data_2HNS # _entry.id 2HNS # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2HNS pdb_00002hns 10.2210/pdb2hns/pdb RCSB RCSB038555 ? ? WWPDB D_1000038555 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2HNS _pdbx_database_status.recvd_initial_deposition_date 2006-07-13 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Gaudin, C.' 1 'Fourmy, F.' 2 'Yoshizawa, S.' 3 # _citation.id primary _citation.title 'Structure of an AAGU Tetraloop and its Contribution to Substrate Selection by yeast RNase III.' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 363 _citation.page_first 322 _citation.page_last 331 _citation.year 2006 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 16979185 _citation.pdbx_database_id_DOI 10.1016/j.jmb.2006.08.029 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Gaudin, C.' 1 ? primary 'Ghazal, G.' 2 ? primary 'Yoshizawa, S.' 3 ? primary 'Elela, S.A.' 4 ? primary 'Fourmy, D.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-R(*GP*GP*CP*GP*UP*GP*AP*UP*CP*AP*AP*GP*UP*GP*AP*UP*CP*GP*CP*GP*CP*C)-3'" _entity.formula_weight 7089.266 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCGUGAUCAAGUGAUCGCGCC _entity_poly.pdbx_seq_one_letter_code_can GGCGUGAUCAAGUGAUCGCGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 G n 1 7 A n 1 8 U n 1 9 C n 1 10 A n 1 11 A n 1 12 G n 1 13 U n 1 14 G n 1 15 A n 1 16 U n 1 17 C n 1 18 G n 1 19 C n 1 20 G n 1 21 C n 1 22 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'RNA was prepared by in vitro transcription' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2HNS _struct_ref.pdbx_db_accession 2HNS _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2HNS _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 22 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2HNS _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 22 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 22 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '2D NOESY' 1 2 2 '2D NOESY' 2 3 2 '2D TOCSY' 2 4 2 DQF-COSY 2 5 2 '2D HMQC' 3 6 2 '3D HCCH-TOCSY' 3 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 288 ambient 6.4 '10mM sodium phosphate' . K 2 303 ambient 6.4 '10mM sodium phosphate' . K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 '1mM RNA, 10mM phosphate buffer pH 6.4, 90% H2O, 10% D2O' '90% H2O/10% D2O' 2 '1mM RNA; 10mM phosphate buffer pH 6.4, 100% D2O' '100% D2O' 3 '1mM RNA A-15N,13C; 10mM phosphate buffer pH 6.4, 100% D2O' '100% D2O' 4 '1mM RNA c-15N,13C; 10mM phosphate buffer pH 6.4, 100% D2O' '100% D2O' 5 '1mM RNA G-15N,13C; 10mM phosphate buffer pH 6.4, 100% D2O' '100% D2O' 6 '1mM RNA U-15N,13C; 10mM phosphate buffer pH 6.4, 100% D2O' '100% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 DRX Bruker 800 ? 2 DRX Bruker 600 ? 3 INOVA Varian 500 ? # _pdbx_nmr_refine.entry_id 2HNS _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 2HNS _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 2HNS _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal collection XwinNMR 3.1 ? 1 'data analysis' Gifa 4.0 'M.A. DELSUC' 2 'data analysis' Sparky 3.110 ? 3 'structure solution' CNS 1.1 'BRUNGER A' 4 refinement CNS 1.1 'BRUNGER A' 5 # _exptl.entry_id 2HNS _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _struct.entry_id 2HNS _struct.title 'Structure of the AAGU tetraloop' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2HNS _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'tetraloop, hairpin, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 1 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 1 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 1 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 2 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 2 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 2 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 3 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 3 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 3 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 4 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 4 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 4 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 18 O6 ? ? A U 5 A G 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 18 N1 ? ? A U 5 A G 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 17 N3 ? ? A G 6 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 17 O2 ? ? A G 6 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 17 N4 ? ? A G 6 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 16 N3 ? ? A A 7 A U 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 16 O4 ? ? A A 7 A U 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 15 N1 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 15 N6 ? ? A U 8 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 14 N1 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 14 O6 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 2HNS _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 2HNS _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 A 7 7 7 A A A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 U 16 16 16 U U A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 C 19 19 19 C C A . n A 1 20 G 20 20 20 G G A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2006-10-31 2 'Structure model' 1 1 2008-05-01 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-09 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.57 2 2 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.52 3 3 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.56 4 4 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.59 5 5 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.59 6 6 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.55 7 7 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.51 8 8 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.53 9 9 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.58 10 10 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.50 11 12 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.54 12 13 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.56 13 14 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.51 14 15 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.56 15 16 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.54 16 17 "O2'" A G 12 ? ? "H5'" A U 13 ? ? 1.49 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2HNS 'a-form double helix' 2HNS 'hairpin loop' 2HNS 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 22 1_555 -0.695 -0.197 0.004 0.580 -0.483 -2.300 1 A_G1:C22_A A 1 ? A 22 ? 19 1 1 A G 2 1_555 A C 21 1_555 -0.677 -0.181 0.024 1.066 -1.389 -1.725 2 A_G2:C21_A A 2 ? A 21 ? 19 1 1 A C 3 1_555 A G 20 1_555 0.050 -0.186 0.349 8.534 -24.516 -5.928 3 A_C3:G20_A A 3 ? A 20 ? 19 1 1 A G 4 1_555 A C 19 1_555 0.033 0.003 0.056 -2.941 -5.948 -4.264 4 A_G4:C19_A A 4 ? A 19 ? 19 1 1 A U 5 1_555 A G 18 1_555 1.713 -0.395 0.073 -0.461 -5.789 2.773 5 A_U5:G18_A A 5 ? A 18 ? 28 1 1 A G 6 1_555 A C 17 1_555 -0.652 -0.200 0.026 -1.125 -5.919 -4.287 6 A_G6:C17_A A 6 ? A 17 ? 19 1 1 A A 7 1_555 A U 16 1_555 0.147 -0.227 0.010 -0.989 -5.336 -4.515 7 A_A7:U16_A A 7 ? A 16 ? 20 1 1 A U 8 1_555 A A 15 1_555 0.165 -0.191 -0.005 -1.885 -5.559 -5.504 8 A_U8:A15_A A 8 ? A 15 ? 20 1 1 A C 9 1_555 A G 14 1_555 0.357 -0.066 0.043 -1.932 -2.619 -2.326 9 A_C9:G14_A A 9 ? A 14 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 22 1_555 A G 2 1_555 A C 21 1_555 -0.091 -0.685 3.982 -1.453 16.597 30.254 -4.186 -0.111 3.191 29.185 2.554 34.444 1 AA_G1G2:C21C22_AA A 1 ? A 22 ? A 2 ? A 21 ? 1 A G 2 1_555 A C 21 1_555 A C 3 1_555 A G 20 1_555 0.125 -0.671 3.427 0.163 9.621 33.427 -2.626 -0.183 3.120 16.311 -0.276 34.746 2 AA_G2C3:G20C21_AA A 2 ? A 21 ? A 3 ? A 20 ? 1 A C 3 1_555 A G 20 1_555 A G 4 1_555 A C 19 1_555 -0.200 -0.756 4.361 -0.108 2.114 33.404 -1.775 0.323 4.307 3.673 0.187 33.469 3 AA_C3G4:C19G20_AA A 3 ? A 20 ? A 4 ? A 19 ? 1 A G 4 1_555 A C 19 1_555 A U 5 1_555 A G 18 1_555 -0.008 -1.251 3.380 1.210 11.703 36.461 -3.348 0.160 2.857 18.133 -1.875 38.250 4 AA_G4U5:G18C19_AA A 4 ? A 19 ? A 5 ? A 18 ? 1 A U 5 1_555 A G 18 1_555 A G 6 1_555 A C 17 1_555 -0.251 -0.939 3.574 2.492 21.235 25.946 -5.124 0.845 2.180 39.788 -4.670 33.503 5 AA_U5G6:C17G18_AA A 5 ? A 18 ? A 6 ? A 17 ? 1 A G 6 1_555 A C 17 1_555 A A 7 1_555 A U 16 1_555 0.148 -0.842 3.668 -1.003 18.272 36.016 -3.436 -0.337 2.922 27.478 1.508 40.261 6 AA_G6A7:U16C17_AA A 6 ? A 17 ? A 7 ? A 16 ? 1 A A 7 1_555 A U 16 1_555 A U 8 1_555 A A 15 1_555 0.001 -0.865 3.852 0.483 16.289 31.406 -4.133 0.079 3.051 27.867 -0.827 35.287 7 AA_A7U8:A15U16_AA A 7 ? A 16 ? A 8 ? A 15 ? 1 A U 8 1_555 A A 15 1_555 A C 9 1_555 A G 14 1_555 -0.077 -0.886 3.896 0.826 11.762 28.347 -4.323 0.331 3.274 22.810 -1.603 30.655 8 AA_U8C9:G14A15_AA A 8 ? A 15 ? A 9 ? A 14 ? #