data_2JYF # _entry.id 2JYF # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2JYF pdb_00002jyf 10.2210/pdb2jyf/pdb RCSB RCSB100446 ? ? WWPDB D_1000100446 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 2JYH _pdbx_database_related.details . _pdbx_database_related.content_type unspecified # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2JYF _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2007-12-13 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Zuo, X.' 1 'Wang, J.' 2 'Foster, T.R.' 3 'Schwieters, C.D.' 4 'Tiede, D.M.' 5 # _citation.id primary _citation.title 'Tetraloop-receptor RNA complex' _citation.journal_abbrev 'To be Published' _citation.journal_volume ? _citation.page_first ? _citation.page_last ? _citation.year ? _citation.journal_id_ASTM ? _citation.country ? _citation.journal_id_ISSN ? _citation.journal_id_CSD 0353 _citation.book_publisher ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_DOI ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Zuo, X.' 1 ? primary 'Wang, J.' 2 ? primary 'Foster, T.R.' 3 ? primary 'Schwieters, C.D.' 4 ? primary 'Tiede, D.M.' 5 ? primary 'Butcher, S.E.' 6 ? primary 'Wang, Y.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (43-MER)' _entity.formula_weight 13873.258 _entity.pdbx_number_of_molecules 2 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_seq_one_letter_code_can GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 U n 1 6 A n 1 7 U n 1 8 G n 1 9 G n 1 10 A n 1 11 A n 1 12 G n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 G n 1 18 G n 1 19 G n 1 20 G n 1 21 A n 1 22 A n 1 23 A n 1 24 C n 1 25 U n 1 26 U n 1 27 G n 1 28 G n 1 29 U n 1 30 U n 1 31 C n 1 32 U n 1 33 U n 1 34 C n 1 35 C n 1 36 U n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 C n 1 42 C n 1 43 U n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2JYF _struct_ref.pdbx_db_accession 2JYF _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_db_isoform ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 2JYF A 1 ? 43 ? 2JYF 1 ? 43 ? 1 43 2 1 2JYF B 1 ? 43 ? 2JYF 44 ? 86 ? 44 86 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _pdbx_nmr_exptl.conditions_id 1 _pdbx_nmr_exptl.experiment_id 1 _pdbx_nmr_exptl.solution_id 1 _pdbx_nmr_exptl.type '3D 1H-13C NOESY' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 20 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.contents '8 mg/ml (w/v) RNA:RNA complex, 95% H2O/5% D2O' _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.solvent_system '95% H2O/5% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 800 Bruker DRX 1 'Bruker DRX' 750 Varian UNITYPLUS 2 'Varian UnityPlus' # _pdbx_nmr_refine.entry_id 2JYF _pdbx_nmr_refine.method 'simulated annealing, torsion angle dynamics' _pdbx_nmr_refine.details 'The structures were refined against the SAXS data and NMR-derived restraints.' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2JYF _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2JYF _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Schwieters, C.D. et al.' 'structure solution' 'X-PLOR NIH' 'Not released' 1 'Schwieters, C.D. et al.' refinement 'X-PLOR NIH' 'Not released' 2 'Wang, J. et al.' refinement Define_the_intermolecular_interface_using_SAXS_data ? 3 'Wang, J. et al.' 'structure solution' Define_the_intermolecular_interface_using_SAXS_data ? 4 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ;We applied the small angle X-ray scattering data and NMR restraints to refine the global structure of the tetraloop-receptor RNA:RNA complex. we defined the interface between the two monomers using the SAXS data in complete absence of intermolecular distance restraints ; _exptl.entry_id 2JYF _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2JYF _struct.title 'Tetraloop-receptor RNA complex' _struct.pdbx_model_details ;We applied the small angle X-ray scattering data and NMR restraints to refine the global structure of the tetraloop-receptor RNA:RNA complex. we defined the interface between the two monomers using the SAXS data in complete absence of intermolecular distance restraints ; _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2JYF _struct_keywords.pdbx_keywords RNA/RNA _struct_keywords.text 'RNA structure, RNA:RNA complex, tetraloop-receptor, GAAA-tetraloop, RNA global structure, complex interface, RNA-RNA COMPLEX' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A G 1 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 2 A U 43 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 39 O6 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 39 N1 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 36 O2 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog15 hydrog ? ? A A 6 N7 ? ? ? 1_555 A U 36 N3 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A A 6 N1 ? ? ? 1_555 A A 38 N6 ? ? A A 6 A A 38 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog17 hydrog ? ? A A 6 N1 ? ? ? 1_555 B A 21 N6 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog18 hydrog ? ? A A 6 N6 ? ? ? 1_555 B A 21 N1 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog19 hydrog ? ? A U 7 O4 ? ? ? 1_555 A G 39 N2 ? ? A U 7 A G 39 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog20 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 8 N2 ? ? ? 1_555 B A 23 N3 ? ? A G 8 B A 66 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog24 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A A 10 N6 ? ? ? 1_555 A C 34 N3 ? ? A A 10 A C 34 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog30 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 28 N1 ? ? A C 16 A G 28 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog46 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 26 O2 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog47 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 26 N3 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog48 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 25 O2 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog49 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 25 N3 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog50 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 20 N2 ? ? ? 1_555 A A 23 N7 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog54 hydrog ? ? A G 20 N3 ? ? ? 1_555 A A 23 N6 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog55 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 24 N3 ? ? A G 20 A C 24 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog56 hydrog ? ? A A 21 N1 ? ? ? 1_555 B A 6 N6 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog57 hydrog ? ? A A 21 N6 ? ? ? 1_555 B A 6 N1 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog58 hydrog ? ? A A 23 N3 ? ? ? 1_555 B G 8 N2 ? ? A A 23 B G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog59 hydrog ? ? A A 37 N3 ? ? ? 1_555 A A 38 N6 ? ? A A 37 A A 38 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog60 hydrog ? ? B G 1 N1 ? ? ? 1_555 B U 43 O2 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog61 hydrog ? ? B G 1 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog62 hydrog ? ? B G 2 N1 ? ? ? 1_555 B C 42 N3 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B G 2 N2 ? ? ? 1_555 B C 42 O2 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? B G 2 O6 ? ? ? 1_555 B C 42 N4 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? B G 2 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 45 B U 86 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog66 hydrog ? ? B G 3 N1 ? ? ? 1_555 B C 41 N3 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? B G 3 N2 ? ? ? 1_555 B C 41 O2 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? B G 3 O6 ? ? ? 1_555 B C 41 N4 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? B A 4 N1 ? ? ? 1_555 B U 40 N3 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? B A 4 N6 ? ? ? 1_555 B U 40 O4 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? B U 5 N3 ? ? ? 1_555 B G 39 O6 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog72 hydrog ? ? B U 5 O2 ? ? ? 1_555 B G 39 N1 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog73 hydrog ? ? B A 6 N6 ? ? ? 1_555 B U 36 O2 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog74 hydrog ? ? B A 6 N7 ? ? ? 1_555 B U 36 N3 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog75 hydrog ? ? B A 6 N1 ? ? ? 1_555 B A 38 N6 ? ? B A 49 B A 81 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog76 hydrog ? ? B U 7 O4 ? ? ? 1_555 B G 39 N2 ? ? B U 50 B G 82 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog77 hydrog ? ? B G 8 N1 ? ? ? 1_555 B C 35 N3 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? B G 8 N2 ? ? ? 1_555 B C 35 O2 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? B G 8 O6 ? ? ? 1_555 B C 35 N4 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B G 9 N1 ? ? ? 1_555 B C 34 N3 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B G 9 N2 ? ? ? 1_555 B C 34 O2 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B G 9 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B A 10 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? B A 10 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? B A 10 N6 ? ? ? 1_555 B C 34 N3 ? ? B A 53 B C 77 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog86 hydrog ? ? B A 11 N1 ? ? ? 1_555 B U 32 N3 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B A 11 N6 ? ? ? 1_555 B U 32 O4 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B G 12 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B G 12 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? B G 12 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? B A 13 N1 ? ? ? 1_555 B U 30 N3 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? B A 13 N6 ? ? ? 1_555 B U 30 O4 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? B A 14 N1 ? ? ? 1_555 B U 29 N3 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? B A 14 N6 ? ? ? 1_555 B U 29 O4 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? B C 15 N3 ? ? ? 1_555 B G 28 N1 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? B C 15 N4 ? ? ? 1_555 B G 28 O6 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? B C 15 O2 ? ? ? 1_555 B G 28 N2 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? B C 16 N3 ? ? ? 1_555 B G 27 N1 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? B C 16 N4 ? ? ? 1_555 B G 27 O6 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 27 N2 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 28 N1 ? ? B C 59 B G 71 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog102 hydrog ? ? B G 17 N1 ? ? ? 1_555 B U 26 O2 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog103 hydrog ? ? B G 17 O6 ? ? ? 1_555 B U 26 N3 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog104 hydrog ? ? B G 18 N1 ? ? ? 1_555 B U 25 O2 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog105 hydrog ? ? B G 18 O6 ? ? ? 1_555 B U 25 N3 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog106 hydrog ? ? B G 19 N1 ? ? ? 1_555 B C 24 N3 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? B G 19 N2 ? ? ? 1_555 B C 24 O2 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? B G 19 O6 ? ? ? 1_555 B C 24 N4 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? B G 20 N2 ? ? ? 1_555 B A 23 N7 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog110 hydrog ? ? B G 20 N3 ? ? ? 1_555 B A 23 N6 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog111 hydrog ? ? B G 20 N2 ? ? ? 1_555 B C 24 N3 ? ? B G 63 B C 67 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog112 hydrog ? ? B A 37 N3 ? ? ? 1_555 B A 38 N6 ? ? B A 80 B A 81 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2JYF _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 U 5 5 5 U U A . n A 1 6 A 6 6 6 A A A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 U 25 25 25 U U A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 U 29 29 29 U U A . n A 1 30 U 30 30 30 U U A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 C 35 35 35 C C A . n A 1 36 U 36 36 36 U U A . n A 1 37 A 37 37 37 A A A . n A 1 38 A 38 38 38 A A A . n A 1 39 G 39 39 39 G G A . n A 1 40 U 40 40 40 U U A . n A 1 41 C 41 41 41 C C A . n A 1 42 C 42 42 42 C C A . n A 1 43 U 43 43 43 U U A . n B 1 1 G 1 44 44 G G B . n B 1 2 G 2 45 45 G G B . n B 1 3 G 3 46 46 G G B . n B 1 4 A 4 47 47 A A B . n B 1 5 U 5 48 48 U U B . n B 1 6 A 6 49 49 A A B . n B 1 7 U 7 50 50 U U B . n B 1 8 G 8 51 51 G G B . n B 1 9 G 9 52 52 G G B . n B 1 10 A 10 53 53 A A B . n B 1 11 A 11 54 54 A A B . n B 1 12 G 12 55 55 G G B . n B 1 13 A 13 56 56 A A B . n B 1 14 A 14 57 57 A A B . n B 1 15 C 15 58 58 C C B . n B 1 16 C 16 59 59 C C B . n B 1 17 G 17 60 60 G G B . n B 1 18 G 18 61 61 G G B . n B 1 19 G 19 62 62 G G B . n B 1 20 G 20 63 63 G G B . n B 1 21 A 21 64 64 A A B . n B 1 22 A 22 65 65 A A B . n B 1 23 A 23 66 66 A A B . n B 1 24 C 24 67 67 C C B . n B 1 25 U 25 68 68 U U B . n B 1 26 U 26 69 69 U U B . n B 1 27 G 27 70 70 G G B . n B 1 28 G 28 71 71 G G B . n B 1 29 U 29 72 72 U U B . n B 1 30 U 30 73 73 U U B . n B 1 31 C 31 74 74 C C B . n B 1 32 U 32 75 75 U U B . n B 1 33 U 33 76 76 U U B . n B 1 34 C 34 77 77 C C B . n B 1 35 C 35 78 78 C C B . n B 1 36 U 36 79 79 U U B . n B 1 37 A 37 80 80 A A B . n B 1 38 A 38 81 81 A A B . n B 1 39 G 39 82 82 G G B . n B 1 40 U 40 83 83 U U B . n B 1 41 C 41 84 84 C C B . n B 1 42 C 42 85 85 C C B . n B 1 43 U 43 86 86 U U B . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2008-10-07 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2022-03-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_struct_assembly 4 3 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' # _pdbx_nmr_exptl_sample.component 'RNA:RNA complex' _pdbx_nmr_exptl_sample.concentration 8 _pdbx_nmr_exptl_sample.concentration_units w/v _pdbx_nmr_exptl_sample.isotopic_labeling ? _pdbx_nmr_exptl_sample.solution_id 1 # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.40 2 1 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.40 3 1 "HO2'" A G 18 ? ? "O4'" A G 19 ? ? 1.41 4 1 "HO2'" B G 61 ? ? "O4'" B G 62 ? ? 1.41 5 1 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.42 6 1 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.43 7 1 OP2 B A 49 ? ? H61 B A 80 ? ? 1.54 8 1 OP2 A A 6 ? ? H61 A A 37 ? ? 1.54 9 2 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.44 10 2 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.45 11 2 "HO2'" B A 49 ? ? OP2 B U 50 ? ? 1.47 12 2 "HO2'" A A 6 ? ? OP2 A U 7 ? ? 1.49 13 2 "HO2'" B C 58 ? ? "O4'" B C 59 ? ? 1.53 14 2 "HO2'" A C 15 ? ? "O4'" A C 16 ? ? 1.53 15 3 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.57 16 3 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.58 17 4 "HO2'" B U 50 ? ? "O5'" B G 51 ? ? 1.55 18 4 "HO2'" A U 7 ? ? "O5'" A G 8 ? ? 1.56 19 4 "O2'" B U 79 ? ? "H5'" B A 80 ? ? 1.58 20 4 "O2'" A U 36 ? ? "H5'" A A 37 ? ? 1.58 21 5 "HO2'" A A 37 ? ? OP2 A A 38 ? ? 1.38 22 5 "HO2'" B A 80 ? ? OP2 B A 81 ? ? 1.38 23 5 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.50 24 5 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.51 25 5 "O2'" B G 70 ? ? H8 B G 71 ? ? 1.57 26 5 "O2'" A G 27 ? ? H8 A G 28 ? ? 1.57 27 6 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.44 28 6 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.46 29 7 "HO2'" B A 49 ? ? "O5'" B U 50 ? ? 1.37 30 7 "HO2'" A A 6 ? ? "O5'" A U 7 ? ? 1.37 31 7 "O2'" A U 5 ? ? "H5'" A A 6 ? ? 1.50 32 7 "O2'" B U 48 ? ? "H5'" B A 49 ? ? 1.51 33 7 "O2'" A U 36 ? ? "H5'" A A 37 ? ? 1.55 34 7 "O2'" B U 79 ? ? "H5'" B A 80 ? ? 1.56 35 7 "O2'" A G 27 ? ? H8 A G 28 ? ? 1.56 36 7 "O2'" B G 70 ? ? H8 B G 71 ? ? 1.57 37 8 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.32 38 8 "HO2'" B G 51 ? ? OP1 B G 52 ? ? 1.33 39 8 "HO2'" A G 8 ? ? OP1 A G 9 ? ? 1.34 40 8 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.34 41 8 "HO2'" A A 10 ? ? "O4'" A A 11 ? ? 1.44 42 8 "HO2'" B A 53 ? ? "O4'" B A 54 ? ? 1.45 43 9 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.49 44 9 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.49 45 9 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.56 46 9 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.58 47 10 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.40 48 10 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.41 49 10 "O2'" A U 36 ? ? "H5'" A A 37 ? ? 1.59 50 10 "O2'" B U 79 ? ? "H5'" B A 80 ? ? 1.59 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2JYF 'double helix' 2JYF 'a-form double helix' 2JYF tetraloop 2JYF 'bulge loop' 2JYF 'mismatched base pair' 2JYF 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A U 43 1_555 -1.815 -0.700 -1.001 -13.212 32.357 -13.807 1 A_G1:U43_A A 1 ? A 43 ? 28 ? 1 A G 2 1_555 A C 42 1_555 0.135 -0.398 -0.993 -0.343 14.662 -9.475 2 A_G2:C42_A A 2 ? A 42 ? 19 1 1 A G 3 1_555 A C 41 1_555 -0.589 -0.336 -0.379 11.878 -12.714 4.075 3 A_G3:C41_A A 3 ? A 41 ? 19 1 1 A A 4 1_555 A U 40 1_555 -0.542 -0.218 0.345 10.510 0.934 0.388 4 A_A4:U40_A A 4 ? A 40 ? 20 1 1 A U 5 1_555 A G 39 1_555 3.478 -1.126 0.055 -1.643 -10.058 -1.154 5 A_U5:G39_A A 5 ? A 39 ? 28 ? 1 A A 37 1_555 A A 38 1_555 6.107 -0.590 1.818 -21.155 16.236 -4.470 6 A_A37:A38_A A 37 ? A 38 ? ? 9 1 A A 6 1_555 B A 21 1_555 0.834 2.162 -0.381 -31.504 8.046 -173.847 7 A_A6:A64_B A 6 ? B 64 ? 1 2 1 A C 35 1_555 A G 8 1_555 0.484 -0.239 -0.189 1.682 17.265 -2.399 8 A_C35:G8_A A 35 ? A 8 ? 19 1 1 A C 34 1_555 A G 9 1_555 0.491 -0.259 -0.446 11.741 12.329 -3.679 9 A_C34:G9_A A 34 ? A 9 ? 19 1 1 A U 33 1_555 A A 10 1_555 0.257 -0.335 -0.778 -13.282 -8.188 2.454 10 A_U33:A10_A A 33 ? A 10 ? 20 1 1 A U 32 1_555 A A 11 1_555 0.535 -0.425 -0.908 7.635 -17.782 8.554 11 A_U32:A11_A A 32 ? A 11 ? 20 1 1 A C 31 1_555 A G 12 1_555 0.389 -0.243 -0.739 8.626 -17.228 3.739 12 A_C31:G12_A A 31 ? A 12 ? 19 1 1 A U 30 1_555 A A 13 1_555 -0.450 -0.061 -0.201 -3.564 -1.941 -0.923 13 A_U30:A13_A A 30 ? A 13 ? 20 1 1 A U 29 1_555 A A 14 1_555 -0.452 -0.071 0.153 1.043 -14.976 -3.647 14 A_U29:A14_A A 29 ? A 14 ? 20 1 1 A G 28 1_555 A C 15 1_555 0.304 -0.103 -0.340 -12.576 -20.467 1.247 15 A_G28:C15_A A 28 ? A 15 ? 19 1 1 A G 27 1_555 A C 16 1_555 -0.264 -0.538 -1.426 -12.714 -11.722 3.876 16 A_G27:C16_A A 27 ? A 16 ? 19 1 1 A U 26 1_555 A G 17 1_555 1.786 -0.659 -1.137 13.469 6.195 -7.918 17 A_U26:G17_A A 26 ? A 17 ? 28 1 1 A U 25 1_555 A G 18 1_555 1.969 -0.545 -0.713 -4.799 8.669 -2.702 18 A_U25:G18_A A 25 ? A 18 ? 28 1 1 A C 24 1_555 A G 19 1_555 0.401 -0.169 -0.400 -14.663 0.648 -0.421 19 A_C24:G19_A A 24 ? A 19 ? 19 1 1 A A 23 1_555 A G 20 1_555 -6.443 -4.440 -0.592 -29.270 1.465 -11.369 20 A_A23:G20_A A 23 ? A 20 ? 11 10 1 B G 1 1_555 B U 43 1_555 -1.821 -0.702 -1.006 -13.372 32.153 -13.834 21 B_G44:U86_B B 44 ? B 86 ? 28 ? 1 B G 2 1_555 B C 42 1_555 0.152 -0.394 -0.992 -0.401 14.390 -9.321 22 B_G45:C85_B B 45 ? B 85 ? 19 1 1 B G 3 1_555 B C 41 1_555 -0.594 -0.338 -0.380 11.666 -12.528 4.005 23 B_G46:C84_B B 46 ? B 84 ? 19 1 1 B A 4 1_555 B U 40 1_555 -0.544 -0.223 0.362 10.424 0.649 0.357 24 B_A47:U83_B B 47 ? B 83 ? 20 1 1 B U 5 1_555 B G 39 1_555 3.482 -1.127 0.076 -2.069 -9.538 -1.250 25 B_U48:G82_B B 48 ? B 82 ? 28 ? 1 B A 37 1_555 B A 38 1_555 6.097 -0.587 1.852 -21.514 16.321 -4.613 26 B_A80:A81_B B 80 ? B 81 ? ? 9 1 A A 21 1_555 B A 6 1_555 -0.866 -2.111 0.357 32.318 -7.899 173.978 27 A_A21:A49_B A 21 ? B 49 ? 1 2 1 B G 8 1_555 B C 35 1_555 -0.487 -0.246 -0.210 -1.721 17.395 -2.561 28 B_G51:C78_B B 51 ? B 78 ? 19 1 1 B G 9 1_555 B C 34 1_555 -0.494 -0.256 -0.421 -11.557 12.260 -3.420 29 B_G52:C77_B B 52 ? B 77 ? 19 1 1 B A 10 1_555 B U 33 1_555 -0.254 -0.332 -0.770 13.089 -8.288 2.441 30 B_A53:U76_B B 53 ? B 76 ? 20 1 1 B A 11 1_555 B U 32 1_555 -0.535 -0.423 -0.899 -7.959 -18.572 8.627 31 B_A54:U75_B B 54 ? B 75 ? 20 1 1 B G 12 1_555 B C 31 1_555 -0.396 -0.251 -0.759 -8.845 -17.193 3.707 32 B_G55:C74_B B 55 ? B 74 ? 19 1 1 B A 13 1_555 B U 30 1_555 0.429 -0.060 -0.217 3.378 -1.526 -0.960 33 B_A56:U73_B B 56 ? B 73 ? 20 1 1 B A 14 1_555 B U 29 1_555 0.460 -0.073 0.177 -1.266 -14.630 -3.844 34 B_A57:U72_B B 57 ? B 72 ? 20 1 1 B C 15 1_555 B G 28 1_555 -0.309 -0.106 -0.341 12.222 -20.215 1.279 35 B_C58:G71_B B 58 ? B 71 ? 19 1 1 B C 16 1_555 B G 27 1_555 0.253 -0.547 -1.431 12.327 -11.535 3.861 36 B_C59:G70_B B 59 ? B 70 ? 19 1 1 B G 17 1_555 B U 26 1_555 -1.791 -0.655 -1.128 -13.316 6.515 -7.902 37 B_G60:U69_B B 60 ? B 69 ? 28 1 1 B G 18 1_555 B U 25 1_555 -1.969 -0.544 -0.714 4.714 8.697 -2.733 38 B_G61:U68_B B 61 ? B 68 ? 28 1 1 B G 19 1_555 B C 24 1_555 -0.400 -0.168 -0.396 14.620 0.544 -0.377 39 B_G62:C67_B B 62 ? B 67 ? 19 1 1 B G 20 1_555 B A 23 1_555 6.450 -4.436 -0.574 29.452 1.843 -11.045 40 B_G63:A66_B B 63 ? B 66 ? 11 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A U 43 1_555 A G 2 1_555 A C 42 1_555 -0.042 -1.784 3.402 0.540 8.864 27.641 -5.432 0.198 2.710 17.975 -1.094 29.006 1 AA_G1G2:C42U43_AA A 1 ? A 43 ? A 2 ? A 42 ? 1 A G 2 1_555 A C 42 1_555 A G 3 1_555 A C 41 1_555 0.372 -0.387 3.800 -0.786 -6.074 29.395 0.719 -0.908 3.791 -11.809 1.528 30.013 2 AA_G2G3:C41C42_AA A 2 ? A 42 ? A 3 ? A 41 ? 1 A G 3 1_555 A C 41 1_555 A A 4 1_555 A U 40 1_555 -0.552 -0.143 3.936 -6.498 17.861 31.882 -3.153 -0.196 3.435 29.473 10.722 36.991 3 AA_G3A4:U40C41_AA A 3 ? A 41 ? A 4 ? A 40 ? 1 A A 4 1_555 A U 40 1_555 A U 5 1_555 A G 39 1_555 -0.010 -0.833 3.730 7.054 29.247 43.931 -3.001 0.509 2.697 34.702 -8.370 52.821 4 AA_A4U5:G39U40_AA A 4 ? A 40 ? A 5 ? A 39 ? 1 A U 5 1_555 A G 39 1_555 A A 37 1_555 A A 38 1_555 0.104 4.693 -1.256 135.919 76.048 139.197 2.423 -0.177 -0.366 38.386 -68.605 171.601 5 AA_U5A37:A38G39_AA A 5 ? A 39 ? A 37 ? A 38 ? 1 A A 37 1_555 A A 38 1_555 A A 6 1_555 B A 21 1_555 -0.971 3.375 -1.385 -158.042 40.998 -138.325 -1.614 -0.194 -1.926 -20.635 -79.544 -174.069 6 AA_A37A6:A64A38_BA A 37 ? A 38 ? A 6 ? B 64 ? 1 A A 6 1_555 B A 21 1_555 A C 35 1_555 A G 8 1_555 3.957 5.580 0.924 138.278 38.563 -38.543 -2.553 0.755 -4.665 -22.511 80.719 -145.663 7 AA_A6C35:G8A64_AB A 6 ? B 64 ? A 35 ? A 8 ? 1 A C 35 1_555 A G 8 1_555 A C 34 1_555 A G 9 1_555 -0.254 2.846 -3.526 -4.051 -19.314 -24.437 -8.170 0.138 -1.068 38.576 -8.090 -31.316 8 AA_C35C34:G9G8_AA A 35 ? A 8 ? A 34 ? A 9 ? 1 A C 34 1_555 A G 9 1_555 A U 33 1_555 A A 10 1_555 -0.594 1.481 -2.538 2.711 -9.962 -28.688 -4.202 -1.507 -1.868 19.331 5.261 -30.452 9 AA_C34U33:A10G9_AA A 34 ? A 9 ? A 33 ? A 10 ? 1 A U 33 1_555 A A 10 1_555 A U 32 1_555 A A 11 1_555 0.769 0.696 -4.318 3.013 -16.770 -34.137 -3.819 0.685 -3.651 26.612 4.782 -38.039 10 AA_U33U32:A11A10_AA A 33 ? A 10 ? A 32 ? A 11 ? 1 A U 32 1_555 A A 11 1_555 A C 31 1_555 A G 12 1_555 -1.135 -0.268 -3.504 -2.272 -16.354 -31.542 -2.214 -1.493 -3.314 27.827 -3.866 -35.504 11 AA_U32C31:G12A11_AA A 32 ? A 11 ? A 31 ? A 12 ? 1 A C 31 1_555 A G 12 1_555 A U 30 1_555 A A 13 1_555 -0.272 0.586 -3.094 -4.505 -12.042 -28.708 -3.164 0.275 -2.652 22.892 -8.564 -31.401 12 AA_C31U30:A13G12_AA A 31 ? A 12 ? A 30 ? A 13 ? 1 A U 30 1_555 A A 13 1_555 A U 29 1_555 A A 14 1_555 -0.832 0.032 -3.732 0.382 -28.865 -34.608 -3.090 -1.132 -2.887 40.867 0.541 -44.782 13 AA_U30U29:A14A13_AA A 30 ? A 13 ? A 29 ? A 14 ? 1 A U 29 1_555 A A 14 1_555 A G 28 1_555 A C 15 1_555 0.591 0.748 -2.627 2.812 -20.187 -26.232 -3.841 0.685 -1.694 38.018 5.296 -33.109 14 AA_U29G28:C15A14_AA A 29 ? A 14 ? A 28 ? A 15 ? 1 A G 28 1_555 A C 15 1_555 A G 27 1_555 A C 16 1_555 1.787 -0.070 -3.260 9.803 -1.242 -39.372 -0.046 1.416 -3.586 1.809 14.278 -40.545 15 AA_G28G27:C16C15_AA A 28 ? A 15 ? A 27 ? A 16 ? 1 A G 27 1_555 A C 16 1_555 A U 26 1_555 A G 17 1_555 -1.920 1.296 -4.726 -9.968 -3.693 -22.350 -4.759 0.189 -4.852 8.907 -24.046 -24.720 16 AA_G27U26:G17C16_AA A 27 ? A 16 ? A 26 ? A 17 ? 1 A U 26 1_555 A G 17 1_555 A U 25 1_555 A G 18 1_555 0.165 0.942 -3.636 -1.905 6.387 -27.588 -0.239 0.838 -3.735 -13.151 -3.924 -28.366 17 AA_U26U25:G18G17_AA A 26 ? A 17 ? A 25 ? A 18 ? 1 A U 25 1_555 A G 18 1_555 A C 24 1_555 A G 19 1_555 -0.177 0.395 -4.125 -0.573 8.617 -32.045 1.161 -0.188 -4.093 -15.266 -1.016 -33.159 18 AA_U25C24:G19G18_AA A 25 ? A 18 ? A 24 ? A 19 ? 1 A C 24 1_555 A G 19 1_555 A A 23 1_555 A G 20 1_555 -1.678 -0.485 -3.435 8.324 -25.050 -53.336 -0.870 -2.154 -3.098 26.181 8.700 -59.079 19 AA_C24A23:G20G19_AA A 24 ? A 19 ? A 23 ? A 20 ? 1 B G 1 1_555 B U 43 1_555 B G 2 1_555 B C 42 1_555 -0.053 -1.788 3.395 0.348 9.139 27.816 -5.429 0.177 2.683 18.392 -0.700 29.253 20 BB_G44G45:C85U86_BB B 44 ? B 86 ? B 45 ? B 85 ? 1 B G 2 1_555 B C 42 1_555 B G 3 1_555 B C 41 1_555 0.364 -0.387 3.807 -0.715 -6.724 29.273 0.880 -0.875 3.790 -13.086 1.392 30.027 21 BB_G45G46:C84C85_BB B 45 ? B 85 ? B 46 ? B 84 ? 1 B G 3 1_555 B C 41 1_555 B A 4 1_555 B U 40 1_555 -0.542 -0.153 3.932 -6.583 18.099 31.911 -3.177 -0.218 3.415 29.776 10.829 37.143 22 BB_G46A47:U83C84_BB B 46 ? B 84 ? B 47 ? B 83 ? 1 B A 4 1_555 B U 40 1_555 B U 5 1_555 B G 39 1_555 -0.008 -0.844 3.740 6.962 29.139 44.081 -3.005 0.500 2.710 34.518 -8.247 52.875 23 BB_A47U48:G82U83_BB B 47 ? B 83 ? B 48 ? B 82 ? 1 B U 5 1_555 B G 39 1_555 B A 37 1_555 B A 38 1_555 0.121 4.690 -1.224 135.762 75.959 140.735 2.417 -0.179 -0.367 38.317 -68.484 171.846 24 BB_U48A80:A81G82_BB B 48 ? B 82 ? B 80 ? B 81 ? 1 B A 37 1_555 B A 38 1_555 A A 21 1_555 B A 6 1_555 -0.978 3.355 -1.376 -157.595 40.810 -135.826 -1.600 -0.179 -1.943 -20.561 -79.401 -173.551 25 BA_A80A21:A49A81_BB B 80 ? B 81 ? A 21 ? B 49 ? 1 A A 21 1_555 B A 6 1_555 B G 8 1_555 B C 35 1_555 4.704 -2.633 4.345 -34.789 12.210 31.008 -3.843 -7.499 -1.127 16.981 48.380 47.826 26 AB_A21G51:C78A49_BB A 21 ? B 49 ? B 51 ? B 78 ? 1 B G 8 1_555 B C 35 1_555 B G 9 1_555 B C 34 1_555 -0.236 -2.843 3.526 -4.247 19.073 24.500 -8.166 -0.205 1.101 38.127 8.490 31.244 27 BB_G51G52:C77C78_BB B 51 ? B 78 ? B 52 ? B 77 ? 1 B G 9 1_555 B C 34 1_555 B A 10 1_555 B U 33 1_555 -0.597 -1.488 2.544 2.784 10.154 28.724 -4.223 1.517 1.857 19.654 -5.389 30.555 28 BB_G52A53:U76C77_BB B 52 ? B 77 ? B 53 ? B 76 ? 1 B A 10 1_555 B U 33 1_555 B A 11 1_555 B U 32 1_555 0.775 -0.698 4.321 3.103 16.539 34.214 -3.792 -0.679 3.669 26.238 -4.922 38.017 29 BB_A53A54:U75U76_BB B 53 ? B 76 ? B 54 ? B 75 ? 1 B A 11 1_555 B U 32 1_555 B G 12 1_555 B C 31 1_555 -1.130 0.267 3.502 -2.022 16.579 31.368 -2.259 1.527 3.295 28.294 3.451 35.438 30 BB_A54G55:C74U75_BB B 54 ? B 75 ? B 55 ? B 74 ? 1 B G 12 1_555 B C 31 1_555 B A 13 1_555 B U 30 1_555 -0.263 -0.578 3.093 -4.574 11.794 28.642 -3.130 -0.311 2.664 22.504 8.728 31.258 31 BB_G55A56:U73C74_BB B 55 ? B 74 ? B 56 ? B 73 ? 1 B A 13 1_555 B U 30 1_555 B A 14 1_555 B U 29 1_555 -0.829 -0.048 3.731 0.099 29.240 34.889 -3.086 1.089 2.877 41.028 -0.139 45.228 32 BB_A56A57:U72U73_BB B 56 ? B 73 ? B 57 ? B 72 ? 1 B A 14 1_555 B U 29 1_555 B C 15 1_555 B G 28 1_555 0.600 -0.750 2.637 3.067 19.780 26.148 -3.863 -0.668 1.723 37.511 -5.817 32.823 33 BB_A57C58:G71U72_BB B 57 ? B 72 ? B 58 ? B 71 ? 1 B C 15 1_555 B G 28 1_555 B C 16 1_555 B G 27 1_555 1.804 0.074 3.256 10.037 0.956 39.398 -0.006 -1.412 3.592 1.391 -14.599 40.618 34 BB_C58C59:G70G71_BB B 58 ? B 71 ? B 59 ? B 70 ? 1 B C 16 1_555 B G 27 1_555 B G 17 1_555 B U 26 1_555 -1.905 -1.306 4.707 -10.027 4.197 22.310 -4.988 -0.207 4.786 10.112 24.158 24.787 35 BB_C59G60:U69G70_BB B 59 ? B 70 ? B 60 ? B 69 ? 1 B G 17 1_555 B U 26 1_555 B G 18 1_555 B U 25 1_555 0.162 -0.947 3.645 -1.810 -6.488 27.612 -0.219 -0.807 3.747 -13.344 3.722 28.406 36 BB_G60G61:U68U69_BB B 60 ? B 69 ? B 61 ? B 68 ? 1 B G 18 1_555 B U 25 1_555 B G 19 1_555 B C 24 1_555 -0.179 -0.399 4.121 -0.662 -8.548 32.069 1.136 0.172 4.092 -15.137 1.172 33.166 37 BB_G61G62:C67U68_BB B 61 ? B 68 ? B 62 ? B 67 ? 1 B G 19 1_555 B C 24 1_555 B G 20 1_555 B A 23 1_555 -1.689 0.488 3.424 8.301 25.230 53.366 -0.869 2.159 3.088 26.338 -8.665 59.173 38 BB_G62G63:A66C67_BB B 62 ? B 67 ? B 63 ? B 66 ? #