data_2JYJ # _entry.id 2JYJ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.356 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2JYJ pdb_00002jyj 10.2210/pdb2jyj/pdb RCSB RCSB100450 ? ? WWPDB D_1000100450 ? ? # loop_ _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.content_type 2jyh PDB 'rigid-body refinement using SAXS' unspecified 2jyf PDB 'Global refinement using SAXS' unspecified # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2JYJ _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2007-12-13 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Zuo, X.' 1 'Wang, J.' 2 'Foster, T.R.' 3 'Schwieters, C.D.' 4 'Tiede, D.M.' 5 'Butcher, S.E.' 6 'Wang, Y.' 7 # _citation.id primary _citation.title 'RNA helical packing in solution: NMR structure of a 30 kDa GAAA tetraloop-receptor complex.' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 351 _citation.page_first 371 _citation.page_last 382 _citation.year 2005 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 16002091 _citation.pdbx_database_id_DOI 10.1016/j.jmb.2005.05.069 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Davis, J.H.' 1 ? primary 'Tonelli, M.' 2 ? primary 'Scott, L.G.' 3 ? primary 'Jaeger, L.' 4 ? primary 'Williamson, J.R.' 5 ? primary 'Butcher, S.E.' 6 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (43-MER)' _entity.formula_weight 13873.258 _entity.pdbx_number_of_molecules 2 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_seq_one_letter_code_can GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 U n 1 6 A n 1 7 U n 1 8 G n 1 9 G n 1 10 A n 1 11 A n 1 12 G n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 G n 1 18 G n 1 19 G n 1 20 G n 1 21 A n 1 22 A n 1 23 A n 1 24 C n 1 25 U n 1 26 U n 1 27 G n 1 28 G n 1 29 U n 1 30 U n 1 31 C n 1 32 U n 1 33 U n 1 34 C n 1 35 C n 1 36 U n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 C n 1 42 C n 1 43 U n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2JYJ _struct_ref.pdbx_db_accession 2JYJ _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_db_isoform ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 2JYJ A 1 ? 43 ? 2JYJ 1 ? 43 ? 1 43 2 1 2JYJ B 1 ? 43 ? 2JYJ 44 ? 86 ? 44 86 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _pdbx_nmr_exptl.conditions_id 1 _pdbx_nmr_exptl.experiment_id 1 _pdbx_nmr_exptl.solution_id 1 _pdbx_nmr_exptl.type '3D 1H-13C NOESY' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 20 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.contents '8 mg/ml (w/v) Tetraloop-receptor RNA/RNA complex, 95% H2O/5% D2O' _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.solvent_system '95% H2O/5% D2O' # _pdbx_nmr_spectrometer.field_strength 800 _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.model DRX _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type 'Bruker DRX' # _pdbx_nmr_refine.entry_id 2JYJ _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ;This ensemble of the structures were re-refined with NMR-derived restraints. The original refinements have been published in JMB (2005, 351(2), pp351-82). We re-refined the structures of the tetraloop-receptor RNA/RNA complex using the restraint files whose formats are consistent with Xplor-nih. No SAXS data was used in this refinement. ; _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2JYJ _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2JYJ _pdbx_nmr_representative.selection_criteria 'closest to the average' # _pdbx_nmr_software.authors 'Schwieters, C.D. et al.' _pdbx_nmr_software.classification refinement _pdbx_nmr_software.name 'X-PLOR NIH' _pdbx_nmr_software.version 2.18 _pdbx_nmr_software.ordinal 1 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2JYJ _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2JYJ _struct.title 'Re-refining the tetraloop-receptor RNA-RNA complex using NMR-derived restraints and Xplor-nih (2.18)' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2JYJ _struct_keywords.pdbx_keywords RNA/RNA _struct_keywords.text 'RNA structure, RNA-RNA complex, tetraloop-receptor, GAAA-tetraloop, RNA global structure' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A G 1 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 2 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog7 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 2 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog8 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 39 O6 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 39 N1 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 36 O2 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A A 6 N7 ? ? ? 1_555 A U 36 N3 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A A 6 N1 ? ? ? 1_555 B A 21 N6 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog18 hydrog ? ? A A 6 N6 ? ? ? 1_555 B A 21 N1 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog19 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 8 A C 34 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog20 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 8 N2 ? ? ? 1_555 B A 23 N3 ? ? A G 8 B A 66 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog24 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 26 O2 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 26 N3 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog46 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 25 O2 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog47 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 25 N3 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog48 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 20 N2 ? ? ? 1_555 A A 23 N7 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog52 hydrog ? ? A G 20 N3 ? ? ? 1_555 A A 23 N6 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog53 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 24 N3 ? ? A G 20 A C 24 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog54 hydrog ? ? A A 21 N1 ? ? ? 1_555 B A 6 N6 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog55 hydrog ? ? A A 21 N6 ? ? ? 1_555 B A 6 N1 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog56 hydrog ? ? A A 23 N3 ? ? ? 1_555 B G 8 N2 ? ? A A 23 B G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog57 hydrog ? ? A A 37 N3 ? ? ? 1_555 A A 38 N6 ? ? A A 37 A A 38 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog58 hydrog ? ? B G 1 N1 ? ? ? 1_555 B U 43 O2 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog59 hydrog ? ? B G 1 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog60 hydrog ? ? B G 2 N1 ? ? ? 1_555 B C 42 N3 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B G 2 N2 ? ? ? 1_555 B C 42 O2 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B G 2 O6 ? ? ? 1_555 B C 42 N4 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B G 2 N1 ? ? ? 1_555 B U 43 O2 ? ? B G 45 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog64 hydrog ? ? B G 2 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 45 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog65 hydrog ? ? B G 3 N1 ? ? ? 1_555 B C 41 N3 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? B G 3 N2 ? ? ? 1_555 B C 41 O2 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? B G 3 O6 ? ? ? 1_555 B C 41 N4 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? B A 4 N1 ? ? ? 1_555 B U 40 N3 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? B A 4 N6 ? ? ? 1_555 B U 40 O4 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? B U 5 N3 ? ? ? 1_555 B G 39 O6 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog71 hydrog ? ? B U 5 O2 ? ? ? 1_555 B G 39 N1 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog72 hydrog ? ? B A 6 N6 ? ? ? 1_555 B U 36 O2 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog73 hydrog ? ? B A 6 N7 ? ? ? 1_555 B U 36 N3 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog74 hydrog ? ? B G 8 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 51 B C 77 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog75 hydrog ? ? B G 8 N1 ? ? ? 1_555 B C 35 N3 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? B G 8 N2 ? ? ? 1_555 B C 35 O2 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? B G 8 O6 ? ? ? 1_555 B C 35 N4 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? B G 9 N1 ? ? ? 1_555 B C 34 N3 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? B G 9 N2 ? ? ? 1_555 B C 34 O2 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B G 9 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B A 10 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B A 10 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B A 11 N1 ? ? ? 1_555 B U 32 N3 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? B A 11 N6 ? ? ? 1_555 B U 32 O4 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? B G 12 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? B G 12 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B G 12 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B A 13 N1 ? ? ? 1_555 B U 30 N3 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B A 13 N6 ? ? ? 1_555 B U 30 O4 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? B A 14 N1 ? ? ? 1_555 B U 29 N3 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? B A 14 N6 ? ? ? 1_555 B U 29 O4 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? B C 15 N3 ? ? ? 1_555 B G 28 N1 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? B C 15 N4 ? ? ? 1_555 B G 28 O6 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? B C 15 O2 ? ? ? 1_555 B G 28 N2 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? B C 16 N3 ? ? ? 1_555 B G 27 N1 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? B C 16 N4 ? ? ? 1_555 B G 27 O6 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 27 N2 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? B G 17 N1 ? ? ? 1_555 B U 26 O2 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog99 hydrog ? ? B G 17 O6 ? ? ? 1_555 B U 26 N3 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog100 hydrog ? ? B G 18 N1 ? ? ? 1_555 B U 25 O2 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog101 hydrog ? ? B G 18 O6 ? ? ? 1_555 B U 25 N3 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog102 hydrog ? ? B G 19 N1 ? ? ? 1_555 B C 24 N3 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? B G 19 N2 ? ? ? 1_555 B C 24 O2 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? B G 19 O6 ? ? ? 1_555 B C 24 N4 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? B G 20 N2 ? ? ? 1_555 B A 23 N7 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog106 hydrog ? ? B G 20 N3 ? ? ? 1_555 B A 23 N6 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog107 hydrog ? ? B G 20 N2 ? ? ? 1_555 B C 24 N3 ? ? B G 63 B C 67 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog108 hydrog ? ? B A 37 N3 ? ? ? 1_555 B A 38 N6 ? ? B A 80 B A 81 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2JYJ _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 U 5 5 5 U U A . n A 1 6 A 6 6 6 A A A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 U 25 25 25 U U A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 U 29 29 29 U U A . n A 1 30 U 30 30 30 U U A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 C 35 35 35 C C A . n A 1 36 U 36 36 36 U U A . n A 1 37 A 37 37 37 A A A . n A 1 38 A 38 38 38 A A A . n A 1 39 G 39 39 39 G G A . n A 1 40 U 40 40 40 U U A . n A 1 41 C 41 41 41 C C A . n A 1 42 C 42 42 42 C C A . n A 1 43 U 43 43 43 U U A . n B 1 1 G 1 44 44 G G B . n B 1 2 G 2 45 45 G G B . n B 1 3 G 3 46 46 G G B . n B 1 4 A 4 47 47 A A B . n B 1 5 U 5 48 48 U U B . n B 1 6 A 6 49 49 A A B . n B 1 7 U 7 50 50 U U B . n B 1 8 G 8 51 51 G G B . n B 1 9 G 9 52 52 G G B . n B 1 10 A 10 53 53 A A B . n B 1 11 A 11 54 54 A A B . n B 1 12 G 12 55 55 G G B . n B 1 13 A 13 56 56 A A B . n B 1 14 A 14 57 57 A A B . n B 1 15 C 15 58 58 C C B . n B 1 16 C 16 59 59 C C B . n B 1 17 G 17 60 60 G G B . n B 1 18 G 18 61 61 G G B . n B 1 19 G 19 62 62 G G B . n B 1 20 G 20 63 63 G G B . n B 1 21 A 21 64 64 A A B . n B 1 22 A 22 65 65 A A B . n B 1 23 A 23 66 66 A A B . n B 1 24 C 24 67 67 C C B . n B 1 25 U 25 68 68 U U B . n B 1 26 U 26 69 69 U U B . n B 1 27 G 27 70 70 G G B . n B 1 28 G 28 71 71 G G B . n B 1 29 U 29 72 72 U U B . n B 1 30 U 30 73 73 U U B . n B 1 31 C 31 74 74 C C B . n B 1 32 U 32 75 75 U U B . n B 1 33 U 33 76 76 U U B . n B 1 34 C 34 77 77 C C B . n B 1 35 C 35 78 78 C C B . n B 1 36 U 36 79 79 U U B . n B 1 37 A 37 80 80 A A B . n B 1 38 A 38 81 81 A A B . n B 1 39 G 39 82 82 G G B . n B 1 40 U 40 83 83 U U B . n B 1 41 C 41 84 84 C C B . n B 1 42 C 42 85 85 C C B . n B 1 43 U 43 86 86 U U B . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2008-10-07 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2022-03-16 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_struct_assembly 4 3 'Structure model' pdbx_struct_oper_list # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' # _pdbx_nmr_exptl_sample.component 'Tetraloop-receptor RNA:RNA complex RNA-RNA complex' _pdbx_nmr_exptl_sample.concentration 8 _pdbx_nmr_exptl_sample.concentration_units w/v _pdbx_nmr_exptl_sample.isotopic_labeling ? _pdbx_nmr_exptl_sample.solution_id 1 # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.44 2 1 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.45 3 1 "HO2'" A G 18 ? ? "O4'" A G 19 ? ? 1.59 4 1 "HO2'" B G 61 ? ? "O4'" B G 62 ? ? 1.60 5 2 "HO2'" A A 6 ? ? "O4'" A U 7 ? ? 1.34 6 2 "HO2'" B A 49 ? ? "O4'" B U 50 ? ? 1.35 7 2 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.48 8 2 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.49 9 2 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.53 10 2 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.53 11 3 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.36 12 3 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.36 13 3 "O2'" A U 36 ? ? "H5'" A A 37 ? ? 1.59 14 3 "O2'" B U 79 ? ? "H5'" B A 80 ? ? 1.60 15 4 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.48 16 4 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.48 17 4 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.49 18 4 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.51 19 4 "O2'" B U 50 ? ? "H5'" B G 51 ? ? 1.51 20 4 "O2'" A U 7 ? ? "H5'" A G 8 ? ? 1.52 21 4 "HO2'" B C 59 ? ? "O5'" B G 60 ? ? 1.58 22 4 "HO2'" A C 16 ? ? "O5'" A G 17 ? ? 1.58 23 4 "O2'" A A 23 ? ? "HO2'" B C 78 ? ? 1.59 24 4 "HO2'" A C 35 ? ? "O2'" B A 66 ? ? 1.59 25 5 "O2'" A U 7 ? ? "H5'" A G 8 ? ? 1.51 26 5 "O2'" B U 50 ? ? "H5'" B G 51 ? ? 1.52 27 6 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.53 28 6 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.53 29 6 "HO2'" A G 8 ? ? N1 B A 65 ? ? 1.54 30 6 N1 A A 22 ? ? "HO2'" B G 51 ? ? 1.57 31 7 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.59 32 8 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.39 33 8 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.39 34 8 "HO2'" B G 63 ? ? N7 B A 65 ? ? 1.48 35 8 "HO2'" A G 20 ? ? N7 A A 22 ? ? 1.48 36 8 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.51 37 8 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.52 38 9 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.39 39 9 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.43 40 9 "HO2'" A U 36 ? ? "O5'" A A 37 ? ? 1.49 41 9 "HO2'" B U 79 ? ? "O5'" B A 80 ? ? 1.49 42 9 "O2'" A G 20 ? ? H62 A A 22 ? ? 1.51 43 9 "O2'" A A 23 ? ? "HO2'" B C 78 ? ? 1.52 44 9 "O2'" B G 63 ? ? H62 B A 65 ? ? 1.55 45 9 "HO2'" A C 35 ? ? "O2'" B A 66 ? ? 1.55 46 9 "HO2'" A U 25 ? ? "O4'" A U 26 ? ? 1.57 47 9 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.57 48 10 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.59 49 10 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.59 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2JYJ 'double helix' 2JYJ 'a-form double helix' 2JYJ tetraloop 2JYJ 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A U 43 1_555 -1.811 -0.633 -1.108 -17.351 15.333 -11.199 1 A_G1:U43_A A 1 ? A 43 ? 28 ? 1 A G 2 1_555 A C 42 1_555 0.142 -0.293 -0.868 -4.292 13.620 -7.936 2 A_G2:C42_A A 2 ? A 42 ? 19 1 1 A G 3 1_555 A C 41 1_555 -0.515 -0.241 0.080 -9.010 13.956 1.059 3 A_G3:C41_A A 3 ? A 41 ? 19 1 1 A A 4 1_555 A U 40 1_555 0.239 -0.043 0.059 9.695 5.157 -1.330 4 A_A4:U40_A A 4 ? A 40 ? 20 1 1 A U 5 1_555 A G 39 1_555 3.222 -0.874 0.289 0.085 -2.867 -1.708 5 A_U5:G39_A A 5 ? A 39 ? 28 ? 1 A A 37 1_555 A A 38 1_555 5.976 0.248 1.698 -21.552 19.988 -4.636 6 A_A37:A38_A A 37 ? A 38 ? ? 9 1 A A 6 1_555 B A 21 1_555 1.087 1.144 -0.269 -41.187 5.002 -174.745 7 A_A6:A64_B A 6 ? B 64 ? 1 2 1 A G 8 1_555 A C 35 1_555 -0.275 -0.529 0.867 -6.982 -21.134 -11.103 8 A_G8:C35_A A 8 ? A 35 ? 19 1 1 A G 9 1_555 A C 34 1_555 -0.247 -0.427 0.884 0.820 -16.401 -9.094 9 A_G9:C34_A A 9 ? A 34 ? 19 1 1 A A 10 1_555 A U 33 1_555 -0.436 -0.166 0.214 17.088 -12.887 -0.635 10 A_A10:U33_A A 10 ? A 33 ? 20 1 1 A A 11 1_555 A U 32 1_555 -0.282 -0.211 -0.302 19.097 -27.109 2.957 11 A_A11:U32_A A 11 ? A 32 ? 20 1 1 A G 12 1_555 A C 31 1_555 -0.575 -0.236 -0.681 -30.805 5.129 -3.576 12 A_G12:C31_A A 12 ? A 31 ? 19 1 1 A A 13 1_555 A U 30 1_555 0.423 -0.097 0.348 -4.949 -8.436 -3.585 13 A_A13:U30_A A 13 ? A 30 ? 20 1 1 A A 14 1_555 A U 29 1_555 0.563 -0.147 -0.390 2.240 21.169 -9.345 14 A_A14:U29_A A 14 ? A 29 ? 20 1 1 A C 15 1_555 A G 28 1_555 -0.412 -0.109 -0.424 17.361 9.516 -2.279 15 A_C15:G28_A A 15 ? A 28 ? 19 1 1 A C 16 1_555 A G 27 1_555 0.040 -0.543 -1.511 14.799 -11.229 3.030 16 A_C16:G27_A A 16 ? A 27 ? 19 1 1 A G 17 1_555 A U 26 1_555 -1.801 -0.684 -1.117 -12.358 16.297 -11.591 17 A_G17:U26_A A 17 ? A 26 ? 28 ? 1 A G 18 1_555 A U 25 1_555 -2.083 -0.532 -0.674 -0.060 14.326 -4.878 18 A_G18:U25_A A 18 ? A 25 ? 28 ? 1 A G 19 1_555 A C 24 1_555 -0.407 -0.186 -0.420 14.830 10.984 -3.569 19 A_G19:C24_A A 19 ? A 24 ? 19 1 1 A G 20 1_555 A A 23 1_555 6.556 -4.257 -0.400 27.425 -3.256 -10.545 20 A_G20:A23_A A 20 ? A 23 ? 11 10 1 B G 1 1_555 B U 43 1_555 -1.811 -0.638 -1.117 -17.190 15.507 -11.341 21 B_G44:U86_B B 44 ? B 86 ? 28 ? 1 B G 2 1_555 B C 42 1_555 0.143 -0.291 -0.862 -4.147 13.579 -7.838 22 B_G45:C85_B B 45 ? B 85 ? 19 1 1 B G 3 1_555 B C 41 1_555 -0.512 -0.238 0.061 -9.511 14.025 1.072 23 B_G46:C84_B B 46 ? B 84 ? 19 1 1 B A 4 1_555 B U 40 1_555 0.230 -0.043 0.073 9.518 4.984 -1.335 24 B_A47:U83_B B 47 ? B 83 ? 20 1 1 B U 5 1_555 B G 39 1_555 3.213 -0.871 0.313 0.035 -2.855 -1.711 25 B_U48:G82_B B 48 ? B 82 ? 28 ? 1 B A 37 1_555 B A 38 1_555 5.973 0.251 1.663 -21.708 20.078 -4.817 26 B_A80:A81_B B 80 ? B 81 ? ? 9 1 A A 21 1_555 B A 6 1_555 -1.087 -1.054 0.285 41.891 -4.988 174.716 27 A_A21:A49_B A 21 ? B 49 ? 1 2 1 B G 8 1_555 B C 35 1_555 -0.282 -0.540 0.887 -6.615 -20.799 -11.049 28 B_G51:C78_B B 51 ? B 78 ? 19 1 1 B G 9 1_555 B C 34 1_555 -0.245 -0.427 0.886 0.841 -16.387 -9.100 29 B_G52:C77_B B 52 ? B 77 ? 19 1 1 B A 10 1_555 B U 33 1_555 -0.429 -0.165 0.238 16.833 -12.806 -0.706 30 B_A53:U76_B B 53 ? B 76 ? 20 1 1 B A 11 1_555 B U 32 1_555 -0.278 -0.204 -0.266 19.262 -27.505 2.435 31 B_A54:U75_B B 54 ? B 75 ? 20 1 1 B G 12 1_555 B C 31 1_555 -0.581 -0.241 -0.687 -30.779 5.385 -3.665 32 B_G55:C74_B B 55 ? B 74 ? 19 1 1 B A 13 1_555 B U 30 1_555 0.414 -0.092 0.325 -5.104 -8.034 -3.310 33 B_A56:U73_B B 56 ? B 73 ? 20 1 1 B A 14 1_555 B U 29 1_555 0.569 -0.147 -0.387 2.465 21.231 -9.361 34 B_A57:U72_B B 57 ? B 72 ? 20 1 1 B C 15 1_555 B G 28 1_555 -0.416 -0.112 -0.423 17.079 9.890 -2.328 35 B_C58:G71_B B 58 ? B 71 ? 19 1 1 B C 16 1_555 B G 27 1_555 0.024 -0.548 -1.502 14.021 -10.888 2.849 36 B_C59:G70_B B 59 ? B 70 ? 19 1 1 B G 17 1_555 B U 26 1_555 -1.809 -0.681 -1.105 -12.211 16.455 -11.537 37 B_G60:U69_B B 60 ? B 69 ? 28 ? 1 B G 18 1_555 B U 25 1_555 -2.074 -0.536 -0.693 -0.401 14.521 -5.006 38 B_G61:U68_B B 61 ? B 68 ? 28 ? 1 B G 19 1_555 B C 24 1_555 -0.399 -0.178 -0.401 14.923 10.939 -3.487 39 B_G62:C67_B B 62 ? B 67 ? 19 1 1 B G 20 1_555 B A 23 1_555 6.558 -4.259 -0.387 27.518 -3.227 -10.381 40 B_G63:A66_B B 63 ? B 66 ? 11 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A U 43 1_555 A G 2 1_555 A C 42 1_555 -0.178 -1.738 3.262 -1.637 5.912 28.970 -4.587 0.020 2.864 11.653 3.226 29.599 1 AA_G1G2:C42U43_AA A 1 ? A 43 ? A 2 ? A 42 ? 1 A G 2 1_555 A C 42 1_555 A G 3 1_555 A C 41 1_555 0.835 -0.966 4.671 -2.888 -4.287 27.576 -0.538 -2.702 4.654 -8.895 5.992 28.047 2 AA_G2G3:C41C42_AA A 2 ? A 42 ? A 3 ? A 41 ? 1 A G 3 1_555 A C 41 1_555 A A 4 1_555 A U 40 1_555 -0.454 -0.647 3.573 0.861 0.606 30.959 -1.339 1.031 3.547 1.135 -1.612 30.976 3 AA_G3A4:U40C41_AA A 3 ? A 41 ? A 4 ? A 40 ? 1 A A 4 1_555 A U 40 1_555 A U 5 1_555 A G 39 1_555 0.742 -0.781 4.199 3.501 17.556 42.828 -2.873 -0.570 3.674 22.885 -4.564 46.256 4 AA_A4U5:G39U40_AA A 4 ? A 40 ? A 5 ? A 39 ? 1 A U 5 1_555 A G 39 1_555 A A 37 1_555 A A 38 1_555 -0.788 4.175 -1.635 138.230 75.982 138.250 2.211 0.180 -1.069 38.335 -69.741 172.110 5 AA_U5A37:A38G39_AA A 5 ? A 39 ? A 37 ? A 38 ? 1 A A 37 1_555 A A 38 1_555 A A 6 1_555 B A 21 1_555 -1.722 4.831 -0.896 -161.291 44.699 -107.951 -2.276 -0.339 -2.454 -22.670 -81.802 -172.582 6 AA_A37A6:A64A38_BA A 37 ? A 38 ? A 6 ? B 64 ? 1 A G 8 1_555 A C 35 1_555 A G 9 1_555 A C 34 1_555 0.376 -1.540 2.939 -2.813 16.519 33.521 -4.131 -0.881 1.957 26.671 4.542 37.368 7 AA_G8G9:C34C35_AA A 8 ? A 35 ? A 9 ? A 34 ? 1 A G 9 1_555 A C 34 1_555 A A 10 1_555 A U 33 1_555 0.024 -1.058 2.865 1.578 6.936 29.220 -3.235 0.225 2.549 13.498 -3.071 30.055 8 AA_G9A10:U33C34_AA A 9 ? A 34 ? A 10 ? A 33 ? 1 A A 10 1_555 A U 33 1_555 A A 11 1_555 A U 32 1_555 0.796 -0.400 3.463 5.478 3.193 34.852 -1.161 -0.444 3.495 5.276 -9.052 35.406 9 AA_A10A11:U32U33_AA A 10 ? A 33 ? A 11 ? A 32 ? 1 A A 11 1_555 A U 32 1_555 A G 12 1_555 A C 31 1_555 -1.774 -0.595 3.566 -19.997 39.570 36.773 -3.211 0.552 2.559 46.638 23.568 57.003 10 AA_A11G12:C31U32_AA A 11 ? A 32 ? A 12 ? A 31 ? 1 A G 12 1_555 A C 31 1_555 A A 13 1_555 A U 30 1_555 -0.930 -0.258 2.817 -3.527 4.071 37.739 -0.844 1.036 2.848 6.254 5.419 38.108 11 AA_G12A13:U30C31_AA A 12 ? A 31 ? A 13 ? A 30 ? 1 A A 13 1_555 A U 30 1_555 A A 14 1_555 A U 29 1_555 0.043 -0.617 3.766 3.086 12.781 30.985 -3.410 0.491 3.256 22.686 -5.478 33.597 12 AA_A13A14:U29U30_AA A 13 ? A 30 ? A 14 ? A 29 ? 1 A A 14 1_555 A U 29 1_555 A C 15 1_555 A G 28 1_555 0.083 -0.801 3.775 0.373 10.397 23.162 -5.146 -0.069 3.130 24.377 -0.874 25.362 13 AA_A14C15:G28U29_AA A 14 ? A 29 ? A 15 ? A 28 ? 1 A C 15 1_555 A G 28 1_555 A C 16 1_555 A G 27 1_555 1.871 -0.182 3.594 13.560 7.119 37.460 -1.223 -0.885 3.920 10.561 -20.115 40.366 14 AA_C15C16:G27G28_AA A 15 ? A 28 ? A 16 ? A 27 ? 1 A C 16 1_555 A G 27 1_555 A G 17 1_555 A U 26 1_555 -2.244 -1.293 4.603 -13.074 9.224 23.734 -5.802 0.039 4.438 19.803 28.069 28.560 15 AA_C16G17:U26G27_AA A 16 ? A 27 ? A 17 ? A 26 ? 1 A G 17 1_555 A U 26 1_555 A G 18 1_555 A U 25 1_555 0.444 -1.193 3.942 -1.009 -8.873 26.747 0.169 -1.211 4.100 -18.537 2.107 28.172 16 AA_G17G18:U25U26_AA A 17 ? A 26 ? A 18 ? A 25 ? 1 A G 18 1_555 A U 25 1_555 A G 19 1_555 A C 24 1_555 -0.225 -0.797 3.936 -0.735 -6.624 31.183 0.033 0.245 4.020 -12.148 1.348 31.869 17 AA_G18G19:C24U25_AA A 18 ? A 25 ? A 19 ? A 24 ? 1 A G 19 1_555 A C 24 1_555 A G 20 1_555 A A 23 1_555 -1.532 0.058 3.641 7.022 25.978 54.801 -1.340 1.896 3.181 26.517 -7.168 60.590 18 AA_G19G20:A23C24_AA A 19 ? A 24 ? A 20 ? A 23 ? 1 B G 1 1_555 B U 43 1_555 B G 2 1_555 B C 42 1_555 -0.176 -1.738 3.258 -1.946 6.187 28.970 -4.623 -0.043 2.839 12.176 3.830 29.672 19 BB_G44G45:C85U86_BB B 44 ? B 86 ? B 45 ? B 85 ? 1 B G 2 1_555 B C 42 1_555 B G 3 1_555 B C 41 1_555 0.820 -0.963 4.697 -2.653 -4.665 27.595 -0.396 -2.593 4.694 -9.664 5.496 28.102 20 BB_G45G46:C84C85_BB B 45 ? B 85 ? B 46 ? B 84 ? 1 B G 3 1_555 B C 41 1_555 B A 4 1_555 B U 40 1_555 -0.451 -0.650 3.557 0.566 0.833 30.891 -1.394 0.965 3.530 1.563 -1.063 30.907 21 BB_G46A47:U83C84_BB B 46 ? B 84 ? B 47 ? B 83 ? 1 B A 4 1_555 B U 40 1_555 B U 5 1_555 B G 39 1_555 0.723 -0.788 4.197 3.428 17.762 42.882 -2.888 -0.553 3.660 23.105 -4.460 46.376 22 BB_A47U48:G82U83_BB B 47 ? B 83 ? B 48 ? B 82 ? 1 B U 5 1_555 B G 39 1_555 B A 37 1_555 B A 38 1_555 -0.805 4.164 -1.674 138.206 76.079 137.321 2.211 0.178 -1.097 38.399 -69.756 171.952 23 BB_U48A80:A81G82_BB B 48 ? B 82 ? B 80 ? B 81 ? 1 B A 37 1_555 B A 38 1_555 A A 21 1_555 B A 6 1_555 -1.696 4.825 -0.880 -161.824 44.887 -105.725 -2.268 -0.310 -2.462 -22.769 -82.085 -172.724 24 BA_A80A21:A49A81_BB B 80 ? B 81 ? A 21 ? B 49 ? 1 B G 8 1_555 B C 35 1_555 B G 9 1_555 B C 34 1_555 0.382 -1.541 2.949 -2.493 16.451 33.690 -4.119 -0.855 1.979 26.473 4.012 37.468 25 BB_G51G52:C77C78_BB B 51 ? B 78 ? B 52 ? B 77 ? 1 B G 9 1_555 B C 34 1_555 B A 10 1_555 B U 33 1_555 0.028 -1.065 2.868 1.347 7.168 29.318 -3.269 0.177 2.541 13.892 -2.611 30.192 26 BB_G52A53:U76C77_BB B 52 ? B 77 ? B 53 ? B 76 ? 1 B A 10 1_555 B U 33 1_555 B A 11 1_555 B U 32 1_555 0.801 -0.424 3.447 5.479 2.506 34.903 -1.092 -0.456 3.490 4.139 -9.052 35.403 27 BB_A53A54:U75U76_BB B 53 ? B 76 ? B 54 ? B 75 ? 1 B A 11 1_555 B U 32 1_555 B G 12 1_555 B C 31 1_555 -1.753 -0.611 3.581 -19.430 39.865 36.773 -3.241 0.569 2.531 46.980 22.897 57.012 28 BB_A54G55:C74U75_BB B 54 ? B 75 ? B 55 ? B 74 ? 1 B G 12 1_555 B C 31 1_555 B A 13 1_555 B U 30 1_555 -0.907 -0.249 2.830 -3.279 3.711 37.742 -0.794 1.028 2.859 5.707 5.042 38.054 29 BB_G55A56:U73C74_BB B 55 ? B 74 ? B 56 ? B 73 ? 1 B A 13 1_555 B U 30 1_555 B A 14 1_555 B U 29 1_555 0.051 -0.613 3.750 3.056 13.399 31.135 -3.441 0.459 3.215 23.576 -5.377 33.964 30 BB_A56A57:U72U73_BB B 56 ? B 73 ? B 57 ? B 72 ? 1 B A 14 1_555 B U 29 1_555 B C 15 1_555 B G 28 1_555 0.090 -0.800 3.793 0.387 9.993 23.057 -5.120 -0.079 3.176 23.625 -0.916 25.105 31 BB_A57C58:G71U72_BB B 57 ? B 72 ? B 58 ? B 71 ? 1 B C 15 1_555 B G 28 1_555 B C 16 1_555 B G 27 1_555 1.896 -0.190 3.598 13.721 6.942 37.372 -1.216 -0.892 3.937 10.316 -20.388 40.307 32 BB_C58C59:G70G71_BB B 58 ? B 71 ? B 59 ? B 70 ? 1 B C 16 1_555 B G 27 1_555 B G 17 1_555 B U 26 1_555 -2.213 -1.302 4.579 -12.944 9.452 23.783 -5.853 0.071 4.381 20.254 27.734 28.614 33 BB_C59G60:U69G70_BB B 59 ? B 70 ? B 60 ? B 69 ? 1 B G 17 1_555 B U 26 1_555 B G 18 1_555 B U 25 1_555 0.442 -1.193 3.958 -0.738 -8.655 26.874 0.106 -1.123 4.121 -18.034 1.537 28.218 34 BB_G60G61:U68U69_BB B 60 ? B 69 ? B 61 ? B 68 ? 1 B G 18 1_555 B U 25 1_555 B G 19 1_555 B C 24 1_555 -0.219 -0.799 3.920 -1.058 -6.697 31.229 0.037 0.163 4.006 -12.259 1.936 31.938 35 BB_G61G62:C67U68_BB B 61 ? B 68 ? B 62 ? B 67 ? 1 B G 19 1_555 B C 24 1_555 B G 20 1_555 B A 23 1_555 -1.541 0.061 3.637 7.280 26.101 54.754 -1.340 1.918 3.167 26.640 -7.430 60.625 36 BB_G62G63:A66C67_BB B 62 ? B 67 ? B 63 ? B 66 ? #