data_2L8H # _entry.id 2L8H # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.366 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2L8H pdb_00002l8h 10.2210/pdb2l8h/pdb RCSB RCSB102088 ? ? BMRB 17408 ? ? WWPDB D_1000102088 ? ? # _pdbx_database_related.db_id 17408 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2L8H _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2011-01-12 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Davidson, A.' 1 'Begley, D.' 2 'Lau, C.' 3 'Varani, G.' 4 # _citation.id primary _citation.title 'A Small-Molecule Probe Induces a Conformation in HIV TAR RNA Capable of Binding Drug-Like Fragments.' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 410 _citation.page_first 984 _citation.page_last 996 _citation.year 2011 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 21763501 _citation.pdbx_database_id_DOI 10.1016/j.jmb.2011.03.039 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Davidson, A.' 1 ? primary 'Begley, D.W.' 2 ? primary 'Lau, C.' 3 ? primary 'Varani, G.' 4 ? # _cell.entry_id 2L8H _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2L8H _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'HIV TAR RNA' 9307.555 1 ? ? ? ? 2 non-polymer syn ARGININE 175.209 1 ? ? ? ? 3 non-polymer syn 4-methoxynaphthalen-2-amine 173.211 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCAGAUCUGAGCCUGGGAGCUCUCUGCC _entity_poly.pdbx_seq_one_letter_code_can GGCAGAUCUGAGCCUGGGAGCUCUCUGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 A n 1 5 G n 1 6 A n 1 7 U n 1 8 C n 1 9 U n 1 10 G n 1 11 A n 1 12 G n 1 13 C n 1 14 C n 1 15 U n 1 16 G n 1 17 G n 1 18 G n 1 19 A n 1 20 G n 1 21 C n 1 22 U n 1 23 C n 1 24 U n 1 25 C n 1 26 U n 1 27 G n 1 28 C n 1 29 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details 'in vitro transcription using T7 polymerase' # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2L8H _struct_ref.pdbx_db_accession 2L8H _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2L8H _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 29 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2L8H _struct_ref_seq.db_align_beg 17 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 45 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 17 _struct_ref_seq.pdbx_auth_seq_align_end 45 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 ARG 'L-peptide linking' y ARGININE ? 'C6 H15 N4 O2 1' 175.209 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 L8H non-polymer . 4-methoxynaphthalen-2-amine ? 'C11 H11 N O' 173.211 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 2 1 1 '1H-1H NOESY' 1 2 2 '1H-1H NOESY with WATERGATE' 2 3 1 '1H-1H TOCSY' 2 4 3 HCCH-COSY 2 5 3 '13C HSQC-NOESY' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 '10 mM potassium phosphate' 6.6 ambient ? 277 K 2 '10 mM potassium phosphate' 6.6 ambient ? 298 K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '1 mM HIV TAR RNA, 4 mM Arginine 4-methoxy-napthylamide, 99.99% D2O' 1 '99.99% D2O' '1 mM HIV TAR RNA, 4 mM Arginine 4-methoxy-napthylamide, 90% H2O, 10% D2O' 2 '90% H2O/10% D2O' '1 mM [U-100% 13C; U-100% 15N] HIV TAR RNA, 4 mM Arginine 4-methoxy-napthylamide, 100% D2O' 3 '100% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 500 Bruker DRX 1 'Bruker DRX' 600 Bruker DMX 2 'Bruker DMX' # _pdbx_nmr_refine.entry_id 2L8H _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details 'RDC restraints applied after initial structure calculations' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2L8H _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2L8H _pdbx_nmr_representative.selection_criteria 'closest to the average' # _pdbx_nmr_software.authors 'Brunger A. T. et.al.' _pdbx_nmr_software.classification refinement _pdbx_nmr_software.name X-PLOR _pdbx_nmr_software.version ? _pdbx_nmr_software.ordinal 1 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details 'fragment based ligand design for HIV-1 TAR' _exptl.entry_id 2L8H _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2L8H _struct.title 'Chemical probe bound to HIV TAR RNA' _struct.pdbx_model_details 'closest to the average, model 1' _struct.pdbx_CASP_flag N _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2L8H _struct_keywords.pdbx_keywords RNA _struct_keywords.text RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale one ? B ARG . C ? ? ? 1_555 C L8H . N ? ? A ARG 1 A L8H 2 1_555 ? ? ? ? ? ? ? 1.330 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 24 N3 ? ? A A 22 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 24 O4 ? ? A A 22 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 11 N7 ? ? A U 23 A A 27 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 11 N6 ? ? A U 23 A A 27 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog19 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 10 N1 ? ? ? 1_555 A U 24 O2 ? ? A G 26 A U 40 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog23 hydrog ? ? A G 10 O6 ? ? ? 1_555 A U 24 N3 ? ? A G 26 A U 40 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog24 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A ARG 1 ? 7 'BINDING SITE FOR RESIDUE ARG A 1' AC2 Software A L8H 2 ? 5 'BINDING SITE FOR RESIDUE L8H A 2' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 7 L8H C . ? L8H A 2 . ? 1_555 ? 2 AC1 7 G A 5 ? G A 21 . ? 1_555 ? 3 AC1 7 A A 6 ? A A 22 . ? 1_555 ? 4 AC1 7 U A 7 ? U A 23 . ? 1_555 ? 5 AC1 7 A A 19 ? A A 35 . ? 1_555 ? 6 AC1 7 G A 20 ? G A 36 . ? 1_555 ? 7 AC1 7 C A 21 ? C A 37 . ? 1_555 ? 8 AC2 5 ARG B . ? ARG A 1 . ? 1_555 ? 9 AC2 5 C A 14 ? C A 30 . ? 1_555 ? 10 AC2 5 U A 15 ? U A 31 . ? 1_555 ? 11 AC2 5 A A 19 ? A A 35 . ? 1_555 ? 12 AC2 5 G A 20 ? G A 36 . ? 1_555 ? # _atom_sites.entry_id 2L8H _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 17 17 G G A . n A 1 2 G 2 18 18 G G A . n A 1 3 C 3 19 19 C C A . n A 1 4 A 4 20 20 A A A . n A 1 5 G 5 21 21 G G A . n A 1 6 A 6 22 22 A A A . n A 1 7 U 7 23 23 U U A . n A 1 8 C 8 24 24 C C A . n A 1 9 U 9 25 25 U U A . n A 1 10 G 10 26 26 G G A . n A 1 11 A 11 27 27 A A A . n A 1 12 G 12 28 28 G G A . n A 1 13 C 13 29 29 C C A . n A 1 14 C 14 30 30 C C A . n A 1 15 U 15 31 31 U U A . n A 1 16 G 16 32 32 G G A . n A 1 17 G 17 33 33 G G A . n A 1 18 G 18 34 34 G G A . n A 1 19 A 19 35 35 A A A . n A 1 20 G 20 36 36 G G A . n A 1 21 C 21 37 37 C C A . n A 1 22 U 22 38 38 U U A . n A 1 23 C 23 39 39 C C A . n A 1 24 U 24 40 40 U U A . n A 1 25 C 25 41 41 C C A . n A 1 26 U 26 42 42 U U A . n A 1 27 G 27 43 43 G G A . n A 1 28 C 28 44 44 C C A . n A 1 29 C 29 45 45 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 ARG 1 1 1 ARG ARG A . C 3 L8H 1 2 2 L8H L8H A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2011-03-23 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2011-08-03 4 'Structure model' 1 3 2023-02-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' 'Source and taxonomy' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_entity_src_syn 3 4 'Structure model' struct_conn 4 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_entity_src_syn.ncbi_taxonomy_id' 4 4 'Structure model' '_pdbx_entity_src_syn.organism_scientific' 5 4 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' 6 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 7 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 8 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'HIV TAR RNA-1' 1 ? mM ? 1 'Arginine 4-methoxy- -napthylamide-2' 4 ? mM ? 1 'HIV TAR RNA-3' 1 ? mM ? 2 'Arginine 4-methoxy- -napthylamide-4' 4 ? mM ? 2 'HIV TAR RNA-5' 1 ? mM '[U-100% 13C; U-100% 15N]' 3 'Arginine 4-methoxy- -napthylamide-6' 4 ? mM ? 3 # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "H2'" A G 32 ? ? H8 A G 33 ? ? 1.25 2 1 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.47 3 2 H8 A G 21 ? ? HH12 A ARG 1 ? ? 1.29 4 2 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.50 5 2 "HO2'" A A 35 ? ? "O5'" A G 36 ? ? 1.52 6 3 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.47 7 3 "HO2'" A G 32 ? ? "O5'" A G 33 ? ? 1.58 8 4 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.47 9 5 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.47 10 5 "HO2'" A A 35 ? ? "O5'" A G 36 ? ? 1.54 11 6 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.47 12 7 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.58 13 8 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.52 14 10 "O2'" A A 22 ? ? H6 A U 23 ? ? 1.52 15 10 "HO2'" A A 35 ? ? "O5'" A G 36 ? ? 1.53 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.41 115.20 -8.79 1.40 N 2 1 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.79 108.50 4.29 0.70 N 3 2 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.56 115.20 -8.64 1.40 N 4 2 "C5'" A C 30 ? ? "C4'" A C 30 ? ? "C3'" A C 30 ? ? 106.45 115.20 -8.75 1.40 N 5 2 "C5'" A U 31 ? ? "C4'" A U 31 ? ? "C3'" A U 31 ? ? 106.72 115.20 -8.48 1.40 N 6 2 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.83 108.50 4.33 0.70 N 7 3 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.49 115.20 -8.71 1.40 N 8 3 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.80 108.50 4.30 0.70 N 9 4 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.51 115.20 -8.69 1.40 N 10 4 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.75 108.50 4.25 0.70 N 11 5 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.26 115.20 -8.94 1.40 N 12 5 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.85 108.50 4.35 0.70 N 13 6 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.45 115.20 -8.75 1.40 N 14 6 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.82 108.50 4.32 0.70 N 15 7 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.22 115.20 -8.98 1.40 N 16 7 "C5'" A C 30 ? ? "C4'" A C 30 ? ? "C3'" A C 30 ? ? 106.64 115.20 -8.56 1.40 N 17 7 "C5'" A U 31 ? ? "C4'" A U 31 ? ? "C3'" A U 31 ? ? 106.64 115.20 -8.56 1.40 N 18 7 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.80 108.50 4.30 0.70 N 19 8 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.20 115.20 -9.00 1.40 N 20 8 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.79 108.50 4.29 0.70 N 21 9 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.44 115.20 -8.76 1.40 N 22 9 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.80 108.50 4.30 0.70 N 23 10 "C5'" A U 25 ? ? "C4'" A U 25 ? ? "C3'" A U 25 ? ? 106.41 115.20 -8.79 1.40 N 24 10 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 112.80 108.50 4.30 0.70 N # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 5 _pdbx_validate_planes.auth_comp_id C _pdbx_validate_planes.auth_asym_id A _pdbx_validate_planes.auth_seq_id 39 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.055 _pdbx_validate_planes.type 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2L8H 'a-form double helix' 2L8H 'hairpin loop' 2L8H 'bulge loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 29 1_555 -0.638 -0.215 0.270 10.933 3.534 -1.386 1 A_G17:C45_A A 17 ? A 45 ? 19 1 1 A G 2 1_555 A C 28 1_555 -0.573 -0.256 -0.264 6.386 -8.692 0.686 2 A_G18:C44_A A 18 ? A 44 ? 19 1 1 A C 3 1_555 A G 27 1_555 0.484 -0.202 0.135 -10.234 -10.471 -0.543 3 A_C19:G43_A A 19 ? A 43 ? 19 1 1 A A 4 1_555 A U 26 1_555 0.359 -0.206 0.311 -4.302 -18.813 -4.810 4 A_A20:U42_A A 20 ? A 42 ? 20 1 1 A G 5 1_555 A C 25 1_555 0.432 -0.236 0.398 1.508 -26.120 -4.003 5 A_G21:C41_A A 21 ? A 41 ? 19 1 1 A A 6 1_555 A U 24 1_555 1.227 -0.093 -0.177 6.227 -34.185 -7.032 6 A_A22:U40_A A 22 ? A 40 ? 20 1 1 A G 10 1_555 A C 23 1_555 -0.725 -0.348 -0.509 1.807 -12.455 2.612 7 A_G26:C39_A A 26 ? A 39 ? 19 1 1 A A 11 1_555 A U 22 1_555 -0.140 -0.238 0.016 -11.754 -18.807 -0.620 8 A_A27:U38_A A 27 ? A 38 ? 20 1 1 A G 12 1_555 A C 21 1_555 0.327 -0.096 0.060 -5.146 -15.121 -1.299 9 A_G28:C37_A A 28 ? A 37 ? 19 1 1 A C 13 1_555 A G 20 1_555 0.885 -0.318 -0.657 22.290 -5.467 -1.749 10 A_C29:G36_A A 29 ? A 36 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 29 1_555 A G 2 1_555 A C 28 1_555 0.131 -1.913 3.362 2.398 9.998 28.352 -5.586 0.204 2.556 19.614 -4.705 30.122 1 AA_G17G18:C44C45_AA A 17 ? A 45 ? A 18 ? A 44 ? 1 A G 2 1_555 A C 28 1_555 A C 3 1_555 A G 27 1_555 -0.171 -1.616 3.542 -1.305 16.621 36.831 -4.198 0.103 2.609 24.807 1.948 40.309 2 AA_G18C19:G43C44_AA A 18 ? A 44 ? A 19 ? A 43 ? 1 A C 3 1_555 A G 27 1_555 A A 4 1_555 A U 26 1_555 -0.210 -1.794 2.511 2.445 12.991 29.352 -4.764 0.666 1.574 24.153 -4.545 32.131 3 AA_C19A20:U42G43_AA A 19 ? A 43 ? A 20 ? A 42 ? 1 A A 4 1_555 A U 26 1_555 A G 5 1_555 A C 25 1_555 0.033 -1.637 2.743 4.076 12.908 29.627 -4.597 0.469 1.874 23.744 -7.497 32.509 4 AA_A20G21:C41U42_AA A 20 ? A 42 ? A 21 ? A 41 ? 1 A G 5 1_555 A C 25 1_555 A A 6 1_555 A U 24 1_555 -0.678 -0.614 3.025 7.868 22.448 36.041 -2.763 1.600 2.125 32.319 -11.328 42.965 5 AA_G21A22:U40C41_AA A 21 ? A 41 ? A 22 ? A 40 ? 1 A A 6 1_555 A U 24 1_555 A G 10 1_555 A C 23 1_555 -3.215 -0.528 2.301 -11.839 24.149 53.841 -1.471 2.767 2.484 24.997 12.254 59.733 6 AA_A22G26:C39U40_AA A 22 ? A 40 ? A 26 ? A 39 ? 1 A G 10 1_555 A C 23 1_555 A A 11 1_555 A U 22 1_555 -0.376 -2.031 3.711 -3.886 10.344 31.545 -5.333 -0.020 2.942 18.337 6.888 33.377 7 AA_G26A27:U38C39_AA A 26 ? A 39 ? A 27 ? A 38 ? 1 A A 11 1_555 A U 22 1_555 A G 12 1_555 A C 21 1_555 -0.231 -1.819 2.620 -0.910 12.011 30.158 -4.736 0.301 1.790 22.013 1.668 32.422 8 AA_A27G28:C37U38_AA A 27 ? A 38 ? A 28 ? A 37 ? 1 A G 12 1_555 A C 21 1_555 A C 13 1_555 A G 20 1_555 -0.228 -1.400 2.530 6.425 4.908 27.909 -3.581 1.488 2.152 9.916 -12.981 29.034 9 AA_G28C29:G36C37_AA A 28 ? A 37 ? A 29 ? A 36 ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ARGININE ARG 3 4-methoxynaphthalen-2-amine L8H #