data_2L88 # _entry.id 2L88 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2L88 pdb_00002l88 10.2210/pdb2l88/pdb RCSB RCSB102079 ? ? BMRB 17397 ? ? WWPDB D_1000102079 ? ? # loop_ _pdbx_database_related.content_type _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.details unspecified 2F8U PDB 'Solution structure of G-quadruplex formed in the human Bcl-2 promoter' unspecified 17397 BMRB . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2L88 _pdbx_database_status.process_site PDBJ _pdbx_database_status.recvd_initial_deposition_date 2011-01-06 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Tong, X.' 1 'Cao, C.' 2 # _citation.id primary _citation.title 'Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 39 _citation.page_first 6753 _citation.page_last 6763 _citation.year 2011 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 21540209 _citation.pdbx_database_id_DOI 10.1093/nar/gkr233 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tong, X.' 1 ? primary 'Lan, W.' 2 ? primary 'Zhang, X.' 3 ? primary 'Wu, H.' 4 ? primary 'Liu, M.' 5 ? primary 'Cao, C.' 6 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-D(*GP*GP*GP*GP*CP*GP*GP*GP*GP*CP*GP*GP*GP*GP*CP*GP*GP*GP*GP*T)-3'" _entity.formula_weight 6394.074 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details 'RET oncogene' # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code '(DG)(DG)(DG)(DG)(DC)(DG)(DG)(DG)(DG)(DC)(DG)(DG)(DG)(DG)(DC)(DG)(DG)(DG)(DG)(DT)' _entity_poly.pdbx_seq_one_letter_code_can GGGGCGGGGCGGGGCGGGGT _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DG n 1 4 DG n 1 5 DC n 1 6 DG n 1 7 DG n 1 8 DG n 1 9 DG n 1 10 DC n 1 11 DG n 1 12 DG n 1 13 DG n 1 14 DG n 1 15 DC n 1 16 DG n 1 17 DG n 1 18 DG n 1 19 DG n 1 20 DT n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2L88 _struct_ref.pdbx_db_accession 2L88 _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code GGGGCGGGGCGGGGCGGGGT _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2L88 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 20 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2L88 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 20 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 20 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 1 2 2 '2D 1H-1H TOCSY' 1 3 2 '2D 1H-13C HSQC' 1 4 2 '2D DQF-COSY' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 0.1 _pdbx_nmr_exptl_sample_conditions.pH 6.8 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '0.2-3mM potassium phosphate; 90% H2O/10% D2O' 1 '90% H2O/10% D2O' '0.2-3mM potassium phosphate; 100% D2O' 2 '100% D2O' # _pdbx_nmr_spectrometer.field_strength 600 _pdbx_nmr_spectrometer.manufacturer Varian _pdbx_nmr_spectrometer.model INOVA _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.type 'Varian INOVA' # _pdbx_nmr_refine.entry_id 2L88 _pdbx_nmr_refine.method 'DGSA-distance geometry simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2L88 _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.representative_conformer 1 _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2L88 _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.ordinal _pdbx_nmr_software.version 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' 1 2.17 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' processing NMRPipe 2 ? Goddard 'data analysis' Sparky 3 ? 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' 4 2.17 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2L88 _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2L88 _struct.title 'Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence' _struct.pdbx_model_details 'closest to the average, model 1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2L88 _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'G-quadruplex, RET, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 1 N7 ? ? ? 1_555 A DG 7 N2 ? ? A DG 1 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DG 7 N1 ? ? A DG 1 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DG 17 O6 ? ? A DG 1 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DG 17 N7 ? ? A DG 1 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DG 8 O6 ? ? A DG 2 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DG 8 N7 ? ? A DG 2 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 18 N2 ? ? A DG 2 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 18 N1 ? ? A DG 2 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 9 O6 ? ? A DG 3 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 9 N7 ? ? A DG 3 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 3 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 3 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 7 N7 ? ? ? 1_555 A DG 11 N2 ? ? A DG 7 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 7 O6 ? ? ? 1_555 A DG 11 N1 ? ? A DG 7 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 8 N1 ? ? ? 1_555 A DG 12 O6 ? ? A DG 8 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 8 N2 ? ? ? 1_555 A DG 12 N7 ? ? A DG 8 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 13 O6 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 13 N7 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 11 N7 ? ? ? 1_555 A DG 17 N2 ? ? A DG 11 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 11 O6 ? ? ? 1_555 A DG 17 N1 ? ? A DG 11 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 12 N1 ? ? ? 1_555 A DG 18 O6 ? ? A DG 12 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 12 N2 ? ? ? 1_555 A DG 18 N7 ? ? A DG 12 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 13 N1 ? ? ? 1_555 A DG 19 O6 ? ? A DG 13 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 13 N2 ? ? ? 1_555 A DG 19 N7 ? ? A DG 13 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 14 N2 ? ? ? 1_555 A DG 19 O6 ? ? A DG 14 A DG 19 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2L88 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DC 5 5 5 DC DC A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DC 10 10 10 DC DC A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DG 12 12 12 DG DG A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DC 15 15 15 DC DC A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DG 18 18 18 DG DG A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DT 20 20 20 DT DT A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2011-05-25 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2011-12-28 4 'Structure model' 1 3 2023-02-15 5 'Structure model' 1 4 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Source and taxonomy' 6 5 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_entity_src_syn 3 4 'Structure model' pdbx_nmr_software 4 5 'Structure model' pdbx_database_status # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' 4 5 'Structure model' '_pdbx_database_status.status_code_nmr_data' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'potassium phosphate-1' ? 0.2-3 mM ? 1 'potassium phosphate-2' ? 0.2-3 mM ? 2 # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.14 2 1 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.49 3 2 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.14 4 2 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.58 5 2 "O3'" A DG 16 ? ? "H3'" A DG 17 ? ? 1.58 6 2 H22 A DG 9 ? ? N3 A DC 10 ? ? 1.59 7 3 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.08 8 3 "O3'" A DG 16 ? ? "H3'" A DG 17 ? ? 1.56 9 3 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.57 10 4 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.16 11 4 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.56 12 4 "O3'" A DG 16 ? ? "H3'" A DG 17 ? ? 1.57 13 5 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.12 14 5 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.53 15 6 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.18 16 6 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.49 17 7 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.16 18 7 "O3'" A DG 16 ? ? "H3'" A DG 17 ? ? 1.57 19 7 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.58 20 8 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.08 21 8 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.51 22 9 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.11 23 9 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.50 24 10 H22 A DG 3 ? ? H42 A DC 5 ? ? 1.12 25 10 "H1'" A DG 14 ? ? O6 A DG 16 ? ? 1.55 26 10 "O3'" A DG 16 ? ? "H3'" A DG 17 ? ? 1.59 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.11 108.30 2.81 0.30 N 2 2 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.33 108.30 3.03 0.30 N 3 3 "O4'" A DG 7 ? ? "C1'" A DG 7 ? ? N9 A DG 7 ? ? 110.21 108.30 1.91 0.30 N 4 3 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.06 108.30 2.76 0.30 N 5 4 "O4'" A DG 7 ? ? "C1'" A DG 7 ? ? N9 A DG 7 ? ? 110.11 108.30 1.81 0.30 N 6 4 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.10 108.30 2.80 0.30 N 7 5 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 110.90 108.30 2.60 0.30 N 8 6 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 110.69 108.30 2.39 0.30 N 9 7 "O4'" A DG 7 ? ? "C1'" A DG 7 ? ? N9 A DG 7 ? ? 110.11 108.30 1.81 0.30 N 10 7 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.15 108.30 2.85 0.30 N 11 8 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.38 108.30 3.08 0.30 N 12 9 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.21 108.30 2.91 0.30 N 13 10 "O4'" A DG 19 ? ? "C1'" A DG 19 ? ? N9 A DG 19 ? ? 111.22 108.30 2.92 0.30 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 DG A 19 ? ? 0.071 'SIDE CHAIN' 2 2 DG A 19 ? ? 0.069 'SIDE CHAIN' 3 3 DG A 19 ? ? 0.070 'SIDE CHAIN' 4 4 DG A 19 ? ? 0.073 'SIDE CHAIN' 5 5 DG A 19 ? ? 0.070 'SIDE CHAIN' 6 6 DG A 19 ? ? 0.079 'SIDE CHAIN' 7 7 DG A 19 ? ? 0.070 'SIDE CHAIN' 8 8 DG A 19 ? ? 0.070 'SIDE CHAIN' 9 9 DG A 19 ? ? 0.075 'SIDE CHAIN' 10 10 DG A 19 ? ? 0.068 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2L88 'double helix' 2L88 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 A DG 9 1_555 1.114 3.879 0.040 -7.197 0.781 -95.692 1 A_DG3:DG9_A A 3 ? A 9 ? 6 3 1 A DG 19 1_555 A DG 13 1_555 -1.789 -3.229 0.761 -10.562 -15.080 91.699 2 A_DG19:DG13_A A 19 ? A 13 ? 6 3 1 A DG 12 1_555 A DG 18 1_555 1.972 3.696 0.099 7.578 2.220 -84.302 3 A_DG12:DG18_A A 12 ? A 18 ? 6 3 1 A DG 17 1_555 A DG 11 1_555 0.387 3.887 0.156 3.931 -6.381 -95.133 4 A_DG17:DG11_A A 17 ? A 11 ? 6 3 1 A DG 1 1_555 A DG 7 1_555 -0.403 -3.825 -0.317 -2.543 6.212 101.508 5 A_DG1:DG7_A A 1 ? A 7 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 A DG 9 1_555 A DG 19 1_555 A DG 13 1_555 1.858 3.467 -0.100 -11.795 4.974 -173.888 -1.736 0.930 -0.098 -2.490 -5.906 -173.926 1 AA_DG3DG19:DG13DG9_AA A 3 ? A 9 ? A 19 ? A 13 ? 1 A DG 19 1_555 A DG 13 1_555 A DG 12 1_555 A DG 18 1_555 -1.018 0.127 -4.158 -2.211 12.261 -23.889 3.813 -1.451 -3.840 -27.367 -4.936 -26.901 2 AA_DG19DG12:DG18DG13_AA A 19 ? A 13 ? A 12 ? A 18 ? 1 A DG 12 1_555 A DG 18 1_555 A DG 17 1_555 A DG 11 1_555 2.863 2.012 3.044 -85.598 155.933 -8.315 -2.180 0.787 -0.164 -78.827 -43.272 -177.888 3 AA_DG12DG17:DG11DG18_AA A 12 ? A 18 ? A 17 ? A 11 ? 1 A DG 17 1_555 A DG 11 1_555 A DG 1 1_555 A DG 7 1_555 1.837 3.798 0.086 5.231 1.577 -179.542 -1.899 0.919 0.085 -0.788 2.616 -179.543 4 AA_DG17DG1:DG7DG11_AA A 17 ? A 11 ? A 1 ? A 7 ? #