data_2AU4 # _entry.id 2AU4 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2AU4 pdb_00002au4 10.2210/pdb2au4/pdb RCSB RCSB034313 ? ? WWPDB D_1000034313 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2006-03-28 2 'Structure model' 1 1 2008-05-01 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-09 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_spectrometer 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' struct_site 6 5 'Structure model' chem_comp_atom 7 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_spectrometer.model' 4 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 5 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 6 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2AU4 _pdbx_database_status.recvd_initial_deposition_date 2005-08-26 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry N _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Carothers, J.M.' 1 'Davis, J.H.' 2 'Chou, J.J.' 3 'Szostak, J.W.' 4 # _citation.id primary _citation.title 'Solution structure of an informationally complex high-affinity RNA aptamer to GTP.' _citation.journal_abbrev Rna _citation.journal_volume 12 _citation.page_first 567 _citation.page_last 579 _citation.year 2006 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 16510427 _citation.pdbx_database_id_DOI 10.1261/rna.2251306 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Carothers, J.M.' 1 ? primary 'Davis, J.H.' 2 ? primary 'Chou, J.J.' 3 ? primary 'Szostak, J.W.' 4 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'Class I RNA aptamer to GTP' 13323.942 1 ? ? ? ? 2 non-polymer syn "GUANOSINE-5'-TRIPHOSPHATE" 523.180 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGACGAAGUGGUUGGGCGCUUCGGCGUGUGAAAACGUCCC _entity_poly.pdbx_seq_one_letter_code_can GGGACGAAGUGGUUGGGCGCUUCGGCGUGUGAAAACGUCCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name "GUANOSINE-5'-TRIPHOSPHATE" _pdbx_entity_nonpoly.comp_id GTP # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 C n 1 6 G n 1 7 A n 1 8 A n 1 9 G n 1 10 U n 1 11 G n 1 12 G n 1 13 U n 1 14 U n 1 15 G n 1 16 G n 1 17 G n 1 18 C n 1 19 G n 1 20 C n 1 21 U n 1 22 U n 1 23 C n 1 24 G n 1 25 G n 1 26 C n 1 27 G n 1 28 U n 1 29 G n 1 30 U n 1 31 G n 1 32 A n 1 33 A n 1 34 A n 1 35 A n 1 36 C n 1 37 G n 1 38 U n 1 39 C n 1 40 C n 1 41 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'In vitro selection' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 C 5 5 5 C C A . n A 1 6 G 6 6 6 G G A . n A 1 7 A 7 7 7 A A A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 C 23 23 23 C C A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 C 26 26 26 C C A . n A 1 27 G 27 27 27 G G A . n A 1 28 U 28 28 28 U U A . n A 1 29 G 29 29 29 G G A . n A 1 30 U 30 30 30 U U A . n A 1 31 G 31 31 31 G G A . n A 1 32 A 32 32 32 A A A . n A 1 33 A 33 33 33 A A A . n A 1 34 A 34 34 34 A A A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 U 38 38 38 U U A . n A 1 39 C 39 39 39 C C A . n A 1 40 C 40 40 40 C C A . n A 1 41 C 41 41 41 C C A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id GTP _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 42 _pdbx_nonpoly_scheme.auth_seq_num 42 _pdbx_nonpoly_scheme.pdb_mon_id GTP _pdbx_nonpoly_scheme.auth_mon_id GTP _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _cell.entry_id 2AU4 _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2AU4 _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 2AU4 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_percent_sol ? _exptl_crystal.density_Matthews ? _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _database_PDB_matrix.entry_id 2AU4 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 2AU4 _struct.title 'Class I GTP aptamer' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details 'minimized average' # _struct_keywords.entry_id 2AU4 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA, aptamer' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2AU4 _struct_ref.pdbx_db_accession 2AU4 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2AU4 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 41 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2AU4 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 41 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 41 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 1 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 1 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 1 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 2 A C 39 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog5 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 2 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 2 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 2 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 39 N3 ? ? A G 3 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 39 O2 ? ? A G 3 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 3 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 38 N3 ? ? A A 4 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 38 O4 ? ? A A 4 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 5 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 5 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 5 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 6 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 6 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 6 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 7 N3 ? ? ? 1_555 A A 35 N6 ? ? A A 7 A A 35 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog20 hydrog ? ? A A 8 N3 ? ? ? 1_555 A G 11 N2 ? ? A A 8 A G 11 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog21 hydrog ? ? A A 8 N1 ? ? ? 1_555 A A 33 N6 ? ? A A 8 A A 33 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A G 16 O6 ? ? A G 9 A G 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A G 9 N2 ? ? ? 1_555 A G 16 N7 ? ? A G 9 A G 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A G 9 O6 ? ? ? 1_555 A G 29 N1 ? ? A G 9 A G 29 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog25 hydrog ? ? A G 12 N1 ? ? ? 1_555 A A 34 N3 ? ? A G 12 A A 34 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog26 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 33 N1 ? ? A U 14 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 33 N6 ? ? A U 14 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 15 N1 ? ? ? 1_555 A A 32 N3 ? ? A G 15 A A 32 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog29 hydrog ? ? A G 16 N1 ? ? ? 1_555 A G 29 O6 ? ? A G 16 A G 29 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog30 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 28 O2 ? ? A G 17 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog31 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 28 N3 ? ? A G 17 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog32 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 18 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 18 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 18 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 19 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 19 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 19 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 20 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 20 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 20 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 21 O2 ? ? ? 1_555 A G 24 N1 ? ? A U 21 A G 24 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id GTP _struct_site.pdbx_auth_seq_id 42 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 7 _struct_site.details 'BINDING SITE FOR RESIDUE GTP A 42' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 7 A A 8 ? A A 8 . ? 1_555 ? 2 AC1 7 G A 9 ? G A 9 . ? 1_555 ? 3 AC1 7 G A 11 ? G A 11 . ? 1_555 ? 4 AC1 7 G A 15 ? G A 15 . ? 1_555 ? 5 AC1 7 G A 16 ? G A 16 . ? 1_555 ? 6 AC1 7 G A 31 ? G A 31 . ? 1_555 ? 7 AC1 7 A A 32 ? A A 32 . ? 1_555 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H21 A G 31 ? ? O6 A GTP 42 ? ? 1.43 2 1 "HO2'" A G 24 ? ? "O5'" A G 25 ? ? 1.47 3 1 "O2'" A A 8 ? ? "HO2'" A GTP 42 ? ? 1.47 4 1 H1 A G 17 ? ? O2 A U 28 ? ? 1.52 5 1 N3 A A 8 ? ? H21 A G 11 ? ? 1.54 6 1 H3 A U 14 ? ? N1 A A 33 ? ? 1.59 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A G 1 ? ? "C2'" A G 1 ? ? "C1'" A G 1 ? ? 106.31 101.50 4.81 0.80 N 2 1 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.67 113.10 4.57 0.50 N 3 1 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.73 106.40 -2.67 0.40 N 4 1 N7 A G 2 ? ? C8 A G 2 ? ? N9 A G 2 ? ? 117.72 113.10 4.62 0.50 N 5 1 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 103.79 106.40 -2.61 0.40 N 6 1 N7 A G 3 ? ? C8 A G 3 ? ? N9 A G 3 ? ? 117.55 113.10 4.45 0.50 N 7 1 C8 A G 3 ? ? N9 A G 3 ? ? C4 A G 3 ? ? 103.84 106.40 -2.56 0.40 N 8 1 N7 A A 4 ? ? C8 A A 4 ? ? N9 A A 4 ? ? 117.59 113.80 3.79 0.50 N 9 1 N7 A G 6 ? ? C8 A G 6 ? ? N9 A G 6 ? ? 117.68 113.10 4.58 0.50 N 10 1 C8 A G 6 ? ? N9 A G 6 ? ? C4 A G 6 ? ? 103.80 106.40 -2.60 0.40 N 11 1 "C3'" A A 7 ? ? "C2'" A A 7 ? ? "C1'" A A 7 ? ? 106.32 101.50 4.82 0.80 N 12 1 N7 A A 7 ? ? C8 A A 7 ? ? N9 A A 7 ? ? 117.42 113.80 3.62 0.50 N 13 1 N7 A A 8 ? ? C8 A A 8 ? ? N9 A A 8 ? ? 117.43 113.80 3.63 0.50 N 14 1 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.61 113.10 4.51 0.50 N 15 1 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.85 106.40 -2.55 0.40 N 16 1 "C3'" A U 10 ? ? "C2'" A U 10 ? ? "C1'" A U 10 ? ? 106.44 101.50 4.94 0.80 N 17 1 N7 A G 11 ? ? C8 A G 11 ? ? N9 A G 11 ? ? 117.52 113.10 4.42 0.50 N 18 1 C8 A G 11 ? ? N9 A G 11 ? ? C4 A G 11 ? ? 103.86 106.40 -2.54 0.40 N 19 1 "C3'" A G 12 ? ? "C2'" A G 12 ? ? "C1'" A G 12 ? ? 106.45 101.50 4.95 0.80 N 20 1 N7 A G 12 ? ? C8 A G 12 ? ? N9 A G 12 ? ? 117.61 113.10 4.51 0.50 N 21 1 C8 A G 12 ? ? N9 A G 12 ? ? C4 A G 12 ? ? 103.74 106.40 -2.66 0.40 N 22 1 "C3'" A U 14 ? ? "C2'" A U 14 ? ? "C1'" A U 14 ? ? 106.52 101.50 5.02 0.80 N 23 1 N7 A G 15 ? ? C8 A G 15 ? ? N9 A G 15 ? ? 117.63 113.10 4.53 0.50 N 24 1 C8 A G 15 ? ? N9 A G 15 ? ? C4 A G 15 ? ? 103.73 106.40 -2.67 0.40 N 25 1 N7 A G 16 ? ? C8 A G 16 ? ? N9 A G 16 ? ? 117.73 113.10 4.63 0.50 N 26 1 C8 A G 16 ? ? N9 A G 16 ? ? C4 A G 16 ? ? 103.77 106.40 -2.63 0.40 N 27 1 "C3'" A G 17 ? ? "C2'" A G 17 ? ? "C1'" A G 17 ? ? 106.32 101.50 4.82 0.80 N 28 1 N7 A G 17 ? ? C8 A G 17 ? ? N9 A G 17 ? ? 117.63 113.10 4.53 0.50 N 29 1 C8 A G 17 ? ? N9 A G 17 ? ? C4 A G 17 ? ? 103.77 106.40 -2.63 0.40 N 30 1 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.75 113.10 4.65 0.50 N 31 1 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.80 106.40 -2.60 0.40 N 32 1 "C3'" A U 22 ? ? "C2'" A U 22 ? ? "C1'" A U 22 ? ? 106.42 101.50 4.92 0.80 N 33 1 "C3'" A G 24 ? ? "C2'" A G 24 ? ? "C1'" A G 24 ? ? 106.39 101.50 4.89 0.80 N 34 1 N7 A G 24 ? ? C8 A G 24 ? ? N9 A G 24 ? ? 117.71 113.10 4.61 0.50 N 35 1 C8 A G 24 ? ? N9 A G 24 ? ? C4 A G 24 ? ? 103.90 106.40 -2.50 0.40 N 36 1 N7 A G 25 ? ? C8 A G 25 ? ? N9 A G 25 ? ? 117.59 113.10 4.49 0.50 N 37 1 C8 A G 25 ? ? N9 A G 25 ? ? C4 A G 25 ? ? 103.86 106.40 -2.54 0.40 N 38 1 N7 A G 27 ? ? C8 A G 27 ? ? N9 A G 27 ? ? 117.61 113.10 4.51 0.50 N 39 1 C8 A G 27 ? ? N9 A G 27 ? ? C4 A G 27 ? ? 103.89 106.40 -2.51 0.40 N 40 1 "C3'" A U 28 ? ? "C2'" A U 28 ? ? "C1'" A U 28 ? ? 106.43 101.50 4.93 0.80 N 41 1 "C3'" A G 29 ? ? "C2'" A G 29 ? ? "C1'" A G 29 ? ? 106.41 101.50 4.91 0.80 N 42 1 N7 A G 29 ? ? C8 A G 29 ? ? N9 A G 29 ? ? 117.75 113.10 4.65 0.50 N 43 1 C8 A G 29 ? ? N9 A G 29 ? ? C4 A G 29 ? ? 103.68 106.40 -2.72 0.40 N 44 1 "C3'" A U 30 ? ? "C2'" A U 30 ? ? "C1'" A U 30 ? ? 106.43 101.50 4.93 0.80 N 45 1 "C3'" A G 31 ? ? "C2'" A G 31 ? ? "C1'" A G 31 ? ? 106.37 101.50 4.87 0.80 N 46 1 N7 A G 31 ? ? C8 A G 31 ? ? N9 A G 31 ? ? 117.57 113.10 4.47 0.50 N 47 1 C8 A G 31 ? ? N9 A G 31 ? ? C4 A G 31 ? ? 103.83 106.40 -2.57 0.40 N 48 1 "C3'" A A 32 ? ? "C2'" A A 32 ? ? "C1'" A A 32 ? ? 106.40 101.50 4.90 0.80 N 49 1 N7 A A 32 ? ? C8 A A 32 ? ? N9 A A 32 ? ? 117.45 113.80 3.65 0.50 N 50 1 N7 A A 33 ? ? C8 A A 33 ? ? N9 A A 33 ? ? 117.41 113.80 3.61 0.50 N 51 1 "C3'" A A 34 ? ? "C2'" A A 34 ? ? "C1'" A A 34 ? ? 106.44 101.50 4.94 0.80 N 52 1 N7 A A 34 ? ? C8 A A 34 ? ? N9 A A 34 ? ? 117.52 113.80 3.72 0.50 N 53 1 N7 A A 35 ? ? C8 A A 35 ? ? N9 A A 35 ? ? 117.53 113.80 3.73 0.50 N 54 1 "C3'" A C 36 ? ? "C2'" A C 36 ? ? "C1'" A C 36 ? ? 106.36 101.50 4.86 0.80 N 55 1 N7 A G 37 ? ? C8 A G 37 ? ? N9 A G 37 ? ? 117.76 113.10 4.66 0.50 N 56 1 C8 A G 37 ? ? N9 A G 37 ? ? C4 A G 37 ? ? 103.77 106.40 -2.63 0.40 N 57 1 "C3'" A C 39 ? ? "C2'" A C 39 ? ? "C1'" A C 39 ? ? 106.41 101.50 4.91 0.80 N 58 1 "C3'" A C 41 ? ? "C2'" A C 41 ? ? "C1'" A C 41 ? ? 106.32 101.50 4.82 0.80 N # _pdbx_nmr_ensemble.entry_id 2AU4 _pdbx_nmr_ensemble.conformers_calculated_total_number ? _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria ? # _pdbx_nmr_representative.entry_id 2AU4 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'minimized average structure' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '3.3 mM Class I aptamer U-15N, 13C, 3.63 mM GTP ligand NA, 10 % phosphate buffer NA, 99% D2O' '99% D2O' 2 '0.9 mM Class I aptamer NA, 0.99 nM GTP ligand U-15N, 13C, 10 % phospate buffer NA, 99% D2O' '99% D2O' 3 '3.3 mM Class I aptamer U-15N, 13C; 3.63 mM GTP ligand NA; 10 % phosphate buffer NA, 95% H2O, 5% D2O' '95% H2O/5% D2O' 4 '0.9 mM Class I aptamer NA; 0.99 nM GTP ligand U-15N, 13C; 10 % phospate buffer NA, 95% H2O, 5% D2O' '95% H2O/5% D2O' 5 '0.8 mM Class I RNA aptamer U-15N,13C, 0.9 mM GTP NA, 10% phosphate buffer NA, 95% H2O, 5% D2O' '95% H2O/5% D2O' 6 '0.5 mM Class I RNA aptamer U-15N,13C, 0.55 mM GTP NA, 18 mL/mg Pf1 phage NA, 10% phosphate buffer NA, 95% H2O, 5% D2O' '95% H2O/5% D2O' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 288 ambient 6.1 '5 mM MgCl2, 75 mM KCl' . K 2 303 ambient 6.1 '5 mM MgCl2, 75 mM KCl' . K 3 298 ambient 6.1 '5 mM MgCl2, 75 mM KCl' . K 4 303 ambient 6.8 '5 mM MgCl2, 75 mM KCl' . K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 3D_13C-separated_NOESY 3 2 1 3D_15N-separated_NOESY 3 3 1 '2D NOESY' 3 4 1 DQF-COSY 4 5 4 '2D 1H decoupled 13C-1H CT HSQC' 5 6 4 '2D 13C-1H CT-TROSY' 5 # _pdbx_nmr_refine.entry_id 2AU4 _pdbx_nmr_refine.method 'restrained molecular dynamics' _pdbx_nmr_refine.details 'structures are based on a total of 434 restraints' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal processing NMRPipe 2.3 Delaglio 1 'structure solution' XPLOR-NIH 2.9.2 'Clore, Tjandra, Schwieters, Kuszewski' 2 'data analysis' Sparky 3 'Kneller and Kuntz' 3 refinement XPLOR-NIH 2.9.2 'Clore, Tjandra, Schwieters, Kuszewski' 4 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 U OP3 O N N 159 U P P N N 160 U OP1 O N N 161 U OP2 O N N 162 U "O5'" O N N 163 U "C5'" C N N 164 U "C4'" C N R 165 U "O4'" O N N 166 U "C3'" C N S 167 U "O3'" O N N 168 U "C2'" C N R 169 U "O2'" O N N 170 U "C1'" C N R 171 U N1 N N N 172 U C2 C N N 173 U O2 O N N 174 U N3 N N N 175 U C4 C N N 176 U O4 O N N 177 U C5 C N N 178 U C6 C N N 179 U HOP3 H N N 180 U HOP2 H N N 181 U "H5'" H N N 182 U "H5''" H N N 183 U "H4'" H N N 184 U "H3'" H N N 185 U "HO3'" H N N 186 U "H2'" H N N 187 U "HO2'" H N N 188 U "H1'" H N N 189 U H3 H N N 190 U H5 H N N 191 U H6 H N N 192 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 U OP3 P sing N N 166 U OP3 HOP3 sing N N 167 U P OP1 doub N N 168 U P OP2 sing N N 169 U P "O5'" sing N N 170 U OP2 HOP2 sing N N 171 U "O5'" "C5'" sing N N 172 U "C5'" "C4'" sing N N 173 U "C5'" "H5'" sing N N 174 U "C5'" "H5''" sing N N 175 U "C4'" "O4'" sing N N 176 U "C4'" "C3'" sing N N 177 U "C4'" "H4'" sing N N 178 U "O4'" "C1'" sing N N 179 U "C3'" "O3'" sing N N 180 U "C3'" "C2'" sing N N 181 U "C3'" "H3'" sing N N 182 U "O3'" "HO3'" sing N N 183 U "C2'" "O2'" sing N N 184 U "C2'" "C1'" sing N N 185 U "C2'" "H2'" sing N N 186 U "O2'" "HO2'" sing N N 187 U "C1'" N1 sing N N 188 U "C1'" "H1'" sing N N 189 U N1 C2 sing N N 190 U N1 C6 sing N N 191 U C2 O2 doub N N 192 U C2 N3 sing N N 193 U N3 C4 sing N N 194 U N3 H3 sing N N 195 U C4 O4 doub N N 196 U C4 C5 sing N N 197 U C5 C6 doub N N 198 U C5 H5 sing N N 199 U C6 H6 sing N N 200 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2AU4 'double helix' 2AU4 tetraloop 2AU4 'mismatched base pair' 2AU4 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 41 1_555 -0.085 -0.144 0.187 0.602 -19.202 -1.934 1 A_G1:C41_A A 1 ? A 41 ? 19 1 1 A G 2 1_555 A C 40 1_555 -0.110 -0.164 0.038 -1.706 -15.327 -2.164 2 A_G2:C40_A A 2 ? A 40 ? 19 1 1 A G 3 1_555 A C 39 1_555 -0.117 -0.164 0.613 8.475 -5.217 -2.030 3 A_G3:C39_A A 3 ? A 39 ? 19 1 1 A A 4 1_555 A U 38 1_555 -0.573 -0.225 -0.074 23.306 -7.676 2.681 4 A_A4:U38_A A 4 ? A 38 ? 20 1 1 A C 5 1_555 A G 37 1_555 0.135 -0.179 0.475 -0.141 -16.456 -1.711 5 A_C5:G37_A A 5 ? A 37 ? 19 1 1 A G 6 1_555 A C 36 1_555 -0.120 -0.148 -0.365 -2.631 -4.359 -1.377 6 A_G6:C36_A A 6 ? A 36 ? 19 1 1 A A 7 1_555 A A 35 1_555 2.511 -2.997 0.017 3.474 -6.245 -112.885 7 A_A7:A35_A A 7 ? A 35 ? ? 6 1 A G 12 1_555 A A 34 1_555 -4.555 0.811 0.498 14.757 -3.660 41.928 8 A_G12:A34_A A 12 ? A 34 ? ? 5 1 A U 14 1_555 A A 33 1_555 0.003 -0.249 -0.182 -2.938 47.915 12.585 9 A_U14:A33_A A 14 ? A 33 ? 20 1 1 A G 15 1_555 A A 32 1_555 -5.232 0.148 -0.390 -16.546 14.950 55.243 10 A_G15:A32_A A 15 ? A 32 ? ? ? 1 A G 9 1_555 A G 29 1_555 -1.556 -2.205 0.485 -8.169 3.066 151.394 11 A_G9:G29_A A 9 ? A 29 ? ? ? 1 A G 17 1_555 A U 28 1_555 -2.831 -0.376 0.122 6.601 -5.468 15.365 12 A_G17:U28_A A 17 ? A 28 ? 28 1 1 A C 18 1_555 A G 27 1_555 0.509 -0.318 0.190 4.296 -27.277 5.820 13 A_C18:G27_A A 18 ? A 27 ? 19 1 1 A G 19 1_555 A C 26 1_555 -0.121 -0.153 -0.438 -1.337 -4.127 -0.811 14 A_G19:C26_A A 19 ? A 26 ? 19 1 1 A C 20 1_555 A G 25 1_555 0.048 -0.124 -0.799 20.912 5.668 -3.565 15 A_C20:G25_A A 20 ? A 25 ? 19 1 1 A U 21 1_555 A G 24 1_555 0.461 -4.733 1.596 -31.531 25.587 -124.554 16 A_U21:G24_A A 21 ? A 24 ? ? 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 41 1_555 A G 2 1_555 A C 40 1_555 -2.262 -0.465 2.785 -10.194 8.103 42.713 -1.297 2.122 3.087 10.827 13.622 44.565 1 AA_G1G2:C40C41_AA A 1 ? A 41 ? A 2 ? A 40 ? 1 A G 2 1_555 A C 40 1_555 A G 3 1_555 A C 39 1_555 1.202 -0.435 2.865 -2.937 16.038 30.373 -2.821 -2.415 2.241 28.203 5.165 34.382 2 AA_G2G3:C39C40_AA A 2 ? A 40 ? A 3 ? A 39 ? 1 A G 3 1_555 A C 39 1_555 A A 4 1_555 A U 38 1_555 0.432 -0.078 3.312 3.840 1.643 37.053 -0.344 -0.158 3.333 2.576 -6.018 37.279 3 AA_G3A4:U38C39_AA A 3 ? A 39 ? A 4 ? A 38 ? 1 A A 4 1_555 A U 38 1_555 A C 5 1_555 A G 37 1_555 -1.587 0.740 4.593 -1.387 29.545 24.933 -4.562 2.139 3.622 50.672 2.380 38.504 4 AA_A4C5:G37U38_AA A 4 ? A 38 ? A 5 ? A 37 ? 1 A C 5 1_555 A G 37 1_555 A G 6 1_555 A C 36 1_555 0.478 -0.013 3.583 5.686 4.850 43.153 -0.529 -0.041 3.593 6.535 -7.662 43.765 5 AA_C5G6:C36G37_AA A 5 ? A 37 ? A 6 ? A 36 ? 1 A G 6 1_555 A C 36 1_555 A A 7 1_555 A A 35 1_555 0.022 -0.823 3.079 9.001 11.382 72.377 -1.024 0.248 2.927 9.544 -7.548 73.622 6 AA_G6A7:A35C36_AA A 6 ? A 36 ? A 7 ? A 35 ? 1 A A 7 1_555 A A 35 1_555 A G 12 1_555 A A 34 1_555 0.223 1.255 3.240 -8.505 -1.730 -1.945 -3.558 -20.855 1.167 15.429 -75.838 -8.894 7 AA_A7G12:A34A35_AA A 7 ? A 35 ? A 12 ? A 34 ? 1 A G 12 1_555 A A 34 1_555 A U 14 1_555 A A 33 1_555 -3.182 -2.370 3.120 -5.680 19.923 46.010 -4.044 3.392 2.324 24.105 6.873 50.227 8 AA_G12U14:A33A34_AA A 12 ? A 34 ? A 14 ? A 33 ? 1 A U 14 1_555 A A 33 1_555 A G 15 1_555 A A 32 1_555 4.481 -3.078 3.828 15.446 -11.613 0.986 6.892 8.014 5.620 -52.345 -69.624 19.350 9 AA_U14G15:A32A33_AA A 14 ? A 33 ? A 15 ? A 32 ? 1 A G 15 1_555 A A 32 1_555 A G 9 1_555 A G 29 1_555 1.793 -0.537 5.339 -9.622 -9.891 -121.603 0.454 0.881 5.384 5.657 -5.503 -122.066 10 AA_G15G9:G29A32_AA A 15 ? A 32 ? A 9 ? A 29 ? 1 A G 9 1_555 A G 29 1_555 A G 17 1_555 A U 28 1_555 1.136 -0.738 2.980 -6.962 15.360 -164.805 0.345 0.561 3.002 -7.747 -3.512 -164.970 11 AA_G9G17:U28G29_AA A 9 ? A 29 ? A 17 ? A 28 ? 1 A G 17 1_555 A U 28 1_555 A C 18 1_555 A G 27 1_555 -2.386 0.186 3.605 0.754 13.180 37.392 -1.439 3.622 3.429 19.818 -1.134 39.575 12 AA_G17C18:G27U28_AA A 17 ? A 28 ? A 18 ? A 27 ? 1 A C 18 1_555 A G 27 1_555 A G 19 1_555 A C 26 1_555 -1.217 -1.351 3.144 -1.128 21.529 29.954 -4.628 1.800 1.840 36.329 1.904 36.761 13 AA_C18G19:C26G27_AA A 18 ? A 27 ? A 19 ? A 26 ? 1 A G 19 1_555 A C 26 1_555 A C 20 1_555 A G 25 1_555 0.949 -0.157 2.894 -0.555 15.694 23.476 -3.521 -2.061 2.314 34.111 1.206 28.183 14 AA_G19C20:G25C26_AA A 19 ? A 26 ? A 20 ? A 25 ? 1 A C 20 1_555 A G 25 1_555 A U 21 1_555 A G 24 1_555 -1.320 -2.018 5.249 -5.968 10.912 95.450 -1.657 0.723 5.113 7.350 4.020 96.062 15 AA_C20U21:G24G25_AA A 20 ? A 25 ? A 21 ? A 24 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 INOVA Varian 750 ? 2 INOVA Varian 500 ? 3 UNITY Varian 400 ? 4 AVANCE Bruker 500 ? # _atom_sites.entry_id 2AU4 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_