data_2JYH # _entry.id 2JYH # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2JYH pdb_00002jyh 10.2210/pdb2jyh/pdb RCSB RCSB100448 ? ? WWPDB D_1000100448 ? ? # _pdbx_database_related.db_id 2jyf _pdbx_database_related.db_name PDB _pdbx_database_related.details . _pdbx_database_related.content_type unspecified # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2JYH _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2007-12-13 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Zuo, X.' 1 'Wang, J.' 2 'Foster, T.R.' 3 'Schwieters, C.D.' 4 'Tiede, D.M.' 5 # _citation.id primary _citation.title 'Rigid-body refinement of the tetraloop-receptor RNA complex' _citation.journal_abbrev 'To be Published' _citation.journal_volume ? _citation.page_first ? _citation.page_last ? _citation.year ? _citation.journal_id_ASTM ? _citation.country ? _citation.journal_id_ISSN ? _citation.journal_id_CSD 0353 _citation.book_publisher ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_DOI ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Zuo, X.' 1 ? primary 'Wang, J.' 2 ? primary 'Foster, T.R.' 3 ? primary 'Schwieters, C.D.' 4 ? primary 'Tiede, D.M.' 5 ? primary 'Butcher, S.E.' 6 ? primary 'Wang, Y.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (43-MER)' _entity.formula_weight 13873.258 _entity.pdbx_number_of_molecules 2 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_seq_one_letter_code_can GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 U n 1 6 A n 1 7 U n 1 8 G n 1 9 G n 1 10 A n 1 11 A n 1 12 G n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 G n 1 18 G n 1 19 G n 1 20 G n 1 21 A n 1 22 A n 1 23 A n 1 24 C n 1 25 U n 1 26 U n 1 27 G n 1 28 G n 1 29 U n 1 30 U n 1 31 C n 1 32 U n 1 33 U n 1 34 C n 1 35 C n 1 36 U n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 C n 1 42 C n 1 43 U n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2JYH _struct_ref.pdbx_db_accession 2JYH _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_db_isoform ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 2JYH A 1 ? 43 ? 2JYH 1 ? 43 ? 1 43 2 1 2JYH B 1 ? 43 ? 2JYH 44 ? 86 ? 44 86 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _pdbx_nmr_exptl.conditions_id 1 _pdbx_nmr_exptl.experiment_id 1 _pdbx_nmr_exptl.solution_id 1 _pdbx_nmr_exptl.type '3D 1H-13C NOESY' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 20 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.contents '8 mg/ml (w/v) Tetraloop-receptor RNA/RNA complex, 95% H2O/5% D2O' _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.solvent_system '95% H2O/5% D2O' # _pdbx_nmr_spectrometer.field_strength 800 _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model DRX _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type 'Bruker DRX' # _pdbx_nmr_refine.entry_id 2JYH _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details 'A modified SA using a rigid-body refinement protocol' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 40 _pdbx_nmr_ensemble.conformers_submitted_total_number 5 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2JYH _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2JYH _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Schwieters, C.D. et al.' refinement 'X-PLOR NIH' 'Not released' 1 'Schwieters, C.D. et al.' 'structure solution' 'X-PLOR NIH' 'Not released' 2 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details 'The deposited structures were calculated using a rigid-body refinement protocol and the SAXS data' _exptl.entry_id 2JYH _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2JYH _struct.title 'Rigid-body refinement of the tetraloop-receptor RNA complex' _struct.pdbx_model_details 'The deposited structures were calculated using a rigid-body refinement protocol and the SAXS data' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2JYH _struct_keywords.pdbx_keywords RNA/RNA _struct_keywords.text 'RNA structure, RNA-RNA complex, tetraloop-receptor, GAAA-tetraloop, RNA global structure' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A G 1 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 2 A U 43 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 39 O6 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 39 N1 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 36 O2 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog15 hydrog ? ? A A 6 N7 ? ? ? 1_555 A U 36 N3 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 28 N1 ? ? A C 16 A G 28 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog40 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 26 O2 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog41 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 26 N3 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog42 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 25 O2 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog43 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 25 N3 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 20 N2 ? ? ? 1_555 A A 23 N7 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog48 hydrog ? ? A G 20 N3 ? ? ? 1_555 A A 23 N6 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog49 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 24 N3 ? ? A G 20 A C 24 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog50 hydrog ? ? A A 21 N1 ? ? ? 1_555 B A 6 N6 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog51 hydrog ? ? A A 21 N6 ? ? ? 1_555 B A 6 N1 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog52 hydrog ? ? A A 23 N3 ? ? ? 1_555 B G 8 N2 ? ? A A 23 B G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog53 hydrog ? ? A A 37 N3 ? ? ? 1_555 A A 38 N6 ? ? A A 37 A A 38 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog54 hydrog ? ? B G 1 N1 ? ? ? 1_555 B U 43 O2 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog55 hydrog ? ? B G 1 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog56 hydrog ? ? B G 2 N1 ? ? ? 1_555 B C 42 N3 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? B G 2 N2 ? ? ? 1_555 B C 42 O2 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? B G 2 O6 ? ? ? 1_555 B C 42 N4 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? B G 2 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 45 B U 86 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog60 hydrog ? ? B G 3 N1 ? ? ? 1_555 B C 41 N3 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B G 3 N2 ? ? ? 1_555 B C 41 O2 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B G 3 O6 ? ? ? 1_555 B C 41 N4 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B A 4 N1 ? ? ? 1_555 B U 40 N3 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? B A 4 N6 ? ? ? 1_555 B U 40 O4 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? B U 5 N3 ? ? ? 1_555 B G 39 O6 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog66 hydrog ? ? B U 5 O2 ? ? ? 1_555 B G 39 N1 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog67 hydrog ? ? B A 6 N6 ? ? ? 1_555 B U 36 O2 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog68 hydrog ? ? B A 6 N7 ? ? ? 1_555 B U 36 N3 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog69 hydrog ? ? B G 8 N1 ? ? ? 1_555 B C 35 N3 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? B G 8 N2 ? ? ? 1_555 B C 35 O2 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? B G 8 O6 ? ? ? 1_555 B C 35 N4 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? B G 9 N1 ? ? ? 1_555 B C 34 N3 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? B G 9 N2 ? ? ? 1_555 B C 34 O2 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? B G 9 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? B A 10 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? B A 10 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? B A 11 N1 ? ? ? 1_555 B U 32 N3 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? B A 11 N6 ? ? ? 1_555 B U 32 O4 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? B G 12 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B G 12 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B G 12 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B A 13 N1 ? ? ? 1_555 B U 30 N3 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B A 13 N6 ? ? ? 1_555 B U 30 O4 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? B A 14 N1 ? ? ? 1_555 B U 29 N3 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? B A 14 N6 ? ? ? 1_555 B U 29 O4 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? B C 15 N3 ? ? ? 1_555 B G 28 N1 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B C 15 N4 ? ? ? 1_555 B G 28 O6 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B C 15 O2 ? ? ? 1_555 B G 28 N2 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B C 16 N3 ? ? ? 1_555 B G 27 N1 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? B C 16 N4 ? ? ? 1_555 B G 27 O6 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 27 N2 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 28 N1 ? ? B C 59 B G 71 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog93 hydrog ? ? B G 17 N1 ? ? ? 1_555 B U 26 O2 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog94 hydrog ? ? B G 17 O6 ? ? ? 1_555 B U 26 N3 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog95 hydrog ? ? B G 18 N1 ? ? ? 1_555 B U 25 O2 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog96 hydrog ? ? B G 18 O6 ? ? ? 1_555 B U 25 N3 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog97 hydrog ? ? B G 19 N1 ? ? ? 1_555 B C 24 N3 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? B G 19 N2 ? ? ? 1_555 B C 24 O2 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? B G 19 O6 ? ? ? 1_555 B C 24 N4 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? B G 20 N2 ? ? ? 1_555 B A 23 N7 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog101 hydrog ? ? B G 20 N3 ? ? ? 1_555 B A 23 N6 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog102 hydrog ? ? B G 20 N2 ? ? ? 1_555 B C 24 N3 ? ? B G 63 B C 67 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog103 hydrog ? ? B A 37 N3 ? ? ? 1_555 B A 38 N6 ? ? B A 80 B A 81 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2JYH _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 U 5 5 5 U U A . n A 1 6 A 6 6 6 A A A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 U 25 25 25 U U A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 U 29 29 29 U U A . n A 1 30 U 30 30 30 U U A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 C 35 35 35 C C A . n A 1 36 U 36 36 36 U U A . n A 1 37 A 37 37 37 A A A . n A 1 38 A 38 38 38 A A A . n A 1 39 G 39 39 39 G G A . n A 1 40 U 40 40 40 U U A . n A 1 41 C 41 41 41 C C A . n A 1 42 C 42 42 42 C C A . n A 1 43 U 43 43 43 U U A . n B 1 1 G 1 44 44 G G B . n B 1 2 G 2 45 45 G G B . n B 1 3 G 3 46 46 G G B . n B 1 4 A 4 47 47 A A B . n B 1 5 U 5 48 48 U U B . n B 1 6 A 6 49 49 A A B . n B 1 7 U 7 50 50 U U B . n B 1 8 G 8 51 51 G G B . n B 1 9 G 9 52 52 G G B . n B 1 10 A 10 53 53 A A B . n B 1 11 A 11 54 54 A A B . n B 1 12 G 12 55 55 G G B . n B 1 13 A 13 56 56 A A B . n B 1 14 A 14 57 57 A A B . n B 1 15 C 15 58 58 C C B . n B 1 16 C 16 59 59 C C B . n B 1 17 G 17 60 60 G G B . n B 1 18 G 18 61 61 G G B . n B 1 19 G 19 62 62 G G B . n B 1 20 G 20 63 63 G G B . n B 1 21 A 21 64 64 A A B . n B 1 22 A 22 65 65 A A B . n B 1 23 A 23 66 66 A A B . n B 1 24 C 24 67 67 C C B . n B 1 25 U 25 68 68 U U B . n B 1 26 U 26 69 69 U U B . n B 1 27 G 27 70 70 G G B . n B 1 28 G 28 71 71 G G B . n B 1 29 U 29 72 72 U U B . n B 1 30 U 30 73 73 U U B . n B 1 31 C 31 74 74 C C B . n B 1 32 U 32 75 75 U U B . n B 1 33 U 33 76 76 U U B . n B 1 34 C 34 77 77 C C B . n B 1 35 C 35 78 78 C C B . n B 1 36 U 36 79 79 U U B . n B 1 37 A 37 80 80 A A B . n B 1 38 A 38 81 81 A A B . n B 1 39 G 39 82 82 G G B . n B 1 40 U 40 83 83 U U B . n B 1 41 C 41 84 84 C C B . n B 1 42 C 42 85 85 C C B . n B 1 43 U 43 86 86 U U B . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2008-10-07 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2022-03-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_struct_assembly 4 3 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' # _pdbx_nmr_exptl_sample.component 'Tetraloop-receptor RNA:RNA complex' _pdbx_nmr_exptl_sample.concentration 8 _pdbx_nmr_exptl_sample.concentration_units w/v _pdbx_nmr_exptl_sample.isotopic_labeling ? _pdbx_nmr_exptl_sample.solution_id 1 # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" B A 49 ? ? "O4'" B U 50 ? ? 1.34 2 1 "HO2'" A A 6 ? ? "O4'" A U 7 ? ? 1.34 3 1 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.47 4 1 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.47 5 1 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.52 6 1 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.52 7 2 "HO2'" A A 6 ? ? "O4'" A U 7 ? ? 1.31 8 2 "HO2'" B A 49 ? ? "O4'" B U 50 ? ? 1.32 9 2 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.47 10 2 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.47 11 2 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.52 12 2 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.53 13 3 "HO2'" A A 6 ? ? "O4'" A U 7 ? ? 1.34 14 3 "HO2'" B A 49 ? ? "O4'" B U 50 ? ? 1.34 15 3 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.45 16 3 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.45 17 3 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.52 18 3 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.53 19 4 "HO2'" B A 49 ? ? "O4'" B U 50 ? ? 1.34 20 4 "HO2'" A A 6 ? ? "O4'" A U 7 ? ? 1.34 21 4 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.47 22 4 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.47 23 4 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.52 24 4 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.52 25 5 "HO2'" A A 6 ? ? "O4'" A U 7 ? ? 1.35 26 5 "HO2'" B A 49 ? ? "O4'" B U 50 ? ? 1.35 27 5 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.45 28 5 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.45 29 5 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.52 30 5 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.52 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2JYH 'double helix' 2JYH 'a-form double helix' 2JYH tetraloop 2JYH 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A U 43 1_555 -1.803 -0.646 -1.037 -15.925 22.811 -12.144 1 A_G1:U43_A A 1 ? A 43 ? 28 ? 1 A G 2 1_555 A C 42 1_555 -0.020 -0.354 -0.864 -0.686 16.691 -8.652 2 A_G2:C42_A A 2 ? A 42 ? 19 1 1 A G 3 1_555 A C 41 1_555 -0.058 -0.177 0.256 -12.376 14.594 4.728 3 A_G3:C41_A A 3 ? A 41 ? 19 1 1 A A 4 1_555 A U 40 1_555 0.031 -0.074 0.182 -2.667 -7.053 -1.731 4 A_A4:U40_A A 4 ? A 40 ? 20 1 1 A U 5 1_555 A G 39 1_555 3.095 -0.781 -0.381 0.928 -5.063 -0.273 5 A_U5:G39_A A 5 ? A 39 ? 28 ? 1 A A 37 1_555 A A 38 1_555 6.386 -0.561 1.872 -20.099 6.470 -1.241 6 A_A37:A38_A A 37 ? A 38 ? ? ? 1 A A 6 1_555 A U 36 1_555 -3.628 -1.480 0.706 -3.629 17.199 -95.438 7 A_A6:U36_A A 6 ? A 36 ? 24 4 1 A G 8 1_555 A C 35 1_555 -0.440 -0.279 -0.525 -9.110 14.791 -4.994 8 A_G8:C35_A A 8 ? A 35 ? 19 1 1 A G 9 1_555 A C 34 1_555 0.443 -0.265 -0.875 -7.317 10.429 -7.332 9 A_G9:C34_A A 9 ? A 34 ? 19 1 1 A A 10 1_555 A U 33 1_555 -0.120 -0.143 -0.382 15.086 -2.949 -0.602 10 A_A10:U33_A A 10 ? A 33 ? 20 1 1 A A 11 1_555 A U 32 1_555 -0.419 -0.429 -0.884 -3.574 -24.576 9.825 11 A_A11:U32_A A 11 ? A 32 ? 20 1 1 A G 12 1_555 A C 31 1_555 -0.633 -0.364 -0.889 -10.925 -15.436 3.045 12 A_G12:C31_A A 12 ? A 31 ? 19 1 1 A A 13 1_555 A U 30 1_555 0.434 -0.059 -0.133 -2.670 -7.703 -0.493 13 A_A13:U30_A A 13 ? A 30 ? 20 1 1 A A 14 1_555 A U 29 1_555 0.504 -0.108 -0.172 0.016 24.700 -6.662 14 A_A14:U29_A A 14 ? A 29 ? 20 1 1 A C 15 1_555 A G 28 1_555 0.445 -0.226 -0.427 19.179 13.045 -2.738 15 A_C15:G28_A A 15 ? A 28 ? 19 1 1 A C 16 1_555 A G 27 1_555 0.022 -0.409 -1.320 13.898 -12.959 4.264 16 A_C16:G27_A A 16 ? A 27 ? 19 1 1 A G 17 1_555 A U 26 1_555 -1.850 -0.593 -1.065 -18.932 13.091 -9.672 17 A_G17:U26_A A 17 ? A 26 ? 28 ? 1 A G 18 1_555 A U 25 1_555 -2.564 -0.526 -0.329 -2.853 14.754 -2.158 18 A_G18:U25_A A 18 ? A 25 ? 28 ? 1 A G 19 1_555 A C 24 1_555 -0.634 -0.155 0.272 20.062 16.642 -1.727 19 A_G19:C24_A A 19 ? A 24 ? 19 1 1 A G 20 1_555 A A 23 1_555 6.588 -3.917 -0.322 31.140 1.819 -11.659 20 A_G20:A23_A A 20 ? A 23 ? 11 10 1 B G 1 1_555 B U 43 1_555 -1.804 -0.643 -1.045 -16.270 22.834 -12.150 21 B_G44:U86_B B 44 ? B 86 ? 28 ? 1 B G 2 1_555 B C 42 1_555 -0.011 -0.353 -0.875 -1.035 16.355 -8.615 22 B_G45:C85_B B 45 ? B 85 ? 19 1 1 B G 3 1_555 B C 41 1_555 -0.064 -0.180 0.260 -12.359 14.657 4.782 23 B_G46:C84_B B 46 ? B 84 ? 19 1 1 B A 4 1_555 B U 40 1_555 0.027 -0.073 0.170 -3.131 -7.105 -1.756 24 B_A47:U83_B B 47 ? B 83 ? 20 1 1 B U 5 1_555 B G 39 1_555 3.088 -0.776 -0.367 0.730 -4.619 -0.409 25 B_U48:G82_B B 48 ? B 82 ? 28 ? 1 B A 37 1_555 B A 38 1_555 6.383 -0.563 1.888 -20.310 6.544 -1.284 26 B_A80:A81_B B 80 ? B 81 ? ? ? 1 A A 21 1_555 B A 6 1_555 -1.378 -2.584 0.542 28.507 -24.381 178.567 27 A_A21:A49_B A 21 ? B 49 ? 1 2 1 B G 8 1_555 B C 35 1_555 -0.433 -0.278 -0.542 -9.842 14.564 -5.042 28 B_G51:C78_B B 51 ? B 78 ? 19 1 1 B G 9 1_555 B C 34 1_555 0.443 -0.266 -0.884 -7.594 10.272 -7.351 29 B_G52:C77_B B 52 ? B 77 ? 19 1 1 B A 10 1_555 B U 33 1_555 -0.116 -0.142 -0.385 14.832 -2.874 -0.602 30 B_A53:U76_B B 53 ? B 76 ? 20 1 1 B A 11 1_555 B U 32 1_555 -0.416 -0.430 -0.885 -3.478 -24.487 9.775 31 B_A54:U75_B B 54 ? B 75 ? 20 1 1 B G 12 1_555 B C 31 1_555 -0.632 -0.368 -0.907 -11.272 -15.565 3.100 32 B_G55:C74_B B 55 ? B 74 ? 19 1 1 B A 13 1_555 B U 30 1_555 0.437 -0.059 -0.134 -2.708 -7.501 -0.487 33 B_A56:U73_B B 56 ? B 73 ? 20 1 1 B A 14 1_555 B U 29 1_555 0.505 -0.108 -0.171 -0.228 24.783 -6.644 34 B_A57:U72_B B 57 ? B 72 ? 20 1 1 B C 15 1_555 B G 28 1_555 0.446 -0.225 -0.410 18.918 13.287 -2.582 35 B_C58:G71_B B 58 ? B 71 ? 19 1 1 B C 16 1_555 B G 27 1_555 0.030 -0.410 -1.328 14.165 -13.044 4.390 36 B_C59:G70_B B 59 ? B 70 ? 19 1 1 B G 17 1_555 B U 26 1_555 -1.851 -0.587 -1.047 -18.620 13.405 -9.488 37 B_G60:U69_B B 60 ? B 69 ? 28 ? 1 B G 18 1_555 B U 25 1_555 -2.566 -0.524 -0.303 -2.512 14.965 -2.024 38 B_G61:U68_B B 61 ? B 68 ? 28 ? 1 B G 19 1_555 B C 24 1_555 -0.637 -0.158 0.264 19.633 16.820 -1.680 39 B_G62:C67_B B 62 ? B 67 ? 19 1 1 B G 20 1_555 B A 23 1_555 6.583 -3.919 -0.337 31.350 2.261 -11.787 40 B_G63:A66_B B 63 ? B 66 ? 11 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A U 43 1_555 A G 2 1_555 A C 42 1_555 -0.052 -1.703 3.239 -1.965 7.463 29.555 -4.613 -0.265 2.734 14.325 3.772 30.524 1 AA_G1G2:C42U43_AA A 1 ? A 43 ? A 2 ? A 42 ? 1 A G 2 1_555 A C 42 1_555 A G 3 1_555 A C 41 1_555 1.182 -0.865 5.034 -4.222 1.307 28.882 -2.143 -3.727 4.773 2.602 8.402 29.211 2 AA_G2G3:C41C42_AA A 2 ? A 42 ? A 3 ? A 41 ? 1 A G 3 1_555 A C 41 1_555 A A 4 1_555 A U 40 1_555 -1.051 -0.752 3.722 3.151 3.675 29.426 -2.311 2.770 3.476 7.174 -6.150 29.812 3 AA_G3A4:U40C41_AA A 3 ? A 41 ? A 4 ? A 40 ? 1 A A 4 1_555 A U 40 1_555 A U 5 1_555 A G 39 1_555 0.495 -0.220 3.945 3.004 1.534 40.921 -0.515 -0.310 3.960 2.190 -4.288 41.054 4 AA_A4U5:G39U40_AA A 4 ? A 40 ? A 5 ? A 39 ? 1 A U 5 1_555 A G 39 1_555 A A 37 1_555 A A 38 1_555 -0.382 5.443 -0.399 144.143 72.812 171.372 2.727 0.180 -0.241 36.418 -72.094 178.613 5 AA_U5A37:A38G39_AA A 5 ? A 39 ? A 37 ? A 38 ? 1 A A 37 1_555 A A 38 1_555 A A 6 1_555 A U 36 1_555 0.223 -3.277 -0.254 159.021 -0.010 23.946 -1.665 -0.150 0.165 -0.006 -87.800 159.482 6 AA_A37A6:U36A38_AA A 37 ? A 38 ? A 6 ? A 36 ? 1 A A 6 1_555 A U 36 1_555 A G 8 1_555 A C 35 1_555 1.691 -2.843 3.914 -9.352 9.082 66.054 -2.963 -1.934 3.307 8.248 8.493 67.185 7 AA_A6G8:C35U36_AA A 6 ? A 36 ? A 8 ? A 35 ? 1 A G 8 1_555 A C 35 1_555 A G 9 1_555 A C 34 1_555 0.023 -1.084 4.436 2.576 -3.789 32.927 -1.023 0.552 4.518 -6.644 -4.517 33.235 8 AA_G8G9:C34C35_AA A 8 ? A 35 ? A 9 ? A 34 ? 1 A G 9 1_555 A C 34 1_555 A A 10 1_555 A U 33 1_555 -0.528 -1.023 2.907 -1.120 8.433 27.242 -3.705 0.856 2.503 17.374 2.308 28.515 9 AA_G9A10:U33C34_AA A 9 ? A 34 ? A 10 ? A 33 ? 1 A A 10 1_555 A U 33 1_555 A A 11 1_555 A U 32 1_555 0.678 -0.378 4.357 5.858 16.084 33.497 -3.392 -0.033 3.851 25.911 -9.437 37.506 10 AA_A10A11:U32U33_AA A 10 ? A 33 ? A 11 ? A 32 ? 1 A A 11 1_555 A U 32 1_555 A G 12 1_555 A C 31 1_555 -0.894 0.235 3.696 -4.167 21.394 31.233 -2.870 0.746 3.286 34.917 6.801 37.930 11 AA_A11G12:C31U32_AA A 11 ? A 32 ? A 12 ? A 31 ? 1 A G 12 1_555 A C 31 1_555 A A 13 1_555 A U 30 1_555 -0.344 -0.401 3.165 -4.172 15.162 33.415 -2.597 0.005 2.757 24.738 6.807 36.835 12 AA_G12A13:U30C31_AA A 12 ? A 31 ? A 13 ? A 30 ? 1 A A 13 1_555 A U 30 1_555 A A 14 1_555 A U 29 1_555 0.023 -0.941 3.717 -1.101 23.170 27.234 -5.059 -0.205 2.259 41.034 1.950 35.631 13 AA_A13A14:U29U30_AA A 13 ? A 30 ? A 14 ? A 29 ? 1 A A 14 1_555 A U 29 1_555 A C 15 1_555 A G 28 1_555 0.308 -0.987 3.361 0.995 17.746 27.329 -4.710 -0.386 2.317 33.447 -1.875 32.508 14 AA_A14C15:G28U29_AA A 14 ? A 29 ? A 15 ? A 28 ? 1 A C 15 1_555 A G 28 1_555 A C 16 1_555 A G 27 1_555 2.292 -0.471 2.861 17.700 18.253 32.145 -2.731 -1.297 3.037 28.123 -27.271 40.776 15 AA_C15C16:G27G28_AA A 15 ? A 28 ? A 16 ? A 27 ? 1 A C 16 1_555 A G 27 1_555 A G 17 1_555 A U 26 1_555 -2.059 -1.390 4.778 -11.325 9.805 21.983 -6.978 -0.082 4.328 22.639 26.150 26.549 16 AA_C16G17:U26G27_AA A 16 ? A 27 ? A 17 ? A 26 ? 1 A G 17 1_555 A U 26 1_555 A G 18 1_555 A U 25 1_555 0.373 -1.051 3.595 -3.919 -3.096 25.849 -1.387 -1.985 3.599 -6.839 8.658 26.319 17 AA_G17G18:U25U26_AA A 17 ? A 26 ? A 18 ? A 25 ? 1 A G 18 1_555 A U 25 1_555 A G 19 1_555 A C 24 1_555 -0.191 -0.877 3.330 -4.779 1.781 32.093 -1.885 -0.508 3.272 3.197 8.576 32.486 18 AA_G18G19:C24U25_AA A 18 ? A 25 ? A 19 ? A 24 ? 1 A G 19 1_555 A C 24 1_555 A G 20 1_555 A A 23 1_555 -1.411 0.251 3.552 13.772 31.411 52.590 -1.330 2.058 2.878 31.926 -13.998 62.111 19 AA_G19G20:A23C24_AA A 19 ? A 24 ? A 20 ? A 23 ? 1 B G 1 1_555 B U 43 1_555 B G 2 1_555 B C 42 1_555 -0.060 -1.699 3.243 -1.937 7.409 29.628 -4.587 -0.244 2.746 14.192 3.710 30.580 20 BB_G44G45:C85U86_BB B 44 ? B 86 ? B 45 ? B 85 ? 1 B G 2 1_555 B C 42 1_555 B G 3 1_555 B C 41 1_555 1.180 -0.863 5.021 -4.412 1.219 28.775 -2.117 -3.796 4.751 2.433 8.807 29.129 21 BB_G45G46:C84C85_BB B 45 ? B 85 ? B 46 ? B 84 ? 1 B G 3 1_555 B C 41 1_555 B A 4 1_555 B U 40 1_555 -1.058 -0.756 3.733 3.208 3.818 29.445 -2.348 2.794 3.477 7.444 -6.255 29.855 22 BB_G46A47:U83C84_BB B 46 ? B 84 ? B 47 ? B 83 ? 1 B A 4 1_555 B U 40 1_555 B U 5 1_555 B G 39 1_555 0.488 -0.224 3.941 2.776 1.392 40.868 -0.503 -0.330 3.954 1.991 -3.969 40.981 23 BB_A47U48:G82U83_BB B 47 ? B 83 ? B 48 ? B 82 ? 1 B U 5 1_555 B G 39 1_555 B A 37 1_555 B A 38 1_555 -0.387 5.433 -0.385 143.935 72.756 171.752 2.722 0.183 -0.235 36.389 -71.989 178.660 24 BB_U48A80:A81G82_BB B 48 ? B 82 ? B 80 ? B 81 ? 1 B A 37 1_555 B A 38 1_555 A A 21 1_555 B A 6 1_555 0.044 4.295 -2.017 -157.811 54.412 -169.831 -2.118 0.108 -2.129 -27.215 -78.930 -178.844 25 BA_A80A21:A49A81_BB B 80 ? B 81 ? A 21 ? B 49 ? 1 A A 21 1_555 B A 6 1_555 B G 8 1_555 B C 35 1_555 3.547 -2.542 4.257 -22.564 20.434 24.525 -5.538 -7.226 -0.625 34.921 38.562 38.908 26 AB_A21G51:C78A49_BB A 21 ? B 49 ? B 51 ? B 78 ? 1 B G 8 1_555 B C 35 1_555 B G 9 1_555 B C 34 1_555 0.011 -1.076 4.425 2.495 -3.827 32.910 -1.002 0.553 4.507 -6.715 -4.378 33.217 27 BB_G51G52:C77C78_BB B 51 ? B 78 ? B 52 ? B 77 ? 1 B G 9 1_555 B C 34 1_555 B A 10 1_555 B U 33 1_555 -0.530 -1.020 2.906 -1.248 8.391 27.285 -3.686 0.833 2.508 17.266 2.568 28.549 28 BB_G52A53:U76C77_BB B 52 ? B 77 ? B 53 ? B 76 ? 1 B A 10 1_555 B U 33 1_555 B A 11 1_555 B U 32 1_555 0.679 -0.377 4.348 5.945 15.980 33.510 -3.370 -0.020 3.849 25.749 -9.580 37.487 29 BB_A53A54:U75U76_BB B 53 ? B 76 ? B 54 ? B 75 ? 1 B A 11 1_555 B U 32 1_555 B G 12 1_555 B C 31 1_555 -0.889 0.241 3.709 -4.036 21.586 31.163 -2.896 0.756 3.289 35.230 6.587 37.966 30 BB_A54G55:C74U75_BB B 54 ? B 75 ? B 55 ? B 74 ? 1 B G 12 1_555 B C 31 1_555 B A 13 1_555 B U 30 1_555 -0.344 -0.395 3.154 -4.332 15.114 33.415 -2.577 -0.014 2.752 24.661 7.068 36.833 31 BB_G55A56:U73C74_BB B 55 ? B 74 ? B 56 ? B 73 ? 1 B A 13 1_555 B U 30 1_555 B A 14 1_555 B U 29 1_555 0.023 -0.946 3.719 -1.151 23.259 27.226 -5.068 -0.212 2.251 41.152 2.037 35.683 32 BB_A56A57:U72U73_BB B 56 ? B 73 ? B 57 ? B 72 ? 1 B A 14 1_555 B U 29 1_555 B C 15 1_555 B G 28 1_555 0.310 -0.996 3.364 0.842 17.726 27.374 -4.717 -0.413 2.317 33.378 -1.586 32.531 33 BB_A57C58:G71U72_BB B 57 ? B 72 ? B 58 ? B 71 ? 1 B C 15 1_555 B G 28 1_555 B C 16 1_555 B G 27 1_555 2.292 -0.469 2.845 17.920 18.018 32.233 -2.690 -1.279 3.041 27.713 -27.562 40.836 34 BB_C58C59:G70G71_BB B 58 ? B 71 ? B 59 ? B 70 ? 1 B C 16 1_555 B G 27 1_555 B G 17 1_555 B U 26 1_555 -2.056 -1.394 4.776 -11.504 9.795 21.955 -6.966 -0.156 4.325 22.597 26.539 26.599 35 BB_C59G60:U69G70_BB B 59 ? B 70 ? B 60 ? B 69 ? 1 B G 17 1_555 B U 26 1_555 B G 18 1_555 B U 25 1_555 0.380 -1.063 3.592 -3.888 -3.262 25.843 -1.362 -1.992 3.601 -7.205 8.588 26.329 36 BB_G60G61:U68U69_BB B 60 ? B 69 ? B 61 ? B 68 ? 1 B G 18 1_555 B U 25 1_555 B G 19 1_555 B C 24 1_555 -0.198 -0.888 3.346 -4.647 2.061 32.075 -1.958 -0.476 3.280 3.701 8.344 32.465 37 BB_G61G62:C67U68_BB B 61 ? B 68 ? B 62 ? B 67 ? 1 B G 19 1_555 B C 24 1_555 B G 20 1_555 B A 23 1_555 -1.413 0.251 3.539 13.685 31.025 52.646 -1.311 2.058 2.876 31.574 -13.928 61.959 38 BB_G62G63:A66C67_BB B 62 ? B 67 ? B 63 ? B 66 ? #