data_2JSM # _entry.id 2JSM # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2JSM pdb_00002jsm 10.2210/pdb2jsm/pdb RCSB RCSB100238 ? ? WWPDB D_1000100238 ? ? # loop_ _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.content_type 143D PDB 'Human telomere DNA solution structure in the presence of NA cations' unspecified 186D PDB 'Tetrahymena telomere DNA solution structure' unspecified 1K8P PDB 'Human telomere DNA crystal structure in the presence of K cations' unspecified 2AQY PDB '3 repeats of human telomere DNA solution structurE' unspecified 2JSK PDB 'Human telomere DNA solution structure in the presence of K cations 16BrG Form 1' unspecified 2JSL PDB 'Human telomere DNA solution structure in the presence of K cations Natural Form 2' unspecified 2JSQ PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS FORM 2 15BRG' unspecified # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2JSM _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2007-07-09 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Kuryavyi, V.V.' 1 'Phan, A.T.' 2 'Luu, K.N.' 3 'Patel, D.J.' 4 # _citation.id primary _citation.title 'Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 35 _citation.page_first 6517 _citation.page_last 6525 _citation.year 2007 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 17895279 _citation.pdbx_database_id_DOI 10.1093/nar/gkm706 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Phan, A.T.' 1 ? primary 'Kuryavyi, V.' 2 ? primary 'Luu, K.N.' 3 ? primary 'Patel, D.J.' 4 ? # _cell.entry_id 2JSM _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2JSM _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'HUMAN TELOMERE DNA' _entity.formula_weight 7287.690 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA) (DG)(DG)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can TAGGGTTAGGGTTAGGGTTAGGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DT n 1 2 DA n 1 3 DG n 1 4 DG n 1 5 DG n 1 6 DT n 1 7 DT n 1 8 DA n 1 9 DG n 1 10 DG n 1 11 DG n 1 12 DT n 1 13 DT n 1 14 DA n 1 15 DG n 1 16 DG n 1 17 DG n 1 18 DT n 1 19 DT n 1 20 DA n 1 21 DG n 1 22 DG n 1 23 DG n # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2JSM _struct_ref.pdbx_db_accession 2JSM _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2JSM _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 23 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2JSM _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 23 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 23 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '1H-1H NOESY' 1 2 1 '1H-1H TOCSY' 1 3 1 '1H- 31P COSY' 1 4 1 '1H-1H COSY' 1 5 1 '1H-15N JRHMQC' 1 6 1 '1H-15N HMBC' 1 # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.ionic_strength 70 _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '0.5-5.0 MM HUMAN TELOMERE DNA, 90% H2O/10% D2O' _pdbx_nmr_sample_details.solvent_system ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 INOVA Varian 600 ? 2 AVANCE Bruker 800 ? # _pdbx_nmr_refine.entry_id 2JSM _pdbx_nmr_refine.method 'torsion angle dynamics' _pdbx_nmr_refine.details ;AFTER DEPOSITION, THE MOLECULES WERE ENERGY MINIMIZED WITH THE ENERGY FUNCTION IMPLEMENTING GEOMETRICAL VALUES IN EFFECT AT RCSB SINCE JULY 31 2007. AS A RESULT, STRUCTURE STATISTICS FOR THIS ENTRY SLIGHTLY DEVIATES FROM THE PUBLISHED ONE, AS FOLLOWS (CURRENT VS PUBLISHED): NOE VIOLATIONS (0.3+-0.48) VS (0.00+-0.00) MAXIMUM VIOLATION (0.21+-0.06) VS (0.00+-0.00) RMSD OF VIOLATIONS (0.03+-0.00) VS (0.03+-0.00) BOND LENGTHS (0.004+-0.000) VS (0.004+-0.000) BOND ANGLES (0.71+-0.01) VS (0.92+-0.01) IMPROPERS (0.38+-0.02) VS (0.36+-0.02) PAIRWISE RMSD: ALL ATOMS (0.61+-0.15) VS (0.82+-0.22) ALL ATOMS EXCEPT T6,T7,A8 (0.40+-0.11) VS (0.59+-0.15) ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 2JSM _pdbx_nmr_ensemble.conformers_calculated_total_number 50 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 2JSM _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria ? # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR 3.851 BRUNGER 1 'structure solution' VNMR 6.0 ? 2 'structure solution' Felix 2000 ? 3 'structure solution' X-PLOR 3.851 ? 4 # _exptl.entry_id 2JSM _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _struct.entry_id 2JSM _struct.title ;MONOMERIC HUMAN TELOMERE DNA TETRAPLEX WITH 3+1 STRAND FOLD TOPOLOGY, TWO EDGEWISE LOOPS AND DOUBLE-CHAIN REVERSAL LOOP, NMR, 10 STRUCTURES, Form 1 Natural ; _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2JSM _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'G-TETRAD; 3+1 STRAND FOLDING;EDGEWISE, DOUBLE-CHAIN REVERSAL LOOPS; Natural Form 1, 10 STRUCTURES, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DT 1 N3 ? ? ? 1_555 A DA 20 N1 ? ? A DT 1 A DA 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DT 1 O4 ? ? ? 1_555 A DA 20 N6 ? ? A DT 1 A DA 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DA 2 N6 ? ? ? 1_555 A DT 19 O2 ? ? A DA 2 A DT 19 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog4 hydrog ? ? A DA 2 N7 ? ? ? 1_555 A DT 19 N3 ? ? A DA 2 A DT 19 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog5 hydrog ? ? A DA 2 N6 ? ? ? 1_555 A DA 20 N3 ? ? A DA 2 A DA 20 1_555 ? ? ? ? ? ? 'DA-DA MISPAIR' ? ? ? hydrog6 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 9 N2 ? ? A DG 3 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 9 N1 ? ? A DG 3 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 3 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 3 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 4 N1 ? ? ? 1_555 A DG 10 O6 ? ? A DG 4 A DG 10 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 4 N2 ? ? ? 1_555 A DG 10 N7 ? ? A DG 4 A DG 10 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 4 N7 ? ? ? 1_555 A DG 22 N2 ? ? A DG 4 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A DG 22 N1 ? ? A DG 4 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 11 O6 ? ? A DG 5 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 11 N7 ? ? A DG 5 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 23 N2 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 23 N1 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 9 N7 ? ? ? 1_555 A DG 17 N2 ? ? A DG 9 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 9 O6 ? ? ? 1_555 A DG 17 N1 ? ? A DG 9 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 10 N1 ? ? ? 1_555 A DG 16 O6 ? ? A DG 10 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 10 N2 ? ? ? 1_555 A DG 16 N7 ? ? A DG 10 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 11 N1 ? ? ? 1_555 A DG 15 O6 ? ? A DG 11 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DG 15 N7 ? ? A DG 11 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DT 12 N3 ? ? ? 1_555 A DA 14 N7 ? ? A DT 12 A DA 14 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog25 hydrog ? ? A DT 12 O4 ? ? ? 1_555 A DA 14 N6 ? ? A DT 12 A DA 14 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog26 hydrog ? ? A DG 15 N1 ? ? ? 1_555 A DG 23 O6 ? ? A DG 15 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 15 N2 ? ? ? 1_555 A DG 23 N7 ? ? A DG 15 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 16 N1 ? ? ? 1_555 A DG 22 O6 ? ? A DG 16 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog29 hydrog ? ? A DG 16 N2 ? ? ? 1_555 A DG 22 N7 ? ? A DG 16 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog30 hydrog ? ? A DG 17 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 17 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog31 hydrog ? ? A DG 17 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 17 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2JSM _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DT 1 1 1 DT DT A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DT 6 6 6 DT DT A . n A 1 7 DT 7 7 7 DT DT A . n A 1 8 DA 8 8 8 DA DA A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DT 12 12 12 DT DT A . n A 1 13 DT 13 13 13 DT DT A . n A 1 14 DA 14 14 14 DA DA A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DT 18 18 18 DT DT A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DA 20 20 20 DA DA A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DG 22 22 22 DG DG A . n A 1 23 DG 23 23 23 DG DG A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2008-07-08 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2022-03-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_nmr_spectrometer 4 3 'Structure model' pdbx_struct_assembly 5 3 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' 4 3 'Structure model' '_pdbx_nmr_spectrometer.model' # _pdbx_nmr_exptl_sample.component 'HUMAN TELOMERE DNA' _pdbx_nmr_exptl_sample.concentration .5 _pdbx_nmr_exptl_sample.concentration_units mM _pdbx_nmr_exptl_sample.isotopic_labeling ? _pdbx_nmr_exptl_sample.solution_id 1 # _ndb_struct_conf_na.entry_id 2JSM _ndb_struct_conf_na.feature 'quadruple helix' #