data_2I7E # _entry.id 2I7E # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2I7E pdb_00002i7e 10.2210/pdb2i7e/pdb RCSB RCSB039230 ? ? WWPDB D_1000039230 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 2ADT _pdbx_database_related.details 'Same RNA determined without associated metal ions.' _pdbx_database_related.content_type unspecified # _pdbx_database_status.entry_id 2I7E _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2006-08-30 _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Davis, J.H.' 1 'Butcher, S.E.' 2 # _citation.id primary _citation.title 'Role of metal ions in the tetraloop-receptor complex as analyzed by NMR.' _citation.journal_abbrev Rna _citation.journal_volume 13 _citation.page_first 76 _citation.page_last 86 _citation.year 2007 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 17119098 _citation.pdbx_database_id_DOI 10.1261/rna.268307 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Davis, J.H.' 1 ? primary 'Foster, T.R.' 2 ? primary 'Tonelli, M.' 3 ? primary 'Butcher, S.E.' 4 ? # _cell.entry_id 2I7E _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2I7E _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 43-MER 13873.258 2 ? ? ? 'GAAA tetraloop receptor RNA' 2 non-polymer syn 'COBALT HEXAMMINE(III)' 161.116 4 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_seq_one_letter_code_can GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 U n 1 6 A n 1 7 U n 1 8 G n 1 9 G n 1 10 A n 1 11 A n 1 12 G n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 G n 1 18 G n 1 19 G n 1 20 G n 1 21 A n 1 22 A n 1 23 A n 1 24 C n 1 25 U n 1 26 U n 1 27 G n 1 28 G n 1 29 U n 1 30 U n 1 31 C n 1 32 U n 1 33 U n 1 34 C n 1 35 C n 1 36 U n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 C n 1 42 C n 1 43 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'The GAAA tetraloop and 11-nt receptor in this sequence are found in group I and Group II introns' # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2I7E _struct_ref.pdbx_db_accession 2I7E _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 2I7E A 1 ? 43 ? 2I7E 1 ? 43 ? 1 43 2 1 2I7E B 1 ? 43 ? 2I7E 44 ? 86 ? 44 86 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 NCO non-polymer . 'COBALT HEXAMMINE(III)' ? 'Co H18 N6 3' 161.116 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type 1 1 1 '2D NOESY' 2 1 1 '2D HMQC' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 283 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.ionic_strength ? _pdbx_nmr_exptl_sample_conditions.pressure_units . _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '1 mM GAAA tetraloop receptor RNA, 10 mM MgCl2, 2 mM cobalt hexaamine, 50 mM NaCl, pH 7.0; 90% H2O 10 %D2O' _pdbx_nmr_sample_details.solvent_system '90% H2O/10% D2O' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.field_strength 1 ? Bruker DMX 750 2 ? Varian INOVA 900 3 ? Bruker DMX 600 # _pdbx_nmr_refine.entry_id 2I7E _pdbx_nmr_refine.method ;structures were subjected to 60 ps (15 fs time steps) of restrained molecular dynamics in torsion angle space, followed by 90 ps of slow cooling. Finally 30 ps (5 fs time steps) of restrained molecular dynamics in Cartesian coordinate space were performed ; _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 2I7E _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 2I7E _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.classification _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal CNS 1.0 refinement 'Brunger A. T. etall' 1 X-PLOR 2.11 refinement ? 2 XwinNMR 2.6 processing ? 3 Sparky 3.111 'data analysis' ? 4 # _exptl.method 'SOLUTION NMR' _exptl.entry_id 2I7E _exptl.crystals_number ? # _struct.entry_id 2I7E _struct.title 'GAAA tetralooop receptor complex with associated cobalt hexammine.' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag N _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2I7E _struct_keywords.pdbx_keywords 'RIBONUCLEIC ACID' _struct_keywords.text 'GAAA tetraloop, 11-nucleotide receptor, RNA tertiary structure, RIBONUCLEIC ACID' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A G 1 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 39 O6 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 39 N1 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 36 O2 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog14 hydrog ? ? A A 6 N7 ? ? ? 1_555 A U 36 N3 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 B A 21 N6 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog16 hydrog ? ? A A 6 N6 ? ? ? 1_555 B A 21 N1 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog17 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 8 N2 ? ? ? 1_555 B A 23 N3 ? ? A G 8 B A 66 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 26 O2 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog42 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 26 N3 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog43 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 25 O2 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 25 N3 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 20 N2 ? ? ? 1_555 A A 23 N7 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog49 hydrog ? ? A G 20 N3 ? ? ? 1_555 A A 23 N6 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog50 hydrog ? ? A A 21 N1 ? ? ? 1_555 B A 6 N6 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog51 hydrog ? ? A A 21 N6 ? ? ? 1_555 B A 6 N1 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog52 hydrog ? ? A A 23 N3 ? ? ? 1_555 B G 8 N2 ? ? A A 23 B G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog53 hydrog ? ? A A 37 N3 ? ? ? 1_555 A A 38 N6 ? ? A A 37 A A 38 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog54 hydrog ? ? B G 1 N1 ? ? ? 1_555 B U 43 O2 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog55 hydrog ? ? B G 1 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog56 hydrog ? ? B G 2 N1 ? ? ? 1_555 B C 42 N3 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? B G 2 N2 ? ? ? 1_555 B C 42 O2 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? B G 2 O6 ? ? ? 1_555 B C 42 N4 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? B G 3 N1 ? ? ? 1_555 B C 41 N3 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? B G 3 N2 ? ? ? 1_555 B C 41 O2 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B G 3 O6 ? ? ? 1_555 B C 41 N4 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B A 4 N1 ? ? ? 1_555 B U 40 N3 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B A 4 N6 ? ? ? 1_555 B U 40 O4 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? B U 5 N3 ? ? ? 1_555 B G 39 O6 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog65 hydrog ? ? B U 5 O2 ? ? ? 1_555 B G 39 N1 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog66 hydrog ? ? B A 6 N6 ? ? ? 1_555 B U 36 O2 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog67 hydrog ? ? B A 6 N7 ? ? ? 1_555 B U 36 N3 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog68 hydrog ? ? B G 8 N1 ? ? ? 1_555 B C 35 N3 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? B G 8 N2 ? ? ? 1_555 B C 35 O2 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? B G 8 O6 ? ? ? 1_555 B C 35 N4 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? B G 9 N1 ? ? ? 1_555 B C 34 N3 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? B G 9 N2 ? ? ? 1_555 B C 34 O2 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? B G 9 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? B A 10 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? B A 10 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? B A 11 N1 ? ? ? 1_555 B U 32 N3 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? B A 11 N6 ? ? ? 1_555 B U 32 O4 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? B G 12 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? B G 12 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B G 12 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B A 13 N1 ? ? ? 1_555 B U 30 N3 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B A 13 N6 ? ? ? 1_555 B U 30 O4 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B A 14 N1 ? ? ? 1_555 B U 29 N3 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? B A 14 N6 ? ? ? 1_555 B U 29 O4 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? B C 15 N3 ? ? ? 1_555 B G 28 N1 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? B C 15 N4 ? ? ? 1_555 B G 28 O6 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B C 15 O2 ? ? ? 1_555 B G 28 N2 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B C 16 N3 ? ? ? 1_555 B G 27 N1 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B C 16 N4 ? ? ? 1_555 B G 27 O6 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 27 N2 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 28 N1 ? ? B C 59 B G 71 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog92 hydrog ? ? B G 17 N1 ? ? ? 1_555 B U 26 O2 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog93 hydrog ? ? B G 17 O6 ? ? ? 1_555 B U 26 N3 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog94 hydrog ? ? B G 18 N1 ? ? ? 1_555 B U 25 O2 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog95 hydrog ? ? B G 18 O6 ? ? ? 1_555 B U 25 N3 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog96 hydrog ? ? B G 19 N1 ? ? ? 1_555 B C 24 N3 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? B G 19 N2 ? ? ? 1_555 B C 24 O2 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? B G 19 O6 ? ? ? 1_555 B C 24 N4 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? B G 20 N2 ? ? ? 1_555 B A 23 N7 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog100 hydrog ? ? B G 20 N3 ? ? ? 1_555 B A 23 N6 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog101 hydrog ? ? B A 37 N3 ? ? ? 1_555 B A 38 N6 ? ? B A 80 B A 81 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A NCO 101 ? 5 'BINDING SITE FOR RESIDUE NCO A 101' AC2 Software A NCO 102 ? 5 'BINDING SITE FOR RESIDUE NCO A 102' AC3 Software B NCO 103 ? 4 'BINDING SITE FOR RESIDUE NCO B 103' AC4 Software B NCO 104 ? 6 'BINDING SITE FOR RESIDUE NCO B 104' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 5 G A 18 ? G A 18 . ? 1_555 ? 2 AC1 5 G A 19 ? G A 19 . ? 1_555 ? 3 AC1 5 G A 20 ? G A 20 . ? 1_555 ? 4 AC1 5 C A 24 ? C A 24 . ? 1_555 ? 5 AC1 5 U A 25 ? U A 25 . ? 1_555 ? 6 AC2 5 U A 7 ? U A 7 . ? 1_555 ? 7 AC2 5 G A 9 ? G A 9 . ? 1_555 ? 8 AC2 5 A A 10 ? A A 10 . ? 1_555 ? 9 AC2 5 U A 33 ? U A 33 . ? 1_555 ? 10 AC2 5 C A 34 ? C A 34 . ? 1_555 ? 11 AC3 4 G B 18 ? G B 61 . ? 1_555 ? 12 AC3 4 G B 19 ? G B 62 . ? 1_555 ? 13 AC3 4 G B 20 ? G B 63 . ? 1_555 ? 14 AC3 4 U B 25 ? U B 68 . ? 1_555 ? 15 AC4 6 A B 6 ? A B 49 . ? 1_555 ? 16 AC4 6 G B 9 ? G B 52 . ? 1_555 ? 17 AC4 6 A B 10 ? A B 53 . ? 1_555 ? 18 AC4 6 U B 32 ? U B 75 . ? 1_555 ? 19 AC4 6 U B 33 ? U B 76 . ? 1_555 ? 20 AC4 6 C B 34 ? C B 77 . ? 1_555 ? # _atom_sites.entry_id 2I7E _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C CO H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 U 5 5 5 U U A . n A 1 6 A 6 6 6 A A A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 U 25 25 25 U U A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 U 29 29 29 U U A . n A 1 30 U 30 30 30 U U A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 C 35 35 35 C C A . n A 1 36 U 36 36 36 U U A . n A 1 37 A 37 37 37 A A A . n A 1 38 A 38 38 38 A A A . n A 1 39 G 39 39 39 G G A . n A 1 40 U 40 40 40 U U A . n A 1 41 C 41 41 41 C C A . n A 1 42 C 42 42 42 C C A . n A 1 43 U 43 43 43 U U A . n B 1 1 G 1 44 44 G G B . n B 1 2 G 2 45 45 G G B . n B 1 3 G 3 46 46 G G B . n B 1 4 A 4 47 47 A A B . n B 1 5 U 5 48 48 U U B . n B 1 6 A 6 49 49 A A B . n B 1 7 U 7 50 50 U U B . n B 1 8 G 8 51 51 G G B . n B 1 9 G 9 52 52 G G B . n B 1 10 A 10 53 53 A A B . n B 1 11 A 11 54 54 A A B . n B 1 12 G 12 55 55 G G B . n B 1 13 A 13 56 56 A A B . n B 1 14 A 14 57 57 A A B . n B 1 15 C 15 58 58 C C B . n B 1 16 C 16 59 59 C C B . n B 1 17 G 17 60 60 G G B . n B 1 18 G 18 61 61 G G B . n B 1 19 G 19 62 62 G G B . n B 1 20 G 20 63 63 G G B . n B 1 21 A 21 64 64 A A B . n B 1 22 A 22 65 65 A A B . n B 1 23 A 23 66 66 A A B . n B 1 24 C 24 67 67 C C B . n B 1 25 U 25 68 68 U U B . n B 1 26 U 26 69 69 U U B . n B 1 27 G 27 70 70 G G B . n B 1 28 G 28 71 71 G G B . n B 1 29 U 29 72 72 U U B . n B 1 30 U 30 73 73 U U B . n B 1 31 C 31 74 74 C C B . n B 1 32 U 32 75 75 U U B . n B 1 33 U 33 76 76 U U B . n B 1 34 C 34 77 77 C C B . n B 1 35 C 35 78 78 C C B . n B 1 36 U 36 79 79 U U B . n B 1 37 A 37 80 80 A A B . n B 1 38 A 38 81 81 A A B . n B 1 39 G 39 82 82 G G B . n B 1 40 U 40 83 83 U U B . n B 1 41 C 41 84 84 C C B . n B 1 42 C 42 85 85 C C B . n B 1 43 U 43 86 86 U U B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 NCO 1 101 101 NCO NCO A . D 2 NCO 1 102 102 NCO NCO A . E 2 NCO 1 103 103 NCO NCO B . F 2 NCO 1 104 104 NCO NCO B . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2007-04-03 2 'Structure model' 1 1 2008-05-01 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-09 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' 4 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 5 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 6 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.45 2 1 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.51 3 1 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.51 4 1 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.53 5 1 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.54 6 1 "O2'" B G 46 ? ? "H5'" B A 47 ? ? 1.58 7 1 "HO2'" A U 7 ? ? "O5'" A G 8 ? ? 1.58 8 1 "O2'" B U 68 ? ? "H5'" B U 69 ? ? 1.58 9 2 "O2'" B U 50 ? ? "H5'" B G 51 ? ? 1.39 10 2 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.46 11 2 "HO2'" A A 38 ? ? OP1 A G 39 ? ? 1.47 12 2 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.53 13 2 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.53 14 2 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.55 15 2 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.57 16 2 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.59 17 2 "O2'" A U 26 ? ? "H5'" A G 27 ? ? 1.60 18 3 "O2'" A U 7 ? ? H8 A G 8 ? ? 1.43 19 3 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.50 20 3 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.53 21 3 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.55 22 3 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.56 23 3 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.56 24 3 N3 A A 6 ? ? H6 A U 7 ? ? 1.58 25 3 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.59 26 4 "O2'" B U 50 ? ? "H5'" B G 51 ? ? 1.38 27 4 "HO2'" A U 36 ? ? OP1 A A 37 ? ? 1.40 28 4 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.49 29 4 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.51 30 4 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.51 31 4 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.52 32 4 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.56 33 4 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.56 34 4 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.57 35 4 "O2'" B U 68 ? ? "H5'" B U 69 ? ? 1.59 36 4 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.60 37 4 "O2'" A U 29 ? ? "H5'" A U 30 ? ? 1.60 38 5 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.47 39 5 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.51 40 5 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.51 41 5 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.52 42 5 "O2'" B C 67 ? ? "H5'" B U 68 ? ? 1.58 43 5 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.60 44 6 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.43 45 6 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.49 46 6 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.51 47 6 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.52 48 6 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.53 49 6 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.53 50 6 "O2'" B U 83 ? ? "H5'" B C 84 ? ? 1.56 51 6 "HO2'" A A 6 ? ? "O5'" A U 7 ? ? 1.57 52 6 "O2'" B G 46 ? ? "H5'" B A 47 ? ? 1.57 53 6 "O2'" B G 61 ? ? "H5'" B G 62 ? ? 1.57 54 6 "O2'" A G 1 ? ? "H5'" A G 2 ? ? 1.58 55 6 "HO2'" A A 21 ? ? OP1 A A 22 ? ? 1.58 56 6 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.59 57 7 H61 A A 6 ? ? H61 B A 64 ? ? 1.32 58 7 "O2'" B U 50 ? ? H8 B G 51 ? ? 1.43 59 7 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.48 60 7 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.51 61 7 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.51 62 7 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.53 63 7 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.55 64 7 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.57 65 8 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.39 66 8 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.49 67 8 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.49 68 8 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.50 69 8 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.51 70 8 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.55 71 8 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.56 72 8 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.58 73 8 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.59 74 8 "O2'" B G 46 ? ? "H5'" B A 47 ? ? 1.60 75 9 H61 A A 22 ? ? "HO2'" B G 51 ? ? 1.35 76 9 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.40 77 9 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.42 78 9 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.46 79 9 "O2'" B G 61 ? ? "H5'" B G 62 ? ? 1.49 80 9 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.50 81 9 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.50 82 9 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.53 83 9 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.56 84 9 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.58 85 9 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.59 86 10 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.40 87 10 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.49 88 10 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.50 89 10 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.50 90 10 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.54 91 10 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.56 92 10 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.59 93 10 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.59 94 11 "HO2'" A A 22 ? ? OP1 A A 23 ? ? 1.31 95 11 H61 A A 6 ? ? H61 B A 64 ? ? 1.34 96 11 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.44 97 11 "HO2'" A C 34 ? ? OP1 A C 35 ? ? 1.49 98 11 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.50 99 11 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.52 100 11 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.54 101 11 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.54 102 11 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.56 103 11 "HO2'" B U 50 ? ? "O5'" B G 51 ? ? 1.59 104 11 "O2'" A U 26 ? ? "H5'" A G 27 ? ? 1.59 105 12 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.43 106 12 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.50 107 12 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.51 108 12 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.51 109 12 "O2'" B U 68 ? ? "H5'" B U 69 ? ? 1.54 110 12 "HO2'" B G 45 ? ? "O4'" B G 46 ? ? 1.54 111 12 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.55 112 12 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.56 113 12 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.57 114 12 "O2'" B U 83 ? ? "H5'" B C 84 ? ? 1.59 115 13 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.42 116 13 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.50 117 13 "O2'" B C 67 ? ? "H5'" B U 68 ? ? 1.53 118 13 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.53 119 13 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.59 120 14 "HO2'" A A 22 ? ? OP1 A A 23 ? ? 1.38 121 14 OP2 B A 49 ? ? H61 B A 80 ? ? 1.44 122 14 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.47 123 14 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.49 124 14 "HO2'" B A 49 ? ? "O5'" B U 50 ? ? 1.49 125 14 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.50 126 14 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.50 127 14 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.51 128 14 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.53 129 14 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.54 130 14 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.55 131 14 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.56 132 15 "HO2'" B U 50 ? ? "O5'" B G 51 ? ? 1.40 133 15 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.49 134 15 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.51 135 15 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.52 136 15 "H2'" B G 62 ? ? "O4'" B G 63 ? ? 1.58 137 16 "HO2'" B C 77 ? ? OP1 B C 78 ? ? 1.36 138 16 "HO2'" B U 50 ? ? "O5'" B G 51 ? ? 1.37 139 16 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.43 140 16 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.50 141 16 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.51 142 16 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.57 143 16 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.57 144 16 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.57 145 16 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.57 146 16 "H1'" A U 7 ? ? "O5'" A G 8 ? ? 1.57 147 16 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.59 148 17 H61 A A 6 ? ? H61 B A 64 ? ? 1.34 149 17 OP2 B A 49 ? ? H61 B A 80 ? ? 1.36 150 17 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.47 151 17 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.49 152 17 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.50 153 17 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.51 154 17 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.54 155 17 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.55 156 17 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.55 157 17 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.56 158 17 "O2'" B G 46 ? ? "H5'" B A 47 ? ? 1.58 159 17 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.59 160 17 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.59 161 18 "HO2'" B A 49 ? ? OP2 B U 50 ? ? 1.30 162 18 OP2 A A 6 ? ? H61 A A 37 ? ? 1.38 163 18 "O2'" B U 50 ? ? H8 B G 51 ? ? 1.44 164 18 "H1'" A U 7 ? ? "O5'" A G 8 ? ? 1.53 165 18 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.54 166 18 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.54 167 18 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.55 168 18 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.55 169 18 "HO2'" A A 6 ? ? "O5'" A U 7 ? ? 1.60 170 19 "HO2'" B G 51 ? ? OP1 B G 52 ? ? 1.34 171 19 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.48 172 19 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.51 173 19 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.52 174 19 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.53 175 19 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.54 176 20 H22 A G 20 ? ? H62 A A 23 ? ? 1.33 177 20 "O2'" B U 50 ? ? "H5'" B G 51 ? ? 1.37 178 20 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.42 179 20 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.55 180 20 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.55 181 20 "O2'" A G 1 ? ? "H5'" A G 2 ? ? 1.58 182 20 "HO2'" B A 80 ? ? O6 B G 82 ? ? 1.59 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2I7E 'double helix' 2I7E 'a-form double helix' 2I7E tetraloop 2I7E 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A U 43 1_555 -1.891 -0.529 -0.798 -7.294 -3.985 -0.870 1 A_G1:U43_A A 1 ? A 43 ? 28 1 1 A G 2 1_555 A C 42 1_555 -0.782 -0.517 -1.031 -7.494 -9.085 1.936 2 A_G2:C42_A A 2 ? A 42 ? 19 1 1 A G 3 1_555 A C 41 1_555 0.587 -0.162 -0.610 -7.828 -7.462 1.401 3 A_G3:C41_A A 3 ? A 41 ? 19 1 1 A A 4 1_555 A U 40 1_555 0.694 -0.078 -0.093 -2.203 -4.997 -3.113 4 A_A4:U40_A A 4 ? A 40 ? 20 1 1 A U 5 1_555 A G 39 1_555 3.338 -0.965 -0.042 0.430 -1.235 -2.694 5 A_U5:G39_A A 5 ? A 39 ? 28 ? 1 A A 37 1_555 A A 38 1_555 6.500 -0.583 -0.070 1.368 1.290 -1.780 6 A_A37:A38_A A 37 ? A 38 ? ? 9 1 A A 6 1_555 A U 36 1_555 -3.448 -1.221 0.283 3.572 -0.201 -100.389 7 A_A6:U36_A A 6 ? A 36 ? 24 4 1 A G 8 1_555 A C 35 1_555 -0.890 -0.366 -0.036 0.471 0.325 -2.720 8 A_G8:C35_A A 8 ? A 35 ? 19 1 1 A G 9 1_555 A C 34 1_555 0.589 -0.092 -0.036 3.887 7.777 -0.493 9 A_G9:C34_A A 9 ? A 34 ? 19 1 1 A A 10 1_555 A U 33 1_555 0.630 -0.133 -0.437 -4.150 8.034 -2.279 10 A_A10:U33_A A 10 ? A 33 ? 20 1 1 A A 11 1_555 A U 32 1_555 -0.658 -0.313 0.094 2.303 -5.802 4.892 11 A_A11:U32_A A 11 ? A 32 ? 20 1 1 A G 12 1_555 A C 31 1_555 -0.876 -0.355 -0.577 -11.601 -9.179 -0.503 12 A_G12:C31_A A 12 ? A 31 ? 19 1 1 A A 13 1_555 A U 30 1_555 0.583 -0.082 -0.030 0.227 -1.214 -0.476 13 A_A13:U30_A A 13 ? A 30 ? 20 1 1 A A 14 1_555 A U 29 1_555 0.374 -0.039 0.169 3.932 6.283 -1.665 14 A_A14:U29_A A 14 ? A 29 ? 20 1 1 A C 15 1_555 A G 28 1_555 0.211 -0.087 -0.355 10.534 1.512 -2.668 15 A_C15:G28_A A 15 ? A 28 ? 19 1 1 A C 16 1_555 A G 27 1_555 -0.032 -0.461 -1.181 6.046 -16.032 12.333 16 A_C16:G27_A A 16 ? A 27 ? 19 1 1 A G 17 1_555 A U 26 1_555 -1.944 -0.434 -0.443 -1.204 -3.637 -1.165 17 A_G17:U26_A A 17 ? A 26 ? 28 1 1 A G 18 1_555 A U 25 1_555 -2.035 -0.379 -0.082 -1.765 3.757 -0.109 18 A_G18:U25_A A 18 ? A 25 ? 28 1 1 A G 19 1_555 A C 24 1_555 0.230 -0.015 -0.284 -2.720 1.227 -2.223 19 A_G19:C24_A A 19 ? A 24 ? 19 1 1 A G 20 1_555 A A 23 1_555 6.570 -3.357 0.314 17.015 16.754 -14.567 20 A_G20:A23_A A 20 ? A 23 ? 11 9 1 B G 1 1_555 B U 43 1_555 -1.544 -0.821 -1.250 -5.366 14.302 -17.329 21 B_G44:U86_B B 44 ? B 86 ? 28 ? 1 B G 2 1_555 B C 42 1_555 -0.772 -0.478 -0.655 2.097 6.171 -4.631 22 B_G45:C85_B B 45 ? B 85 ? 19 1 1 B G 3 1_555 B C 41 1_555 -0.864 -0.398 -0.502 -2.179 -1.552 -1.295 23 B_G46:C84_B B 46 ? B 84 ? 19 1 1 B A 4 1_555 B U 40 1_555 0.441 -0.060 -0.174 -2.398 0.309 -1.542 24 B_A47:U83_B B 47 ? B 83 ? 20 1 1 B U 5 1_555 B G 39 1_555 3.509 -1.157 0.125 2.034 -2.391 -2.448 25 B_U48:G82_B B 48 ? B 82 ? 28 ? 1 B A 37 1_555 B A 38 1_555 6.753 -0.564 -0.079 0.726 1.849 1.584 26 B_A80:A81_B B 80 ? B 81 ? ? 9 1 A A 21 1_555 B A 6 1_555 -1.020 -1.220 0.053 44.984 -10.898 179.285 27 A_A21:A49_B A 21 ? B 49 ? 1 2 1 B G 8 1_555 B C 35 1_555 -0.843 -0.332 -0.106 -1.715 -2.549 -2.461 28 B_G51:C78_B B 51 ? B 78 ? 19 1 1 B G 9 1_555 B C 34 1_555 0.403 -0.058 -0.122 2.273 1.469 -1.090 29 B_G52:C77_B B 52 ? B 77 ? 19 1 1 B A 10 1_555 B U 33 1_555 0.152 -0.066 -0.319 -0.333 -0.003 0.512 30 B_A53:U76_B B 53 ? B 76 ? 20 1 1 B A 11 1_555 B U 32 1_555 -0.713 -0.360 -0.516 -3.590 -19.812 2.298 31 B_A54:U75_B B 54 ? B 75 ? 20 1 1 B G 12 1_555 B C 31 1_555 -0.483 -0.234 -0.685 -7.349 -10.767 2.081 32 B_G55:C74_B B 55 ? B 74 ? 19 1 1 B A 13 1_555 B U 30 1_555 0.618 -0.056 0.052 0.548 -4.317 -2.602 33 B_A56:U73_B B 56 ? B 73 ? 20 1 1 B A 14 1_555 B U 29 1_555 0.286 -0.034 -0.121 0.843 7.129 -3.425 34 B_A57:U72_B B 57 ? B 72 ? 20 1 1 B C 15 1_555 B G 28 1_555 -0.290 -0.085 -0.426 7.728 9.152 -2.534 35 B_C58:G71_B B 58 ? B 71 ? 19 1 1 B C 16 1_555 B G 27 1_555 -0.377 -0.296 -0.912 3.135 -13.343 10.037 36 B_C59:G70_B B 59 ? B 70 ? 19 1 1 B G 17 1_555 B U 26 1_555 -1.937 -0.411 -0.181 0.450 -7.225 -3.334 37 B_G60:U69_B B 60 ? B 69 ? 28 1 1 B G 18 1_555 B U 25 1_555 -2.009 -0.407 -0.048 1.465 6.155 -0.048 38 B_G61:U68_B B 61 ? B 68 ? 28 1 1 B G 19 1_555 B C 24 1_555 0.530 -0.043 -0.246 -3.611 -2.834 -1.168 39 B_G62:C67_B B 62 ? B 67 ? 19 1 1 B G 20 1_555 B A 23 1_555 6.689 -3.726 0.435 15.770 8.226 -11.145 40 B_G63:A66_B B 63 ? B 66 ? 11 9 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A U 43 1_555 A G 2 1_555 A C 42 1_555 0.005 -1.351 3.840 -1.088 -7.214 36.844 -0.957 -0.181 4.022 -11.278 1.701 37.535 1 AA_G1G2:C42U43_AA A 1 ? A 43 ? A 2 ? A 42 ? 1 A G 2 1_555 A C 42 1_555 A G 3 1_555 A C 41 1_555 -0.656 -0.876 3.791 -0.971 4.380 35.114 -2.180 0.915 3.675 7.224 1.602 35.390 2 AA_G2G3:C41C42_AA A 2 ? A 42 ? A 3 ? A 41 ? 1 A G 3 1_555 A C 41 1_555 A A 4 1_555 A U 40 1_555 -0.355 -0.031 3.750 -3.541 5.334 36.228 -0.886 0.008 3.725 8.495 5.640 36.770 3 AA_G3A4:U40C41_AA A 3 ? A 41 ? A 4 ? A 40 ? 1 A A 4 1_555 A U 40 1_555 A U 5 1_555 A G 39 1_555 0.929 -0.260 3.808 2.194 7.202 43.756 -1.123 -0.993 3.762 9.578 -2.919 44.368 4 AA_A4U5:G39U40_AA A 4 ? A 40 ? A 5 ? A 39 ? 1 A U 5 1_555 A G 39 1_555 A A 37 1_555 A A 38 1_555 -1.159 3.204 -1.881 157.094 71.011 52.083 1.923 -0.123 -0.591 36.383 -80.488 173.171 5 AA_U5A37:A38G39_AA A 5 ? A 39 ? A 37 ? A 38 ? 1 A A 37 1_555 A A 38 1_555 A A 6 1_555 A U 36 1_555 -0.051 -3.362 -0.580 161.391 -3.859 32.975 -1.708 -0.245 -0.139 -2.088 -87.320 162.207 6 AA_A37A6:U36A38_AA A 37 ? A 38 ? A 6 ? A 36 ? 1 A A 6 1_555 A U 36 1_555 A G 8 1_555 A C 35 1_555 3.139 -0.962 3.367 -13.396 9.321 70.961 -1.101 -3.066 2.692 7.926 11.390 72.573 7 AA_A6G8:C35U36_AA A 6 ? A 36 ? A 8 ? A 35 ? 1 A G 8 1_555 A C 35 1_555 A G 9 1_555 A C 34 1_555 1.115 -1.727 3.342 -3.796 6.987 34.559 -3.815 -2.364 2.816 11.572 6.287 35.435 8 AA_G8G9:C34C35_AA A 8 ? A 35 ? A 9 ? A 34 ? 1 A G 9 1_555 A C 34 1_555 A A 10 1_555 A U 33 1_555 -1.117 -2.026 3.966 3.807 7.586 27.840 -5.882 3.151 3.138 15.322 -7.688 29.081 9 AA_G9A10:U33C34_AA A 9 ? A 34 ? A 10 ? A 33 ? 1 A A 10 1_555 A U 33 1_555 A A 11 1_555 A U 32 1_555 0.013 -1.044 4.083 -1.741 -7.046 24.296 0.260 -0.683 4.202 -16.283 4.023 25.341 10 AA_A10A11:U32U33_AA A 10 ? A 33 ? A 11 ? A 32 ? 1 A A 11 1_555 A U 32 1_555 A G 12 1_555 A C 31 1_555 -0.125 -0.496 4.020 0.839 28.083 36.183 -3.611 0.250 2.929 38.843 -1.160 45.520 11 AA_A11G12:C31U32_AA A 11 ? A 32 ? A 12 ? A 31 ? 1 A G 12 1_555 A C 31 1_555 A A 13 1_555 A U 30 1_555 -0.413 -0.763 3.133 -2.810 13.902 33.807 -2.981 0.302 2.651 22.705 4.589 36.582 12 AA_G12A13:U30C31_AA A 12 ? A 31 ? A 13 ? A 30 ? 1 A A 13 1_555 A U 30 1_555 A A 14 1_555 A U 29 1_555 -0.211 -0.539 4.042 -1.189 5.395 30.307 -2.304 0.113 3.895 10.212 2.252 30.795 13 AA_A13A14:U29U30_AA A 13 ? A 30 ? A 14 ? A 29 ? 1 A A 14 1_555 A U 29 1_555 A C 15 1_555 A G 28 1_555 -0.631 -0.965 3.623 3.779 17.004 25.061 -5.282 1.968 2.386 34.387 -7.642 30.440 14 AA_A14C15:G28U29_AA A 14 ? A 29 ? A 15 ? A 28 ? 1 A C 15 1_555 A G 28 1_555 A C 16 1_555 A G 27 1_555 1.603 -0.126 3.211 8.552 33.988 34.131 -2.896 -1.260 2.480 45.672 -11.492 48.544 15 AA_C15C16:G27G28_AA A 15 ? A 28 ? A 16 ? A 27 ? 1 A C 16 1_555 A G 27 1_555 A G 17 1_555 A U 26 1_555 -2.008 -0.663 3.631 -9.258 14.664 22.367 -5.357 1.593 3.197 32.282 20.380 28.235 16 AA_C16G17:U26G27_AA A 16 ? A 27 ? A 17 ? A 26 ? 1 A G 17 1_555 A U 26 1_555 A G 18 1_555 A U 25 1_555 0.292 -1.195 3.935 -5.508 6.351 28.747 -3.836 -1.886 3.482 12.459 10.805 29.926 17 AA_G17G18:U25U26_AA A 17 ? A 26 ? A 18 ? A 25 ? 1 A G 18 1_555 A U 25 1_555 A G 19 1_555 A C 24 1_555 -0.610 -1.002 4.115 1.351 6.685 35.329 -2.793 1.225 3.843 10.890 -2.200 35.961 18 AA_G18G19:C24U25_AA A 18 ? A 25 ? A 19 ? A 24 ? 1 A G 19 1_555 A C 24 1_555 A G 20 1_555 A A 23 1_555 -0.578 0.212 2.876 -1.346 19.033 43.238 -1.145 0.624 2.751 24.459 1.730 47.075 19 AA_G19G20:A23C24_AA A 19 ? A 24 ? A 20 ? A 23 ? 1 B G 1 1_555 B U 43 1_555 B G 2 1_555 B C 42 1_555 0.361 -1.872 3.492 -3.569 6.638 25.183 -5.886 -1.745 2.836 14.806 7.961 26.269 20 BB_G44G45:C85U86_BB B 44 ? B 86 ? B 45 ? B 85 ? 1 B G 2 1_555 B C 42 1_555 B G 3 1_555 B C 41 1_555 0.176 -0.543 4.683 1.071 -12.012 31.923 1.875 -0.051 4.588 -20.929 -1.866 34.070 21 BB_G45G46:C84C85_BB B 45 ? B 85 ? B 46 ? B 84 ? 1 B G 3 1_555 B C 41 1_555 B A 4 1_555 B U 40 1_555 -0.099 -0.794 4.158 -1.534 4.034 32.433 -2.285 -0.158 4.033 7.182 2.731 32.712 22 BB_G46A47:U83C84_BB B 46 ? B 84 ? B 47 ? B 83 ? 1 B A 4 1_555 B U 40 1_555 B U 5 1_555 B G 39 1_555 0.736 -0.290 3.530 3.151 15.869 45.319 -1.708 -0.637 3.300 19.863 -3.944 47.977 23 BB_A47U48:G82U83_BB B 47 ? B 83 ? B 48 ? B 82 ? 1 B U 5 1_555 B G 39 1_555 B A 37 1_555 B A 38 1_555 -0.053 -4.764 -0.706 -157.787 -79.123 -161.046 2.349 0.039 -1.055 39.572 -78.915 -179.426 24 BB_U48A80:A81G82_BB B 48 ? B 82 ? B 80 ? B 81 ? 1 B A 37 1_555 B A 38 1_555 A A 21 1_555 B A 6 1_555 -1.347 4.469 -1.413 -158.817 50.915 -104.908 -2.026 -0.007 -2.729 -25.873 -80.704 -171.954 25 BA_A80A21:A49A81_BB B 80 ? B 81 ? A 21 ? B 49 ? 1 A A 21 1_555 B A 6 1_555 B G 8 1_555 B C 35 1_555 4.696 -2.326 3.803 -31.570 22.952 30.078 -3.545 -6.682 -1.642 31.632 43.509 48.916 26 AB_A21G51:C78A49_BB A 21 ? B 49 ? B 51 ? B 78 ? 1 B G 8 1_555 B C 35 1_555 B G 9 1_555 B C 34 1_555 0.407 -2.027 3.269 -0.859 6.539 32.415 -4.599 -0.851 2.807 11.564 1.519 33.061 27 BB_G51G52:C77C78_BB B 51 ? B 78 ? B 52 ? B 77 ? 1 B G 9 1_555 B C 34 1_555 B A 10 1_555 B U 33 1_555 -0.615 -1.529 3.833 -0.259 10.617 30.529 -4.820 1.057 3.144 19.438 0.474 32.282 28 BB_G52A53:U76C77_BB B 52 ? B 77 ? B 53 ? B 76 ? 1 B A 10 1_555 B U 33 1_555 B A 11 1_555 B U 32 1_555 -0.187 -0.958 3.994 2.211 1.666 32.697 -2.042 0.791 3.921 2.953 -3.919 32.811 29 BB_A53A54:U75U76_BB B 53 ? B 76 ? B 54 ? B 75 ? 1 B A 11 1_555 B U 32 1_555 B G 12 1_555 B C 31 1_555 -0.578 -0.510 3.496 -1.313 18.582 28.048 -4.038 0.778 2.679 34.005 2.403 33.567 30 BB_A54G55:C74U75_BB B 54 ? B 75 ? B 55 ? B 74 ? 1 B G 12 1_555 B C 31 1_555 B A 13 1_555 B U 30 1_555 -0.409 -0.955 3.471 -3.714 6.253 32.524 -2.751 0.068 3.262 10.994 6.530 33.306 31 BB_G55A56:U73C74_BB B 55 ? B 74 ? B 56 ? B 73 ? 1 B A 13 1_555 B U 30 1_555 B A 14 1_555 B U 29 1_555 -0.121 -1.160 3.946 0.339 13.726 27.196 -5.314 0.307 3.022 27.107 -0.670 30.406 32 BB_A56A57:U72U73_BB B 56 ? B 73 ? B 57 ? B 72 ? 1 B A 14 1_555 B U 29 1_555 B C 15 1_555 B G 28 1_555 0.004 -0.935 3.762 0.768 15.878 28.048 -4.762 0.142 2.840 29.914 -1.446 32.161 33 BB_A57C58:G71U72_BB B 57 ? B 72 ? B 58 ? B 71 ? 1 B C 15 1_555 B G 28 1_555 B C 16 1_555 B G 27 1_555 2.299 -0.465 2.814 9.352 29.338 33.379 -3.003 -2.233 2.276 41.728 -13.302 45.114 34 BB_C58C59:G70G71_BB B 58 ? B 71 ? B 59 ? B 70 ? 1 B C 16 1_555 B G 27 1_555 B G 17 1_555 B U 26 1_555 -1.906 -0.947 3.480 -7.914 10.235 23.672 -4.916 1.864 3.263 22.890 17.698 26.932 35 BB_C59G60:U69G70_BB B 59 ? B 70 ? B 60 ? B 69 ? 1 B G 17 1_555 B U 26 1_555 B G 18 1_555 B U 25 1_555 -0.123 -1.266 3.892 -4.877 5.253 26.733 -4.123 -1.111 3.549 11.110 10.314 27.661 36 BB_G60G61:U68U69_BB B 60 ? B 69 ? B 61 ? B 68 ? 1 B G 18 1_555 B U 25 1_555 B G 19 1_555 B C 24 1_555 -0.244 -0.778 4.273 1.249 11.654 35.655 -3.154 0.588 3.830 18.429 -1.974 37.473 37 BB_G61G62:C67U68_BB B 61 ? B 68 ? B 62 ? B 67 ? 1 B G 19 1_555 B C 24 1_555 B G 20 1_555 B A 23 1_555 -0.707 -0.060 2.774 -3.760 17.765 46.438 -1.193 0.604 2.634 21.587 4.569 49.678 38 BB_G62G63:A66C67_BB B 62 ? B 67 ? B 63 ? B 66 ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'COBALT HEXAMMINE(III)' _pdbx_entity_nonpoly.comp_id NCO #