data_2GV4 # _entry.id 2GV4 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2GV4 pdb_00002gv4 10.2210/pdb2gv4/pdb RCSB RCSB037586 ? ? WWPDB D_1000037586 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 2GRW _pdbx_database_related.details . _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2GV4 _pdbx_database_status.recvd_initial_deposition_date 2006-05-02 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Heus, H.A.' 1 'Zoll, J.' 2 'Tessari, M.' 3 'van Kuppeveld, F.J.M.' 4 'Melchers, W.J.G.' 5 # _citation.id primary _citation.title ;Breaking pseudo-twofold symmetry in the poliovirus 3'-UTR Y-stem by restoring Watson-Crick base pairs. ; _citation.journal_abbrev Rna _citation.journal_volume 13 _citation.page_first 781 _citation.page_last 792 _citation.year 2007 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 17449731 _citation.pdbx_database_id_DOI 10.1261/rna.375607 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Zoll, J.' 1 ? primary 'Tessari, M.' 2 ? primary 'Van Kuppeveld, F.J.M.' 3 ? primary 'Melchers, W.J.G.' 4 ? primary 'Heus, H.A.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;Short RNA strand 5'-GGACCUCUCGAAAGAGUGGUCC-3' ; _entity.formula_weight 7073.267 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ;poliovirus 3'-UTR Y-stem ; _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGACCUCUCGAAAGAGUGGUCC _entity_poly.pdbx_seq_one_letter_code_can GGACCUCUCGAAAGAGUGGUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 C n 1 5 C n 1 6 U n 1 7 C n 1 8 U n 1 9 C n 1 10 G n 1 11 A n 1 12 A n 1 13 A n 1 14 G n 1 15 A n 1 16 G n 1 17 U n 1 18 G n 1 19 G n 1 20 U n 1 21 C n 1 22 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details ;This sequence is a mutant of poliovirus 3'-UTR Y-stem ; # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2GV4 _struct_ref.pdbx_db_accession 2GV4 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2GV4 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 22 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2GV4 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 22 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 22 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '2D NOESY' 1 2 2 '2D NOESY' 2 3 2 DQF-COSY 2 4 2 '2D TOCSY' 2 5 2 2D-HSQC 2 6 3 2D-HSQC 3 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 300 ambient 6.8 '5 mM' . K 2 300 ambient 6.8 '5 mM' . K 3 300 ambient 6.8 '5 mM' . K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '2mM RNA, pH 6.8' '90% H2O/10% D2O' 2 '2mM RNA pH 6.8' '100% D2O' 3 '2mM RNA, 27 mg/ml philamentous phage Pf1' '100% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 INOVA Varian 800 ? 2 INOVA Varian 600 ? # _pdbx_nmr_refine.entry_id 2GV4 _pdbx_nmr_refine.method 'torsion angle dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 2GV4 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 13 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 2GV4 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal collection VNMR 6.1 Varian 1 processing NMRPipe 2.1 'F. Delaglio' 2 'data analysis' Sparky 3.106 'T.D. Goddard and D.G. Kneller' 3 'structure solution' X-PLOR 3.1 'A.T. Brunger' 4 refinement X-PLOR 3.1 'A.T. Brunger' 5 # _exptl.entry_id 2GV4 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 2GV4 _struct.title ;Solution structure of the poliovirus 3'-UTR Y-stem ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2GV4 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA, poliovirus, stem-loop, pseudo-2-fold symmetry' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 1 A C 22 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog2 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 21 O2 ? ? A G 2 A C 21 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog3 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 20 N3 ? ? A A 3 A U 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 20 O4 ? ? A A 3 A U 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 19 N1 ? ? A C 4 A G 19 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog6 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 5 A G 18 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog7 hydrog ? ? A U 6 O4 ? ? ? 1_555 A U 17 N3 ? ? A U 6 A U 17 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog8 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 16 N1 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog9 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 15 N1 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 15 N6 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog12 hydrog ? ? A G 10 N2 ? ? ? 1_555 A A 13 N7 ? ? A G 10 A A 13 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog13 hydrog ? ? A G 10 N3 ? ? ? 1_555 A A 13 N6 ? ? A G 10 A A 13 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 2GV4 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 2GV4 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 C 4 4 4 C C A . n A 1 5 C 5 5 5 C C A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2007-03-20 2 'Structure model' 1 1 2008-05-01 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-09 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_struct_assembly 3 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 9 "O4'" A C 7 ? ? "C1'" A C 7 ? ? N1 A C 7 ? ? 112.71 108.50 4.21 0.70 N 2 10 "O4'" A C 7 ? ? "C1'" A C 7 ? ? N1 A C 7 ? ? 112.80 108.50 4.30 0.70 N 3 11 "O4'" A C 7 ? ? "C1'" A C 7 ? ? N1 A C 7 ? ? 112.75 108.50 4.25 0.70 N 4 13 "O4'" A C 7 ? ? "C1'" A C 7 ? ? N1 A C 7 ? ? 112.85 108.50 4.35 0.70 N # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2GV4 'a-form double helix' 2GV4 tetraloop 2GV4 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 22 1_555 0.444 0.451 0.140 7.087 6.144 2.386 1 A_G1:C22_A A 1 ? A 22 ? ? 1 1 A G 2 1_555 A C 21 1_555 -2.058 -0.330 -0.091 3.014 -7.356 -0.989 2 A_G2:C21_A A 2 ? A 21 ? ? ? 1 A A 3 1_555 A U 20 1_555 0.055 0.006 -0.196 -3.754 -8.045 -5.051 3 A_A3:U20_A A 3 ? A 20 ? 20 1 1 A C 4 1_555 A G 19 1_555 1.336 0.082 -0.553 -3.026 -0.608 1.914 4 A_C4:G19_A A 4 ? A 19 ? ? 1 1 A C 5 1_555 A G 18 1_555 1.342 -0.343 0.127 -3.302 6.644 -10.080 5 A_C5:G18_A A 5 ? A 18 ? ? 1 1 A U 6 1_555 A U 17 1_555 -3.480 -1.326 -0.056 5.650 -8.948 1.447 6 A_U6:U17_A A 6 ? A 17 ? ? ? 1 A C 7 1_555 A G 16 1_555 0.852 0.184 0.069 4.982 -10.982 9.039 7 A_C7:G16_A A 7 ? A 16 ? ? 1 1 A U 8 1_555 A A 15 1_555 0.043 0.017 0.082 -5.132 -2.885 -9.455 8 A_U8:A15_A A 8 ? A 15 ? 20 1 1 A C 9 1_555 A G 14 1_555 -0.370 0.345 -0.015 -1.779 2.747 7.084 9 A_C9:G14_A A 9 ? A 14 ? ? 1 1 A G 10 1_555 A A 13 1_555 6.826 -4.622 0.420 0.503 -2.701 -7.063 10 A_G10:A13_A A 10 ? A 13 ? 11 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 22 1_555 A G 2 1_555 A C 21 1_555 -2.276 -1.002 3.106 -10.634 12.237 29.428 -3.776 2.176 3.085 22.102 19.207 33.511 1 AA_G1G2:C21C22_AA A 1 ? A 22 ? A 2 ? A 21 ? 1 A G 2 1_555 A C 21 1_555 A A 3 1_555 A U 20 1_555 -0.960 -0.874 4.100 -4.324 11.238 45.652 -2.234 0.762 3.864 14.195 5.462 47.131 2 AA_G2A3:U20C21_AA A 2 ? A 21 ? A 3 ? A 20 ? 1 A A 3 1_555 A U 20 1_555 A C 4 1_555 A G 19 1_555 1.272 -1.441 3.646 2.522 1.814 37.828 -2.474 -1.597 3.650 2.792 -3.883 37.951 3 AA_A3C4:G19U20_AA A 3 ? A 20 ? A 4 ? A 19 ? 1 A C 4 1_555 A G 19 1_555 A C 5 1_555 A G 18 1_555 -1.578 -1.725 3.380 -0.537 13.628 31.448 -4.941 2.603 2.469 23.791 0.937 34.210 4 AA_C4C5:G18G19_AA A 4 ? A 19 ? A 5 ? A 18 ? 1 A C 5 1_555 A G 18 1_555 A U 6 1_555 A U 17 1_555 1.682 -0.593 3.374 4.783 13.171 19.184 -5.966 -2.449 2.745 34.222 -12.428 23.718 5 AA_C5U6:U17G18_AA A 5 ? A 18 ? A 6 ? A 17 ? 1 A U 6 1_555 A U 17 1_555 A C 7 1_555 A G 16 1_555 1.013 -0.606 3.530 -2.682 14.342 46.706 -1.880 -1.440 3.166 17.593 3.289 48.810 6 AA_U6C7:G16U17_AA A 6 ? A 17 ? A 7 ? A 16 ? 1 A C 7 1_555 A G 16 1_555 A U 8 1_555 A A 15 1_555 -2.049 -1.863 3.388 0.175 22.295 28.026 -5.785 3.367 1.527 39.138 -0.307 35.673 7 AA_C7U8:A15G16_AA A 7 ? A 16 ? A 8 ? A 15 ? 1 A U 8 1_555 A A 15 1_555 A C 9 1_555 A G 14 1_555 1.838 -1.041 3.676 2.715 3.747 28.475 -3.034 -3.006 3.667 7.554 -5.474 28.841 8 AA_U8C9:G14A15_AA A 8 ? A 15 ? A 9 ? A 14 ? 1 A C 9 1_555 A G 14 1_555 A G 10 1_555 A A 13 1_555 -1.102 -0.340 3.523 1.583 16.949 49.167 -1.599 1.373 3.216 19.699 -1.839 51.857 9 AA_C9G10:A13G14_AA A 9 ? A 14 ? A 10 ? A 13 ? #