUCGAGAGACCGGAGAUAUCACCC _entity_poly.pdbx_seq_one_letter_code_can GGGUGACUCCAGAGGUCGAGAGACCGGAGAUAUCACCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 U n 1 5 G n 1 6 A n 1 7 C n 1 8 U n 1 9 C n 1 10 C n 1 11 A n 1 12 G n 1 13 A n 1 14 G n 1 15 G n 1 16 U n 1 17 C n 1 18 G n 1 19 A n 1 20 G n 1 21 A n 1 22 G n 1 23 A n 1 24 C n 1 25 C n 1 26 G n 1 27 G n 1 28 A n 1 29 G n 1 30 A n 1 31 U n 1 32 A n 1 33 U n 1 34 C n 1 35 A n 1 36 C n 1 37 C n 1 38 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details ;THE MOLECULE WAS SYNTHESIZED IN VITRO BY T7 POLYMERASE RNA TRANSCRIPTION USING CHEMICALLY SYNTHESIZED DNA OLIGONUCLEOTIDES AS TEMPLATES ; # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 G 5 5 5 G G A . n A 1 6 A 6 6 6 A A A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 C 10 10 10 C C A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 U 16 16 16 U U A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 A 19 19 19 A A A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 G 26 26 26 G G A . n A 1 27 G 27 27 27 G G A . n A 1 28 A 28 28 28 A A A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 U 31 31 31 U U A . n A 1 32 A 32 32 32 A A A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 C 37 37 37 C C A . n A 1 38 C 38 38 38 C C A . n # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' 3.851 ? 1 X-PLOR refinement 3.851 ? 2 X-PLOR phasing 3.851 ? 3 # _cell.entry_id 2A9L _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2A9L _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 2A9L _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 2A9L _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 2A9L _struct.title ;SOLUTION NMR STRUCTURE OF A SUBSTRATE FOR THE ARCHAEAL PRE-TRNA SPLICING ENDONUCLEASES: THE BULGE-HELIX-BULGE MOTIF, MINIMIZED AVERAGE STRUCTURE ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2A9L _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'ARCHAEAL BULGE-HELIX-BULGE MOTIF, PRE-TRNA SPLICING, ARCHAEA, RNA STRUCTURE, RIBONUCLEIC ACID, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2A9L _struct_ref.pdbx_db_accession 2A9L _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2A9L _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 38 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2A9L _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 38 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 38 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 1 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 37 N3 ? ? A G 2 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 37 O2 ? ? A G 2 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 37 N4 ? ? A G 2 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 3 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 35 N1 ? ? A U 4 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 35 N6 ? ? A U 4 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 5 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 5 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 5 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 6 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 6 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 7 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 7 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 7 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 28 N1 ? ? A U 8 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 8 A A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 9 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 9 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 9 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 26 N1 ? ? A C 10 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 26 O6 ? ? A C 10 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 26 N2 ? ? A C 10 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 14 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 14 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 14 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 15 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 15 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 15 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 23 N1 ? ? A U 16 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 23 N6 ? ? A U 16 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 17 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 17 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 17 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 18 N2 ? ? ? 1_555 A A 21 N7 ? ? A G 18 A A 21 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog40 hydrog ? ? A G 18 N3 ? ? ? 1_555 A A 21 N6 ? ? A G 18 A A 21 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 "HO2'" _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 G _pdbx_validate_close_contact.auth_seq_id_1 12 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 "O4'" _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 A _pdbx_validate_close_contact.auth_seq_id_2 13 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.59 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C4'" A A 6 ? ? "C3'" A A 6 ? ? "C2'" A A 6 ? ? 96.56 102.60 -6.04 1.00 N 2 1 "O4'" A A 6 ? ? "C1'" A A 6 ? ? N9 A A 6 ? ? 112.96 108.50 4.46 0.70 N 3 1 "O4'" A C 10 ? ? "C1'" A C 10 ? ? N1 A C 10 ? ? 113.58 108.50 5.08 0.70 N 4 1 "C3'" A A 11 ? ? "C2'" A A 11 ? ? "C1'" A A 11 ? ? 97.00 101.30 -4.30 0.70 N 5 1 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "C3'" A G 12 ? ? 128.50 116.00 12.50 1.60 N 6 1 "C5'" A G 12 ? ? "C4'" A G 12 ? ? "O4'" A G 12 ? ? 115.92 109.80 6.12 0.90 N 7 1 N9 A G 12 ? ? "C1'" A G 12 ? ? "C2'" A G 12 ? ? 124.27 114.00 10.27 1.30 N 8 1 "C4'" A A 13 ? ? "C3'" A A 13 ? ? "C2'" A A 13 ? ? 95.26 102.60 -7.34 1.00 N 9 1 N9 A A 13 ? ? "C1'" A A 13 ? ? "C2'" A A 13 ? ? 123.64 114.00 9.64 1.30 N 10 1 "O4'" A A 13 ? ? "C1'" A A 13 ? ? N9 A A 13 ? ? 103.34 108.20 -4.86 0.80 N 11 1 N1 A A 21 ? ? C2 A A 21 ? ? N3 A A 21 ? ? 132.63 129.30 3.33 0.50 N 12 1 N1 A A 21 ? ? C6 A A 21 ? ? N6 A A 21 ? ? 114.91 118.60 -3.69 0.60 N 13 1 "C1'" A G 22 ? ? "O4'" A G 22 ? ? "C4'" A G 22 ? ? 116.13 109.90 6.23 0.80 N 14 1 C6 A C 25 ? ? N1 A C 25 ? ? C2 A C 25 ? ? 117.42 120.30 -2.88 0.40 N 15 1 N1 A U 31 ? ? "C1'" A U 31 ? ? "C2'" A U 31 ? ? 124.52 114.00 10.52 1.30 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 G A 12 ? ? 0.091 'SIDE CHAIN' 2 1 A A 13 ? ? 0.131 'SIDE CHAIN' 3 1 G A 14 ? ? 0.169 'SIDE CHAIN' 4 1 G A 15 ? ? 0.072 'SIDE CHAIN' 5 1 G A 18 ? ? 0.267 'SIDE CHAIN' 6 1 A A 19 ? ? 0.096 'SIDE CHAIN' 7 1 G A 22 ? ? 0.073 'SIDE CHAIN' 8 1 A A 23 ? ? 0.073 'SIDE CHAIN' 9 1 C A 25 ? ? 0.094 'SIDE CHAIN' 10 1 G A 27 ? ? 0.063 'SIDE CHAIN' 11 1 U A 31 ? ? 0.146 'SIDE CHAIN' 12 1 C A 34 ? ? 0.068 'SIDE CHAIN' # _pdbx_nmr_ensemble.entry_id 2A9L _pdbx_nmr_ensemble.conformers_calculated_total_number 65 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria 'LEAST RESTRAINT VIOLATION' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 ? 7.0 ? . K 2 303 ? 7.0 ? . K # _pdbx_nmr_exptl.experiment_id 1 _pdbx_nmr_exptl.conditions_id 1 _pdbx_nmr_exptl.type 'SEE JRNL REFERENCE' _pdbx_nmr_exptl.solution_id 1 # _pdbx_nmr_refine.entry_id 2A9L _pdbx_nmr_refine.method 'TORSION ANGLE MOLECULAR DYNAMICS' _pdbx_nmr_refine.details 'REFINEMENT DETAILS CAN BE FOUND IN THE JOURNAL CITATION ABOVE. X-PLOR 3.851 ALSO WAS USED.' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement CNS ? 'BRUNGER,ADAMS,CLORE,DELANO,GROS, GROSSE-KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,READ,RICE,SIMONSON,WARREN' 1 'structure solution' X-PLOR 3.851 ? 2 'structure solution' CNS ? ? 3 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2A9L 'double helix' 2A9L 'a-form double helix' 2A9L tetraloop 2A9L 'bulge loop' 2A9L 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 38 1_555 -0.814 -0.157 -0.040 0.720 -5.724 -0.074 1 A_G1:C38_A A 1 ? A 38 ? 19 1 1 A G 2 1_555 A C 37 1_555 -1.007 -0.302 -0.044 2.542 -12.234 0.755 2 A_G2:C37_A A 2 ? A 37 ? 19 1 1 A G 3 1_555 A C 36 1_555 -1.034 -0.284 0.025 2.400 -10.697 1.073 3 A_G3:C36_A A 3 ? A 36 ? 19 1 1 A U 4 1_555 A A 35 1_555 0.157 -0.123 -0.431 2.537 -14.123 2.558 4 A_U4:A35_A A 4 ? A 35 ? 20 1 1 A G 5 1_555 A C 34 1_555 0.355 0.107 -0.358 -28.073 -16.745 -2.003 5 A_G5:C34_A A 5 ? A 34 ? 19 1 1 A A 6 1_555 A U 33 1_555 0.757 -0.099 0.561 -13.608 -12.376 -2.492 6 A_A6:U33_A A 6 ? A 33 ? 20 1 1 A C 7 1_555 A G 29 1_555 0.626 -0.137 -0.066 12.195 -2.889 -2.022 7 A_C7:G29_A A 7 ? A 29 ? 19 1 1 A U 8 1_555 A A 28 1_555 0.575 -0.129 -0.143 14.533 -9.666 4.298 8 A_U8:A28_A A 8 ? A 28 ? 20 1 1 A C 9 1_555 A G 27 1_555 0.976 -0.344 -0.285 6.367 -1.831 -3.027 9 A_C9:G27_A A 9 ? A 27 ? 19 1 1 A C 10 1_555 A G 26 1_555 0.837 -0.215 -0.157 -5.651 -6.215 -1.863 10 A_C10:G26_A A 10 ? A 26 ? 19 1 1 A G 14 1_555 A C 25 1_555 0.135 -0.111 0.463 1.660 16.018 -2.853 11 A_G14:C25_A A 14 ? A 25 ? 19 1 1 A G 15 1_555 A C 24 1_555 -0.501 -0.087 0.031 -1.398 -3.260 -1.958 12 A_G15:C24_A A 15 ? A 24 ? 19 1 1 A U 16 1_555 A A 23 1_555 0.151 -0.037 0.102 -4.505 0.821 -3.201 13 A_U16:A23_A A 16 ? A 23 ? 20 1 1 A C 17 1_555 A G 22 1_555 1.033 -0.319 0.219 8.727 10.327 -1.439 14 A_C17:G22_A A 17 ? A 22 ? 19 1 1 A G 18 1_555 A A 21 1_555 4.409 -2.929 -2.456 9.772 -10.996 -55.849 15 A_G18:A21_A A 18 ? A 21 ? 11 4 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 38 1_555 A G 2 1_555 A C 37 1_555 -0.431 -2.391 3.080 -4.464 8.970 26.444 -6.644 0.015 2.208 18.773 9.343 28.247 1 AA_G1G2:C37C38_AA A 1 ? A 38 ? A 2 ? A 37 ? 1 A G 2 1_555 A C 37 1_555 A G 3 1_555 A C 36 1_555 -0.133 -2.559 3.079 -6.474 11.783 28.983 -6.375 -0.700 1.906 22.104 12.146 31.889 2 AA_G2G3:C36C37_AA A 2 ? A 37 ? A 3 ? A 36 ? 1 A G 3 1_555 A C 36 1_555 A U 4 1_555 A A 35 1_555 -0.225 -2.203 3.219 3.065 3.280 32.900 -4.378 0.881 2.959 5.758 -5.380 33.196 3 AA_G3U4:A35C36_AA A 3 ? A 36 ? A 4 ? A 35 ? 1 A U 4 1_555 A A 35 1_555 A G 5 1_555 A C 34 1_555 0.037 -2.137 3.828 5.333 23.262 34.217 -5.466 0.510 2.020 34.790 -7.976 41.512 4 AA_U4G5:C34A35_AA A 4 ? A 35 ? A 5 ? A 34 ? 1 A G 5 1_555 A C 34 1_555 A A 6 1_555 A U 33 1_555 1.228 -1.754 2.916 1.923 6.925 21.260 -6.624 -2.570 2.334 18.115 -5.030 22.429 5 AA_G5A6:U33C34_AA A 5 ? A 34 ? A 6 ? A 33 ? 1 A C 7 1_555 A G 29 1_555 A U 8 1_555 A A 28 1_555 -0.102 -2.389 3.219 -3.823 4.461 26.698 -6.086 -0.666 2.778 9.515 8.154 27.326 6 AA_C7U8:A28G29_AA A 7 ? A 29 ? A 8 ? A 28 ? 1 A U 8 1_555 A A 28 1_555 A C 9 1_555 A G 27 1_555 -0.717 -2.528 3.464 -1.380 8.684 34.465 -5.374 0.980 2.791 14.368 2.283 35.536 7 AA_U8C9:G27A28_AA A 8 ? A 28 ? A 9 ? A 27 ? 1 A C 9 1_555 A G 27 1_555 A C 10 1_555 A G 26 1_555 1.447 -2.155 3.427 3.120 5.197 35.859 -4.194 -1.876 3.204 8.366 -5.024 36.351 8 AA_C9C10:G26G27_AA A 9 ? A 27 ? A 10 ? A 26 ? 1 A G 14 1_555 A C 25 1_555 A G 15 1_555 A C 24 1_555 0.199 -1.162 3.614 -0.035 17.694 25.748 -5.551 -0.378 2.350 34.937 0.069 31.157 9 AA_G14G15:C24C25_AA A 14 ? A 25 ? A 15 ? A 24 ? 1 A G 15 1_555 A C 24 1_555 A U 16 1_555 A A 23 1_555 0.082 -1.335 3.482 -0.983 15.930 31.262 -4.555 -0.281 2.524 27.436 1.693 35.009 10 AA_G15U16:A23C24_AA A 15 ? A 24 ? A 16 ? A 23 ? 1 A U 16 1_555 A A 23 1_555 A C 17 1_555 A G 22 1_555 0.694 -1.095 3.188 1.458 8.146 29.702 -3.550 -1.040 2.825 15.515 -2.777 30.808 11 AA_U16C17:G22A23_AA A 16 ? A 23 ? A 17 ? A 22 ? 1 A C 17 1_555 A G 22 1_555 A G 18 1_555 A A 21 1_555 -2.772 -0.321 4.273 10.995 -7.588 25.330 1.340 8.496 2.830 -15.966 -23.135 28.586 12 AA_C17G18:A21G22_AA A 17 ? A 22 ? A 18 ? A 21 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength 1 UNITY Varian 500 2 UNITYPLUS GE 600 3 OMEGA GE 600 # _atom_sites.entry_id 2A9L _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_