data_2BE0 # _entry.id 2BE0 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2BE0 pdb_00002be0 10.2210/pdb2be0/pdb NDB DR0019 ? ? RCSB RCSB034982 ? ? WWPDB D_1000034982 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2005-12-20 2 'Structure model' 1 1 2008-05-01 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-09 5 'Structure model' 1 4 2023-08-23 6 'Structure model' 1 5 2024-03-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' 'Structure summary' 6 5 'Structure model' 'Data collection' 7 5 'Structure model' 'Refinement description' 8 6 'Structure model' 'Source and taxonomy' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp 2 4 'Structure model' database_2 3 4 'Structure model' entity 4 4 'Structure model' pdbx_entity_nonpoly 5 4 'Structure model' pdbx_molecule_features 6 4 'Structure model' struct_site 7 5 'Structure model' chem_comp_atom 8 5 'Structure model' chem_comp_bond 9 5 'Structure model' pdbx_initial_refinement_model 10 6 'Structure model' pdbx_entity_src_syn # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_chem_comp.name' 2 4 'Structure model' '_chem_comp.pdbx_synonyms' 3 4 'Structure model' '_database_2.pdbx_DOI' 4 4 'Structure model' '_database_2.pdbx_database_accession' 5 4 'Structure model' '_entity.pdbx_description' 6 4 'Structure model' '_pdbx_entity_nonpoly.name' 7 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 8 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 9 4 'Structure model' '_struct_site.pdbx_auth_seq_id' 10 6 'Structure model' '_pdbx_entity_src_syn.entity_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2BE0 _pdbx_database_status.recvd_initial_deposition_date 2005-10-21 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1J7T 'Crystal structure of the Complex Between Paromomycin and the 16S-Rrna A-Site' unspecified PDB 2BEE 'Crystal structure of the Complex Between Paromomycin derivative JS4 and the 16S-Rrna A Site' unspecified PDB 2ESI 'Crystal structure of the complex between Kanamycin A and the 16S-Rrna A Site' unspecified PDB 2ESJ 'Crystal structure of the complex between Lividomycin A and the 16S-Rrna A Site' unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Francois, B.' 1 'Westhof, E.' 2 # _citation.id primary _citation.title 'Antibacterial aminoglycosides with a modified mode of binding to the ribosomal-RNA decoding site' _citation.journal_abbrev ANGEW.CHEM.INT.ED.ENGL. _citation.journal_volume 43 _citation.page_first 6735 _citation.page_last 6738 _citation.year 2004 _citation.journal_id_ASTM ACIEAY _citation.country GE _citation.journal_id_ISSN 0570-0833 _citation.journal_id_CSD 0179 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 15593140 _citation.pdbx_database_id_DOI 10.1002/anie.200462092 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Francois, B.' 1 ? primary 'Szychowski, J.' 2 ? primary 'Adhikari, S.S.' 3 ? primary 'Pachamuthu, K.' 4 ? primary 'Swayze, E.E.' 5 ? primary 'Griffey, R.H.' 6 ? primary 'Migawa, M.T.' 7 ? primary 'Westhof, E.' 8 ? primary 'Hanessian, S.' 9 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn "5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'" 7048.259 2 ? ? ? '16S Rrna A Site' 2 non-polymer syn ;(2S,3S,4R,5R,6R)-5-AMINO-2-(AMINOMETHYL)-6-((2R,3R,4R,5S)-5-((1R,2R,3S,5R,6S)-3,5-DIAMINO-2-((2S,3R,4R,5S,6R)-3-AMINO-4 ,5-DIHYDROXY-6-(HYDROXYMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-6-HYDROXYCYCLOHEXYLOXY)-2-(HYDROXYMETHYL)-4-(2-((R)-PIPERIDI N-3-YLMETHYLAMINO)ETHOXY)-TETRAHYDROFURAN-3-YLOXY)-TETRAHYDRO-2H-PYRAN-3,4-DIOL ; 755.855 2 ? ? ? ? 3 water nat water 18.015 44 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code CGCGUCACACCGGUGAAGUCGC _entity_poly.pdbx_seq_one_letter_code_can CGCGUCACACCGGUGAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ;(2S,3S,4R,5R,6R)-5-AMINO-2-(AMINOMETHYL)-6-((2R,3R,4R,5S)-5-((1R,2R,3S,5R,6S)-3,5-DIAMINO-2-((2S,3R,4R,5S,6R)-3-AMINO-4 ,5-DIHYDROXY-6-(HYDROXYMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-6-HYDROXYCYCLOHEXYLOXY)-2-(HYDROXYMETHYL)-4-(2-((R)-PIPERIDI N-3-YLMETHYLAMINO)ETHOXY)-TETRAHYDROFURAN-3-YLOXY)-TETRAHYDRO-2H-PYRAN-3,4-DIOL ; JS5 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 C n 1 7 A n 1 8 C n 1 9 A n 1 10 C n 1 11 C n 1 12 G n 1 13 G n 1 14 U n 1 15 G n 1 16 A n 1 17 A n 1 18 G n 1 19 U n 1 20 C n 1 21 G n 1 22 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'Streptomyces rimosus subsp. paromomycinus' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 92743 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 JS5 non-polymer . ;(2S,3S,4R,5R,6R)-5-AMINO-2-(AMINOMETHYL)-6-((2R,3R,4R,5S)-5-((1R,2R,3S,5R,6S)-3,5-DIAMINO-2-((2S,3R,4R,5S,6R)-3-AMINO-4 ,5-DIHYDROXY-6-(HYDROXYMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-6-HYDROXYCYCLOHEXYLOXY)-2-(HYDROXYMETHYL)-4-(2-((R)-PIPERIDI N-3-YLMETHYLAMINO)ETHOXY)-TETRAHYDROFURAN-3-YLOXY)-TETRAHYDRO-2H-PYRAN-3,4-DIOL ; ;2"-O-[N-(3-(AMINOMETHYL)-PYRIDINE)-2-AMINOETHYL]PAROMOMYCIN; O-2-AMINO-2-DEOXY-ALPHA-D-GLUCOPYRANOSYL-(1,4)-O-[O-2,6-DIAMINO-2,6-DIDEOXY-BETA-L-IDOPYRANOSYL-(1,3)-BETA-D-2-O-(3-ETHY LAMINOMETHYL)-PYRIDYL-(1,5)]-2-DEOXY-D-STREPTAMINE ; 'C31 H61 N7 O14' 755.855 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 0 ? ? ? A . n A 1 2 G 2 1 1 G G A . n A 1 3 C 3 2 2 C C A . n A 1 4 G 4 3 3 G G A . n A 1 5 U 5 4 4 U U A . n A 1 6 C 6 5 5 C C A . n A 1 7 A 7 6 6 A A A . n A 1 8 C 8 7 7 C C A . n A 1 9 A 9 8 8 A A A . n A 1 10 C 10 9 9 C C A . n A 1 11 C 11 10 10 C C A . n A 1 12 G 12 11 11 G G A . n A 1 13 G 13 12 12 G G A . n A 1 14 U 14 13 13 U U A . n A 1 15 G 15 14 14 G G A . n A 1 16 A 16 15 15 A A A . n A 1 17 A 17 16 16 A A A . n A 1 18 G 18 17 17 G G A . n A 1 19 U 19 18 18 U U A . n A 1 20 C 20 19 19 C C A . n A 1 21 G 21 20 20 G G A . n A 1 22 C 22 21 21 C C A . n B 1 1 C 1 21 ? ? ? B . n B 1 2 G 2 22 22 G G B . n B 1 3 C 3 23 23 C C B . n B 1 4 G 4 24 24 G G B . n B 1 5 U 5 25 25 U U B . n B 1 6 C 6 26 26 C C B . n B 1 7 A 7 27 27 A A B . n B 1 8 C 8 28 28 C C B . n B 1 9 A 9 29 29 A A B . n B 1 10 C 10 30 30 C C B . n B 1 11 C 11 31 31 C C B . n B 1 12 G 12 32 32 G G B . n B 1 13 G 13 33 33 G G B . n B 1 14 U 14 34 34 U U B . n B 1 15 G 15 35 35 G G B . n B 1 16 A 16 36 36 A A B . n B 1 17 A 17 37 37 A A B . n B 1 18 G 18 38 38 G G B . n B 1 19 U 19 39 39 U U B . n B 1 20 C 20 40 40 C C B . n B 1 21 G 21 41 41 G G B . n B 1 22 C 22 42 42 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 JS5 1 50 50 JS5 JS5 A . D 2 JS5 1 51 51 JS5 JS5 B . E 3 HOH 1 100 100 HOH HOH A . E 3 HOH 2 101 101 HOH HOH A . E 3 HOH 3 102 102 HOH HOH A . E 3 HOH 4 103 103 HOH HOH A . E 3 HOH 5 104 104 HOH HOH A . E 3 HOH 6 106 106 HOH HOH A . E 3 HOH 7 108 108 HOH HOH A . E 3 HOH 8 112 112 HOH HOH A . E 3 HOH 9 114 114 HOH HOH A . E 3 HOH 10 115 115 HOH HOH A . E 3 HOH 11 116 116 HOH HOH A . E 3 HOH 12 117 117 HOH HOH A . E 3 HOH 13 120 120 HOH HOH A . E 3 HOH 14 122 122 HOH HOH A . E 3 HOH 15 123 123 HOH HOH A . E 3 HOH 16 124 124 HOH HOH A . E 3 HOH 17 125 125 HOH HOH A . E 3 HOH 18 126 126 HOH HOH A . E 3 HOH 19 127 127 HOH HOH A . E 3 HOH 20 128 128 HOH HOH A . E 3 HOH 21 132 132 HOH HOH A . E 3 HOH 22 133 133 HOH HOH A . E 3 HOH 23 135 135 HOH HOH A . E 3 HOH 24 136 136 HOH HOH A . E 3 HOH 25 137 137 HOH HOH A . E 3 HOH 26 143 143 HOH HOH A . F 3 HOH 1 105 105 HOH HOH B . F 3 HOH 2 107 107 HOH HOH B . F 3 HOH 3 109 109 HOH HOH B . F 3 HOH 4 110 110 HOH HOH B . F 3 HOH 5 111 111 HOH HOH B . F 3 HOH 6 113 113 HOH HOH B . F 3 HOH 7 118 118 HOH HOH B . F 3 HOH 8 119 119 HOH HOH B . F 3 HOH 9 121 121 HOH HOH B . F 3 HOH 10 129 129 HOH HOH B . F 3 HOH 11 130 130 HOH HOH B . F 3 HOH 12 131 131 HOH HOH B . F 3 HOH 13 134 134 HOH HOH B . F 3 HOH 14 138 138 HOH HOH B . F 3 HOH 15 139 139 HOH HOH B . F 3 HOH 16 140 140 HOH HOH B . F 3 HOH 17 141 141 HOH HOH B . F 3 HOH 18 142 142 HOH HOH B . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal DENZO 'data reduction' . ? 1 SCALEPACK 'data scaling' . ? 2 AMoRE phasing . ? 3 CNS refinement 1.1 ? 4 # _cell.entry_id 2BE0 _cell.length_a 39.141 _cell.length_b 39.141 _cell.length_c 99.140 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 8 _cell.pdbx_unique_axis ? _cell.length_a_esd ? _cell.length_b_esd ? _cell.length_c_esd ? _cell.angle_alpha_esd ? _cell.angle_beta_esd ? _cell.angle_gamma_esd ? # _symmetry.entry_id 2BE0 _symmetry.space_group_name_H-M 'P 41' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 76 _symmetry.space_group_name_Hall ? # _exptl.entry_id 2BE0 _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.69 _exptl_crystal.density_percent_sol 54.34 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 310 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 6.4 _exptl_crystal_grow.pdbx_details '6% MPD, 0.3M potassium chloride, 5% glycerol, 0.1M cacodylate, pH 6.4, VAPOR DIFFUSION, HANGING DROP, temperature 310K' _exptl_crystal_grow.pdbx_pH_range . # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.details 1 1 1 MPD ? ? ? 1 2 1 'potassium chloride' ? ? ? 1 3 1 glycerol ? ? ? 1 4 1 cacodylate ? ? ? 1 5 1 H2O ? ? ? 1 6 2 MPD ? ? ? 1 7 2 'potassium chloride' ? ? ? 1 8 2 cacodylate ? ? ? 1 9 2 H2O ? ? ? # _diffrn.id 1 _diffrn.ambient_temp 110 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 4' _diffrn_detector.pdbx_collection_date 2004-02-13 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.933 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'ESRF BEAMLINE ID14-2' _diffrn_source.pdbx_synchrotron_site ESRF _diffrn_source.pdbx_synchrotron_beamline ID14-2 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 0.933 # _reflns.entry_id 2BE0 _reflns.observed_criterion_sigma_I 5.0 _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 50.0 _reflns.d_resolution_high 2.63 _reflns.number_obs 46641 _reflns.number_all 46641 _reflns.percent_possible_obs 99.0 _reflns.pdbx_Rmerge_I_obs 0.06 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI 28 _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 10 _reflns.R_free_details ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _reflns_shell.d_res_high 2.63 _reflns_shell.d_res_low 2.72 _reflns_shell.percent_possible_all 100 _reflns_shell.Rmerge_I_obs 0.26 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.meanI_over_sigI_obs 9.4 _reflns_shell.pdbx_redundancy ? _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_diffrn_id ? _reflns_shell.pdbx_ordinal 1 # _refine.entry_id 2BE0 _refine.ls_number_reflns_obs 4291 _refine.ls_number_reflns_all 4453 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.0 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 30.0 _refine.ls_d_res_high 2.63 _refine.ls_percent_reflns_obs ? _refine.ls_R_factor_obs ? _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2236 _refine.ls_R_factor_R_free 0.2665 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free 3842 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method ? _refine.details ;G. PARKINSON, J. VOJTECHOVSKY, L. CLOWNEY,A.T. BRUNGER, H.M. BERMAN, NEW PARAMETERS FOR THE REFINEMENT OF NUCLEIC ACID CONTAINING STRUCTURES, ACTA CRYST. D, 52, 57-64 (1996) ; _refine.pdbx_starting_model 'PDB ENTRY 1J7T' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.overall_SU_B ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_overall_phase_error ? _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_analyze.entry_id 2BE0 _refine_analyze.Luzzati_coordinate_error_obs 0.42 _refine_analyze.Luzzati_sigma_a_obs 0.52 _refine_analyze.Luzzati_d_res_low_obs ? _refine_analyze.Luzzati_coordinate_error_free ? _refine_analyze.Luzzati_sigma_a_free ? _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 898 _refine_hist.pdbx_number_atoms_ligand 104 _refine_hist.number_atoms_solvent 44 _refine_hist.number_atoms_total 1046 _refine_hist.d_res_high 2.63 _refine_hist.d_res_low 30.0 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function c_bond_d 0.006 ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d 1.023 ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d 10.251 ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d 1.241 ? ? ? 'X-RAY DIFFRACTION' ? # loop_ _pdbx_xplor_file.serial_no _pdbx_xplor_file.param_file _pdbx_xplor_file.topol_file _pdbx_xplor_file.pdbx_refine_id 1 dna-rna_rep.param ? 'X-RAY DIFFRACTION' 2 water_rep.param ? 'X-RAY DIFFRACTION' 3 ion.param ? 'X-RAY DIFFRACTION' 4 JS5_39.param ? 'X-RAY DIFFRACTION' # _database_PDB_matrix.entry_id 2BE0 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 2BE0 _struct.title 'Complex Between Paromomycin Derivative JS5-39 and the 16S-Rrna A-Site.' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2BE0 _struct_keywords.pdbx_keywords RNA/antibiotic _struct_keywords.text 'RNA-AMINOGLYCOSIDE INTERACTIONS, A SITE, UOU PAIRS, AA BULGES, RNA-antibiotic complex' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2BE0 _struct_ref.pdbx_db_accession 2BE0 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 2BE0 A 1 ? 22 ? 2BE0 0 ? 21 ? 0 21 2 1 2BE0 B 1 ? 22 ? 2BE0 21 ? 42 ? 21 42 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details 'The biological assembly is the duplex' _struct_biol.pdbx_parent_biol_id ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 1 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 1 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 1 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 21 N1 ? ? A C 2 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 21 O6 ? ? A C 2 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 21 N2 ? ? A C 2 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 3 B C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 3 B C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 3 B C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 5 N3 ? ? ? 1_555 B U 19 O4 ? ? A U 4 B U 39 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog11 hydrog ? ? A U 5 O2 ? ? ? 1_555 B U 19 N3 ? ? A U 4 B U 39 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog12 hydrog ? ? A C 6 N3 ? ? ? 1_555 B G 18 N1 ? ? A C 5 B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 N4 ? ? ? 1_555 B G 18 O6 ? ? A C 5 B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 O2 ? ? ? 1_555 B G 18 N2 ? ? A C 5 B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 8 N3 ? ? ? 1_555 B G 15 N1 ? ? A C 7 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 8 N4 ? ? ? 1_555 B G 15 O6 ? ? A C 7 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 O2 ? ? ? 1_555 B G 15 N2 ? ? A C 7 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 9 N1 ? ? ? 1_555 B U 14 N3 ? ? A A 8 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 9 N6 ? ? ? 1_555 B U 14 O4 ? ? A A 8 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 9 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 9 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 9 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 10 B G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 10 B G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 10 B G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 11 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 11 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 11 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 12 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 12 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 12 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 14 N3 ? ? ? 1_555 B A 9 N1 ? ? A U 13 B A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 14 O4 ? ? ? 1_555 B A 9 N6 ? ? A U 13 B A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 15 N1 ? ? ? 1_555 B C 8 N3 ? ? A G 14 B C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 15 N2 ? ? ? 1_555 B C 8 O2 ? ? A G 14 B C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 15 O6 ? ? ? 1_555 B C 8 N4 ? ? A G 14 B C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 18 N1 ? ? ? 1_555 B C 6 N3 ? ? A G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 18 N2 ? ? ? 1_555 B C 6 O2 ? ? A G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 18 O6 ? ? ? 1_555 B C 6 N4 ? ? A G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 19 N3 ? ? ? 1_555 B U 5 O2 ? ? A U 18 B U 25 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog41 hydrog ? ? A U 19 O4 ? ? ? 1_555 B U 5 N3 ? ? A U 18 B U 25 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog42 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 20 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 20 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 20 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 21 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 21 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 21 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A JS5 50 ? 14 'BINDING SITE FOR RESIDUE JS5 A 50' AC2 Software B JS5 51 ? 13 'BINDING SITE FOR RESIDUE JS5 B 51' 1 ? ? ? ? ? ? ? # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 14 U A 14 ? U A 13 . ? 1_555 ? 2 AC1 14 G A 15 ? G A 14 . ? 1_555 ? 3 AC1 14 A A 16 ? A A 15 . ? 1_555 ? 4 AC1 14 A A 17 ? A A 16 . ? 1_555 ? 5 AC1 14 G A 18 ? G A 17 . ? 1_555 ? 6 AC1 14 U A 19 ? U A 18 . ? 1_555 ? 7 AC1 14 HOH E . ? HOH A 112 . ? 1_555 ? 8 AC1 14 HOH E . ? HOH A 124 . ? 1_555 ? 9 AC1 14 HOH E . ? HOH A 135 . ? 1_555 ? 10 AC1 14 C B 3 ? C B 23 . ? 1_555 ? 11 AC1 14 U B 5 ? U B 25 . ? 1_555 ? 12 AC1 14 C B 6 ? C B 26 . ? 1_555 ? 13 AC1 14 A B 7 ? A B 27 . ? 1_555 ? 14 AC1 14 A B 9 ? A B 29 . ? 1_555 ? 15 AC2 13 G A 4 ? G A 3 . ? 1_555 ? 16 AC2 13 U A 5 ? U A 4 . ? 1_555 ? 17 AC2 13 C A 6 ? C A 5 . ? 1_555 ? 18 AC2 13 A A 7 ? A A 6 . ? 1_555 ? 19 AC2 13 A A 9 ? A A 8 . ? 1_555 ? 20 AC2 13 HOH E . ? HOH A 126 . ? 1_555 ? 21 AC2 13 U B 14 ? U B 34 . ? 1_555 ? 22 AC2 13 G B 15 ? G B 35 . ? 1_555 ? 23 AC2 13 A B 16 ? A B 36 . ? 1_555 ? 24 AC2 13 A B 17 ? A B 37 . ? 1_555 ? 25 AC2 13 G B 18 ? G B 38 . ? 1_555 ? 26 AC2 13 U B 19 ? U B 39 . ? 1_555 ? 27 AC2 13 HOH F . ? HOH B 107 . ? 1_555 ? # loop_ _pdbx_validate_chiral.id _pdbx_validate_chiral.PDB_model_num _pdbx_validate_chiral.auth_atom_id _pdbx_validate_chiral.label_alt_id _pdbx_validate_chiral.auth_asym_id _pdbx_validate_chiral.auth_comp_id _pdbx_validate_chiral.auth_seq_id _pdbx_validate_chiral.PDB_ins_code _pdbx_validate_chiral.details _pdbx_validate_chiral.omega 1 1 C15 ? A JS5 50 ? PLANAR . 2 1 C15 ? B JS5 51 ? PLANAR . # _struct_site_keywords.site_id 1 _struct_site_keywords.text bis-intercalation # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A C 0 ? A C 1 2 1 Y 1 B C 21 ? B C 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 JS5 C11 C N S 114 JS5 O11 O N N 115 JS5 C21 C N R 116 JS5 N21 N N N 117 JS5 C31 C N R 118 JS5 O31 O N N 119 JS5 C41 C N S 120 JS5 O41 O N N 121 JS5 C51 C N R 122 JS5 O51 O N N 123 JS5 C61 C N N 124 JS5 O61 O N N 125 JS5 C12 C N R 126 JS5 N12 N N N 127 JS5 C22 C N N 128 JS5 C32 C N S 129 JS5 N32 N N N 130 JS5 C42 C N R 131 JS5 C52 C N R 132 JS5 O52 O N N 133 JS5 C62 C N S 134 JS5 O62 O N N 135 JS5 C13 C N S 136 JS5 O13 O N N 137 JS5 C23 C N R 138 JS5 O23 O N N 139 JS5 C33 C N R 140 JS5 O33 O N N 141 JS5 C43 C N R 142 JS5 C53 C N N 143 JS5 O53 O N N 144 JS5 C63 C N N 145 JS5 C73 C N N 146 JS5 N73 N N N 147 JS5 C83 C N N 148 JS5 C15 C N R 149 JS5 C25 C N N 150 JS5 N25 N N N 151 JS5 C35 C N N 152 JS5 C45 C N N 153 JS5 C55 C N N 154 JS5 C14 C N R 155 JS5 C24 C N R 156 JS5 N24 N N N 157 JS5 C34 C N R 158 JS5 O34 O N N 159 JS5 C44 C N S 160 JS5 O44 O N N 161 JS5 C54 C N S 162 JS5 O54 O N N 163 JS5 C64 C N N 164 JS5 N64 N N N 165 JS5 H11 H N N 166 JS5 H21 H N N 167 JS5 H211 H N N 168 JS5 H212 H N N 169 JS5 H31 H N N 170 JS5 H3 H N N 171 JS5 H41 H N N 172 JS5 H2 H N N 173 JS5 H51 H N N 174 JS5 H611 H N N 175 JS5 H612 H N N 176 JS5 H61 H N N 177 JS5 H12 H N N 178 JS5 H121 H N N 179 JS5 H122 H N N 180 JS5 H221 H N N 181 JS5 H222 H N N 182 JS5 H32 H N N 183 JS5 H321 H N N 184 JS5 H322 H N N 185 JS5 H42 H N N 186 JS5 H52 H N N 187 JS5 H62 H N N 188 JS5 H1 H N N 189 JS5 H13 H N N 190 JS5 H23 H N N 191 JS5 H33 H N N 192 JS5 H43 H N N 193 JS5 H531 H N N 194 JS5 H532 H N N 195 JS5 H53 H N N 196 JS5 H631 H N N 197 JS5 H632 H N N 198 JS5 H731 H N N 199 JS5 H732 H N N 200 JS5 H73 H N N 201 JS5 H831 H N N 202 JS5 H832 H N N 203 JS5 H15 H N N 204 JS5 H251 H N N 205 JS5 H252 H N N 206 JS5 H25 H N N 207 JS5 H351 H N N 208 JS5 H352 H N N 209 JS5 H451 H N N 210 JS5 H452 H N N 211 JS5 H551 H N N 212 JS5 H552 H N N 213 JS5 H14 H N N 214 JS5 H24 H N N 215 JS5 H241 H N N 216 JS5 H242 H N N 217 JS5 H34 H N N 218 JS5 H4 H N N 219 JS5 H44 H N N 220 JS5 H5 H N N 221 JS5 H54 H N N 222 JS5 H11A H N N 223 JS5 H12A H N N 224 JS5 H641 H N N 225 JS5 H642 H N N 226 U OP3 O N N 227 U P P N N 228 U OP1 O N N 229 U OP2 O N N 230 U "O5'" O N N 231 U "C5'" C N N 232 U "C4'" C N R 233 U "O4'" O N N 234 U "C3'" C N S 235 U "O3'" O N N 236 U "C2'" C N R 237 U "O2'" O N N 238 U "C1'" C N R 239 U N1 N N N 240 U C2 C N N 241 U O2 O N N 242 U N3 N N N 243 U C4 C N N 244 U O4 O N N 245 U C5 C N N 246 U C6 C N N 247 U HOP3 H N N 248 U HOP2 H N N 249 U "H5'" H N N 250 U "H5''" H N N 251 U "H4'" H N N 252 U "H3'" H N N 253 U "HO3'" H N N 254 U "H2'" H N N 255 U "HO2'" H N N 256 U "H1'" H N N 257 U H3 H N N 258 U H5 H N N 259 U H6 H N N 260 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 JS5 C11 O11 sing N N 118 JS5 C11 C21 sing N N 119 JS5 C11 O51 sing N N 120 JS5 C11 H11 sing N N 121 JS5 O11 C42 sing N N 122 JS5 C21 N21 sing N N 123 JS5 C21 C31 sing N N 124 JS5 C21 H21 sing N N 125 JS5 N21 H211 sing N N 126 JS5 N21 H212 sing N N 127 JS5 C31 O31 sing N N 128 JS5 C31 C41 sing N N 129 JS5 C31 H31 sing N N 130 JS5 O31 H3 sing N N 131 JS5 C41 O41 sing N N 132 JS5 C41 C51 sing N N 133 JS5 C41 H41 sing N N 134 JS5 O41 H2 sing N N 135 JS5 C51 O51 sing N N 136 JS5 C51 C61 sing N N 137 JS5 C51 H51 sing N N 138 JS5 C61 O61 sing N N 139 JS5 C61 H611 sing N N 140 JS5 C61 H612 sing N N 141 JS5 O61 H61 sing N N 142 JS5 C12 N12 sing N N 143 JS5 C12 C22 sing N N 144 JS5 C12 C62 sing N N 145 JS5 C12 H12 sing N N 146 JS5 N12 H121 sing N N 147 JS5 N12 H122 sing N N 148 JS5 C22 C32 sing N N 149 JS5 C22 H221 sing N N 150 JS5 C22 H222 sing N N 151 JS5 C32 N32 sing N N 152 JS5 C32 C42 sing N N 153 JS5 C32 H32 sing N N 154 JS5 N32 H321 sing N N 155 JS5 N32 H322 sing N N 156 JS5 C42 C52 sing N N 157 JS5 C42 H42 sing N N 158 JS5 C52 O52 sing N N 159 JS5 C52 C62 sing N N 160 JS5 C52 H52 sing N N 161 JS5 O52 C13 sing N N 162 JS5 C62 O62 sing N N 163 JS5 C62 H62 sing N N 164 JS5 O62 H1 sing N N 165 JS5 C13 O13 sing N N 166 JS5 C13 C23 sing N N 167 JS5 C13 H13 sing N N 168 JS5 O13 C43 sing N N 169 JS5 C23 O23 sing N N 170 JS5 C23 C33 sing N N 171 JS5 C23 H23 sing N N 172 JS5 O23 C63 sing N N 173 JS5 C33 O33 sing N N 174 JS5 C33 C43 sing N N 175 JS5 C33 H33 sing N N 176 JS5 O33 C14 sing N N 177 JS5 C43 C53 sing N N 178 JS5 C43 H43 sing N N 179 JS5 C53 O53 sing N N 180 JS5 C53 H531 sing N N 181 JS5 C53 H532 sing N N 182 JS5 O53 H53 sing N N 183 JS5 C63 C73 sing N N 184 JS5 C63 H631 sing N N 185 JS5 C63 H632 sing N N 186 JS5 C73 N73 sing N N 187 JS5 C73 H731 sing N N 188 JS5 C73 H732 sing N N 189 JS5 N73 C83 sing N N 190 JS5 N73 H73 sing N N 191 JS5 C83 C15 sing N N 192 JS5 C83 H831 sing N N 193 JS5 C83 H832 sing N N 194 JS5 C15 C25 sing N N 195 JS5 C15 C55 sing N N 196 JS5 C15 H15 sing N N 197 JS5 C25 N25 sing N N 198 JS5 C25 H251 sing N N 199 JS5 C25 H252 sing N N 200 JS5 N25 C35 sing N N 201 JS5 N25 H25 sing N N 202 JS5 C35 C45 sing N N 203 JS5 C35 H351 sing N N 204 JS5 C35 H352 sing N N 205 JS5 C45 C55 sing N N 206 JS5 C45 H451 sing N N 207 JS5 C45 H452 sing N N 208 JS5 C55 H551 sing N N 209 JS5 C55 H552 sing N N 210 JS5 C14 C24 sing N N 211 JS5 C14 O54 sing N N 212 JS5 C14 H14 sing N N 213 JS5 C24 N24 sing N N 214 JS5 C24 C34 sing N N 215 JS5 C24 H24 sing N N 216 JS5 N24 H241 sing N N 217 JS5 N24 H242 sing N N 218 JS5 C34 O34 sing N N 219 JS5 C34 C44 sing N N 220 JS5 C34 H34 sing N N 221 JS5 O34 H4 sing N N 222 JS5 C44 O44 sing N N 223 JS5 C44 C54 sing N N 224 JS5 C44 H44 sing N N 225 JS5 O44 H5 sing N N 226 JS5 C54 O54 sing N N 227 JS5 C54 C64 sing N N 228 JS5 C54 H54 sing N N 229 JS5 C64 N64 sing N N 230 JS5 C64 H11A sing N N 231 JS5 C64 H12A sing N N 232 JS5 N64 H641 sing N N 233 JS5 N64 H642 sing N N 234 U OP3 P sing N N 235 U OP3 HOP3 sing N N 236 U P OP1 doub N N 237 U P OP2 sing N N 238 U P "O5'" sing N N 239 U OP2 HOP2 sing N N 240 U "O5'" "C5'" sing N N 241 U "C5'" "C4'" sing N N 242 U "C5'" "H5'" sing N N 243 U "C5'" "H5''" sing N N 244 U "C4'" "O4'" sing N N 245 U "C4'" "C3'" sing N N 246 U "C4'" "H4'" sing N N 247 U "O4'" "C1'" sing N N 248 U "C3'" "O3'" sing N N 249 U "C3'" "C2'" sing N N 250 U "C3'" "H3'" sing N N 251 U "O3'" "HO3'" sing N N 252 U "C2'" "O2'" sing N N 253 U "C2'" "C1'" sing N N 254 U "C2'" "H2'" sing N N 255 U "O2'" "HO2'" sing N N 256 U "C1'" N1 sing N N 257 U "C1'" "H1'" sing N N 258 U N1 C2 sing N N 259 U N1 C6 sing N N 260 U C2 O2 doub N N 261 U C2 N3 sing N N 262 U N3 C4 sing N N 263 U N3 H3 sing N N 264 U C4 O4 doub N N 265 U C4 C5 sing N N 266 U C5 C6 doub N N 267 U C5 H5 sing N N 268 U C6 H6 sing N N 269 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2BE0 'double helix' 2BE0 'a-form double helix' 2BE0 'mismatched base pair' 2BE0 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 B C 22 1_555 -0.126 -0.247 -0.123 -6.536 -2.910 -2.103 1 A_G1:C42_B A 1 ? B 42 ? 19 1 1 A C 3 1_555 B G 21 1_555 -0.113 -0.199 0.178 0.138 -5.548 -4.437 2 A_C2:G41_B A 2 ? B 41 ? 19 1 1 A G 4 1_555 B C 20 1_555 0.071 -0.058 0.057 -4.505 -11.582 3.368 3 A_G3:C40_B A 3 ? B 40 ? 19 1 1 A U 5 1_555 B U 19 1_555 2.049 -1.730 0.284 -4.921 -5.744 5.972 4 A_U4:U39_B A 4 ? B 39 ? 16 1 1 A C 6 1_555 B G 18 1_555 0.223 -0.052 -0.143 -5.677 -6.020 2.595 5 A_C5:G38_B A 5 ? B 38 ? 19 1 1 A C 8 1_555 B G 15 1_555 0.413 -0.048 0.212 7.154 -19.675 4.582 6 A_C7:G35_B A 7 ? B 35 ? 19 1 1 A A 9 1_555 B U 14 1_555 0.187 -0.234 0.377 6.093 -12.348 3.017 7 A_A8:U34_B A 8 ? B 34 ? 20 1 1 A C 10 1_555 B G 13 1_555 0.258 -0.151 0.124 2.672 -14.137 1.169 8 A_C9:G33_B A 9 ? B 33 ? 19 1 1 A C 11 1_555 B G 12 1_555 0.076 -0.015 0.144 0.117 -8.722 2.955 9 A_C10:G32_B A 10 ? B 32 ? 19 1 1 A G 12 1_555 B C 11 1_555 -0.195 -0.067 0.099 0.272 -7.967 3.322 10 A_G11:C31_B A 11 ? B 31 ? 19 1 1 A G 13 1_555 B C 10 1_555 -0.339 -0.103 0.178 -2.297 -14.375 2.354 11 A_G12:C30_B A 12 ? B 30 ? 19 1 1 A U 14 1_555 B A 9 1_555 -0.069 -0.185 0.367 -5.095 -14.706 4.320 12 A_U13:A29_B A 13 ? B 29 ? 20 1 1 A G 15 1_555 B C 8 1_555 -0.352 -0.049 0.139 -6.608 -17.015 4.300 13 A_G14:C28_B A 14 ? B 28 ? 19 1 1 A G 18 1_555 B C 6 1_555 -0.205 -0.026 -0.366 1.664 -6.366 1.066 14 A_G17:C26_B A 17 ? B 26 ? 19 1 1 A U 19 1_555 B U 5 1_555 -2.252 -1.665 0.326 -2.756 -5.669 6.437 15 A_U18:U25_B A 18 ? B 25 ? 16 1 1 A C 20 1_555 B G 4 1_555 -0.021 -0.131 -0.202 9.120 -14.505 2.941 16 A_C19:G24_B A 19 ? B 24 ? 19 1 1 A G 21 1_555 B C 3 1_555 -0.023 -0.220 0.047 -1.278 -4.034 -3.959 17 A_G20:C23_B A 20 ? B 23 ? 19 1 1 A C 22 1_555 B G 2 1_555 0.198 -0.241 -0.049 3.075 -2.760 0.246 18 A_C21:G22_B A 21 ? B 22 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 B C 22 1_555 A C 3 1_555 B G 21 1_555 -0.179 -1.560 3.229 -2.406 0.887 29.379 -3.251 -0.151 3.186 1.744 4.733 29.488 1 AA_G1C2:G41C42_BB A 1 ? B 42 ? A 2 ? B 41 ? 1 A C 3 1_555 B G 21 1_555 A G 4 1_555 B C 20 1_555 0.686 -2.065 3.234 0.991 10.252 31.860 -5.109 -1.046 2.488 18.094 -1.748 33.443 2 AA_C2G3:C40G41_BB A 2 ? B 41 ? A 3 ? B 40 ? 1 A G 4 1_555 B C 20 1_555 A U 5 1_555 B U 19 1_555 0.389 -1.413 3.328 -1.394 -0.133 39.424 -2.077 -0.743 3.317 -0.197 2.066 39.448 3 AA_G3U4:U39C40_BB A 3 ? B 40 ? A 4 ? B 39 ? 1 A U 5 1_555 B U 19 1_555 A C 6 1_555 B G 18 1_555 -0.303 -2.720 3.203 5.141 -0.886 26.825 -5.543 1.901 3.177 -1.886 -10.951 27.318 4 AA_U4C5:G38U39_BB A 4 ? B 39 ? A 5 ? B 38 ? 1 A C 6 1_555 B G 18 1_555 A C 8 1_555 B G 15 1_555 1.817 -3.425 6.016 -12.306 21.718 76.773 -3.638 -1.966 4.784 17.070 9.672 80.130 5 AA_C5C7:G35G38_BB A 5 ? B 38 ? A 7 ? B 35 ? 1 A C 8 1_555 B G 15 1_555 A A 9 1_555 B U 14 1_555 0.194 -1.706 3.006 -1.722 12.344 32.378 -4.437 -0.544 2.214 21.183 2.955 34.634 6 AA_C7A8:U34G35_BB A 7 ? B 35 ? A 8 ? B 34 ? 1 A A 9 1_555 B U 14 1_555 A C 10 1_555 B G 13 1_555 -0.290 -1.516 3.116 1.992 7.016 34.173 -3.487 0.756 2.740 11.772 -3.342 34.920 7 AA_A8C9:G33U34_BB A 8 ? B 34 ? A 9 ? B 33 ? 1 A C 10 1_555 B G 13 1_555 A C 11 1_555 B G 12 1_555 -0.100 -1.618 3.268 0.299 5.064 32.162 -3.736 0.229 2.984 9.071 -0.535 32.549 8 AA_C9C10:G32G33_BB A 9 ? B 33 ? A 10 ? B 32 ? 1 A C 11 1_555 B G 12 1_555 A G 12 1_555 B C 11 1_555 0.068 -1.789 3.252 0.848 5.258 25.448 -5.338 0.069 2.831 11.773 -1.900 25.990 9 AA_C10G11:C31G32_BB A 10 ? B 32 ? A 11 ? B 31 ? 1 A G 12 1_555 B C 11 1_555 A G 13 1_555 B C 10 1_555 0.288 -1.623 3.213 -1.058 5.675 33.225 -3.666 -0.658 2.894 9.832 1.833 33.709 10 AA_G11G12:C30C31_BB A 11 ? B 31 ? A 12 ? B 30 ? 1 A G 13 1_555 B C 10 1_555 A U 14 1_555 B A 9 1_555 0.330 -1.381 3.133 -1.717 7.798 35.104 -3.249 -0.757 2.755 12.725 2.802 35.973 11 AA_G12U13:A29C30_BB A 12 ? B 30 ? A 13 ? B 29 ? 1 A U 14 1_555 B A 9 1_555 A G 15 1_555 B C 8 1_555 -0.299 -1.751 2.949 1.946 11.053 31.869 -4.475 0.772 2.214 19.393 -3.414 33.740 12 AA_U13G14:C28A29_BB A 13 ? B 29 ? A 14 ? B 28 ? 1 A G 15 1_555 B C 8 1_555 A G 18 1_555 B C 6 1_555 -1.746 -3.429 6.217 13.412 23.474 76.103 -3.758 1.981 4.857 18.500 -10.570 80.072 13 AA_G14G17:C26C28_BB A 14 ? B 28 ? A 17 ? B 26 ? 1 A G 18 1_555 B C 6 1_555 A U 19 1_555 B U 5 1_555 0.365 -2.783 3.308 -7.696 0.360 27.050 -5.814 -2.544 3.053 0.750 16.046 28.106 14 AA_G17U18:U25C26_BB A 17 ? B 26 ? A 18 ? B 25 ? 1 A U 19 1_555 B U 5 1_555 A C 20 1_555 B G 4 1_555 -0.388 -1.264 3.035 5.132 -3.866 40.192 -1.416 1.093 3.069 -5.583 -7.410 40.681 15 AA_U18C19:G24U25_BB A 18 ? B 25 ? A 19 ? B 24 ? 1 A C 20 1_555 B G 4 1_555 A G 21 1_555 B C 3 1_555 -0.497 -2.147 3.388 -2.138 14.886 31.129 -5.701 0.540 2.193 25.928 3.723 34.491 16 AA_C19G20:C23G24_BB A 19 ? B 24 ? A 20 ? B 23 ? 1 A G 21 1_555 B C 3 1_555 A C 22 1_555 B G 2 1_555 0.331 -1.625 3.255 0.963 0.607 28.710 -3.411 -0.452 3.230 1.224 -1.942 28.732 17 AA_G20C21:G22C23_BB A 20 ? B 23 ? A 21 ? B 22 ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 1J7T _pdbx_initial_refinement_model.details 'PDB ENTRY 1J7T' # _atom_sites.entry_id 2BE0 _atom_sites.fract_transf_matrix[1][1] 0.025549 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.025549 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010087 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_