data_2LDZ # _entry.id 2LDZ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2LDZ pdb_00002ldz 10.2210/pdb2ldz/pdb WWPDB D_1000178299 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1999-02-23 2 'Structure model' 1 1 2008-03-05 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-16 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' Other 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.process_site' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2LDZ _pdbx_database_status.recvd_initial_deposition_date 1998-08-18 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 1LDZ _pdbx_database_related.details 'ENSEMBLE OF 25 STRUCTURES' _pdbx_database_related.content_type ensemble # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Hoogstraten, C.G.' 1 'Legault, P.' 2 'Pardi, A.' 3 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'NMR solution structure of the lead-dependent ribozyme: evidence for dynamics in RNA catalysis.' J.Mol.Biol. 284 337 350 1998 JMOBAK UK 0022-2836 0070 ? 9813122 10.1006/jmbi.1998.2182 1 'Order, Dynamics and Metal-Binding in the Lead-Dependent Ribozyme' J.Mol.Biol. 284 325 ? 1998 JMOBAK UK 0022-2836 0070 ? ? ? 2 'Properties of an in Vitro Selected Pb2+ Cleavage Motif' Biochemistry 33 9561 ? 1994 BICHAW US 0006-2960 0033 ? ? ? 3 'A Small Metalloribozyme with a Two-Step Mechanism' Nature 358 560 ? 1992 NATUAS UK 0028-0836 0006 ? ? ? 4 'In Vitro Selection of Rnas that Undergo Autolytic Cleavage with Pb2+' Biochemistry 31 3887 ? 1992 BICHAW US 0006-2960 0033 ? ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Hoogstraten, C.G.' 1 ? primary 'Legault, P.' 2 ? primary 'Pardi, A.' 3 ? 1 'Legault, P.' 4 ? 1 'Hoogstraten, C.G.' 5 ? 1 'Metlitzky, E.' 6 ? 1 'Pardi, A.' 7 ? 2 'Pan, T.' 8 ? 2 'Dichtl, B.' 9 ? 2 'Uhlenbeck, O.C.' 10 ? 3 'Pan, T.' 11 ? 3 'Uhlenbeck, O.C.' 12 ? 4 'Pan, T.' 13 ? 4 'Uhlenbeck, O.C.' 14 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'LEAD-DEPENDENT RIBOZYME' _entity.formula_weight 9761.906 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details 'MOLECULE IS RNA' # _entity_name_com.entity_id 1 _entity_name_com.name LEADZYME # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GCGACCGAGCCAGCGAAAGUUGGGAGUCGC _entity_poly.pdbx_seq_one_letter_code_can GCGACCGAGCCAGCGAAAGUUGGGAGUCGC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 C n 1 3 G n 1 4 A n 1 5 C n 1 6 C n 1 7 G n 1 8 A n 1 9 G n 1 10 C n 1 11 C n 1 12 A n 1 13 G n 1 14 C n 1 15 G n 1 16 A n 1 17 A n 1 18 A n 1 19 G n 1 20 U n 1 21 U n 1 22 G n 1 23 G n 1 24 G n 1 25 A n 1 26 G n 1 27 U n 1 28 C n 1 29 G n 1 30 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'PREPARED BY IN VITRO TRANSCRIPTION FROM SYNTHETIC DNA TEMPLATE' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 C 2 2 2 C C A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 C 5 5 5 C C A . n A 1 6 C 6 6 6 C C A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 A 12 12 12 A A A . n A 1 13 G 13 13 13 G G A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 U 21 21 21 U U A . n A 1 22 G 22 22 22 G G A . n A 1 23 G 23 23 23 G G A . n A 1 24 G 24 24 24 G G A . n A 1 25 A 25 25 25 A A A . n A 1 26 G 26 26 26 G G A . n A 1 27 U 27 27 27 U U A . n A 1 28 C 28 28 28 C C A . n A 1 29 G 29 29 29 G G A . n A 1 30 C 30 30 30 C C A . n # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' 3.1 ? 1 X-PLOR refinement 3.1 ? 2 X-PLOR phasing 3.1 ? 3 # _cell.entry_id 2LDZ _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2LDZ _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 2LDZ _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 2LDZ _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 2LDZ _struct.title 'SOLUTION STRUCTURE OF THE LEAD-DEPENDENT RIBOZYME, NMR, MINIMIZED AVERAGE STRUCTURE' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2LDZ _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'CATALYTIC RNA, INTERNAL LOOPS, LEADZYME, NMR SPECTROSCOPY, RNA STRUCTURE, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2LDZ _struct_ref.pdbx_db_accession 2LDZ _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2LDZ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 30 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2LDZ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 30 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 30 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 1 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 1 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 1 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 2 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 2 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 2 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 2 N4 ? ? ? 1_555 A C 30 N3 ? ? A C 2 A C 30 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog8 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 3 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 3 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 3 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 27 N3 ? ? A A 4 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 27 O4 ? ? A A 4 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 26 N1 ? ? A C 5 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 26 O6 ? ? A C 5 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 26 N2 ? ? A C 5 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 N3 ? ? ? 1_555 A A 25 N6 ? ? A C 6 A A 25 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog17 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 10 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 10 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 10 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 21 N3 ? ? A A 12 A U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 21 O4 ? ? A A 12 A U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 N1 ? ? ? 1_555 A U 20 O2 ? ? A G 13 A U 20 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog26 hydrog ? ? A G 13 O6 ? ? ? 1_555 A U 20 N3 ? ? A G 13 A U 20 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog27 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 15 N2 ? ? ? 1_555 A A 18 N7 ? ? A G 15 A A 18 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N7 A G 1 ? ? C8 A G 1 ? ? N9 A G 1 ? ? 117.59 113.10 4.49 0.50 N 2 1 C8 A G 1 ? ? N9 A G 1 ? ? C4 A G 1 ? ? 103.76 106.40 -2.64 0.40 N 3 1 N7 A G 3 ? ? C8 A G 3 ? ? N9 A G 3 ? ? 117.65 113.10 4.55 0.50 N 4 1 C8 A G 3 ? ? N9 A G 3 ? ? C4 A G 3 ? ? 103.65 106.40 -2.75 0.40 N 5 1 N7 A A 4 ? ? C8 A A 4 ? ? N9 A A 4 ? ? 117.47 113.80 3.67 0.50 N 6 1 N7 A G 7 ? ? C8 A G 7 ? ? N9 A G 7 ? ? 117.66 113.10 4.56 0.50 N 7 1 C8 A G 7 ? ? N9 A G 7 ? ? C4 A G 7 ? ? 103.68 106.40 -2.72 0.40 N 8 1 N7 A A 8 ? ? C8 A A 8 ? ? N9 A A 8 ? ? 117.53 113.80 3.73 0.50 N 9 1 N7 A G 9 ? ? C8 A G 9 ? ? N9 A G 9 ? ? 117.63 113.10 4.53 0.50 N 10 1 C8 A G 9 ? ? N9 A G 9 ? ? C4 A G 9 ? ? 103.71 106.40 -2.69 0.40 N 11 1 N7 A A 12 ? ? C8 A A 12 ? ? N9 A A 12 ? ? 117.51 113.80 3.71 0.50 N 12 1 N7 A G 13 ? ? C8 A G 13 ? ? N9 A G 13 ? ? 117.64 113.10 4.54 0.50 N 13 1 C8 A G 13 ? ? N9 A G 13 ? ? C4 A G 13 ? ? 103.69 106.40 -2.71 0.40 N 14 1 N7 A G 15 ? ? C8 A G 15 ? ? N9 A G 15 ? ? 117.64 113.10 4.54 0.50 N 15 1 C8 A G 15 ? ? N9 A G 15 ? ? C4 A G 15 ? ? 103.71 106.40 -2.69 0.40 N 16 1 N7 A A 16 ? ? C8 A A 16 ? ? N9 A A 16 ? ? 117.51 113.80 3.71 0.50 N 17 1 N7 A A 17 ? ? C8 A A 17 ? ? N9 A A 17 ? ? 117.52 113.80 3.72 0.50 N 18 1 N7 A A 18 ? ? C8 A A 18 ? ? N9 A A 18 ? ? 117.49 113.80 3.69 0.50 N 19 1 N7 A G 19 ? ? C8 A G 19 ? ? N9 A G 19 ? ? 117.64 113.10 4.54 0.50 N 20 1 C8 A G 19 ? ? N9 A G 19 ? ? C4 A G 19 ? ? 103.72 106.40 -2.68 0.40 N 21 1 N7 A G 22 ? ? C8 A G 22 ? ? N9 A G 22 ? ? 117.63 113.10 4.53 0.50 N 22 1 C8 A G 22 ? ? N9 A G 22 ? ? C4 A G 22 ? ? 103.73 106.40 -2.67 0.40 N 23 1 N7 A G 23 ? ? C8 A G 23 ? ? N9 A G 23 ? ? 117.58 113.10 4.48 0.50 N 24 1 C8 A G 23 ? ? N9 A G 23 ? ? C4 A G 23 ? ? 103.71 106.40 -2.69 0.40 N 25 1 N7 A G 24 ? ? C8 A G 24 ? ? N9 A G 24 ? ? 117.65 113.10 4.55 0.50 N 26 1 C8 A G 24 ? ? N9 A G 24 ? ? C4 A G 24 ? ? 103.69 106.40 -2.71 0.40 N 27 1 N7 A A 25 ? ? C8 A A 25 ? ? N9 A A 25 ? ? 117.68 113.80 3.88 0.50 N 28 1 N7 A G 26 ? ? C8 A G 26 ? ? N9 A G 26 ? ? 117.69 113.10 4.59 0.50 N 29 1 C8 A G 26 ? ? N9 A G 26 ? ? C4 A G 26 ? ? 103.74 106.40 -2.66 0.40 N 30 1 N7 A G 29 ? ? C8 A G 29 ? ? N9 A G 29 ? ? 117.60 113.10 4.50 0.50 N 31 1 C8 A G 29 ? ? N9 A G 29 ? ? C4 A G 29 ? ? 103.74 106.40 -2.66 0.40 N # _pdbx_nmr_ensemble.entry_id 2LDZ _pdbx_nmr_ensemble.conformers_calculated_total_number 25 _pdbx_nmr_ensemble.conformers_submitted_total_number 1 _pdbx_nmr_ensemble.conformer_selection_criteria ;NO NOE VIOLATIONS GREATER THAN 0.3 A, NO DIHEDRAL VIOLATIONS GREATER THAN 3 DEGREES, GOOD STEREOCHEMICAL QUALITY, TOTAL ENERGY LESS THAN -120 KCAL/MOL, NOE PSEUDOENERGY LESS THAN 4 KCAL/ MOL ; # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents H2O/D2O # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 5.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength '0.1 M' _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 NOESY 1 2 1 CPMG-NOESY 1 3 1 BD-NOESY 1 4 1 CBD-NOESY 1 5 1 NOESY-HSQC 1 6 1 CBD-NOESY-HSQC 1 7 1 HMQC-NOESY-HSQC 1 8 1 HCCH-E.COSY 1 9 1 'DIRECTED HCC-TOCSY-CCH-E.COSY' 1 10 1 'SPIN-ECHO DIFFERENCE CT-HCCH-COSY' 1 # _pdbx_nmr_details.entry_id 2LDZ _pdbx_nmr_details.text ;THE STRUCTURE WAS DETERMINED FROM DISTANCE AND TORSION ANGLE RESTRAINTS DERIVED USING UNLABELED, 15N-LABELED, AND 13C, 15N-LABELED SAMPLES OF THE LEADZYME PREPARED BY IN VITRO TRANSCRIPTION. ; # _pdbx_nmr_refine.entry_id 2LDZ _pdbx_nmr_refine.method 'SIMULATED ANNEALING FROM RANDOM TORSION ANGLES' _pdbx_nmr_refine.details 'A COMPLETE SET OF REFINEMENT MACROS, ALONG WITH ASSOCIATED FILES, IS AVAILABLE UPON REQUEST TO THE AUTHORS.' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR 3.1 BRUNGER 1 'structure solution' X-PLOR 3.1 ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2LDZ 'double helix' 2LDZ 'a-form double helix' 2LDZ tetraloop 2LDZ 'mismatched base pair' 2LDZ 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 30 1_555 -0.244 -0.778 -1.885 -13.903 -12.829 7.241 1 A_G1:C30_A A 1 ? A 30 ? 19 1 1 A C 2 1_555 A G 29 1_555 -0.453 -0.084 -0.065 -31.497 9.263 -5.204 2 A_C2:G29_A A 2 ? A 29 ? 19 1 1 A G 3 1_555 A C 28 1_555 -0.431 -0.662 1.755 13.971 7.278 3.746 3 A_G3:C28_A A 3 ? A 28 ? 19 1 1 A A 4 1_555 A U 27 1_555 -0.460 -0.255 0.079 10.944 -30.972 2.813 4 A_A4:U27_A A 4 ? A 27 ? 20 1 1 A C 5 1_555 A G 26 1_555 -0.210 -0.288 0.338 8.481 -27.063 -4.881 5 A_C5:G26_A A 5 ? A 26 ? 19 1 1 A C 6 1_555 A A 25 1_555 1.713 -0.139 0.281 -2.401 -28.255 2.153 6 A_C6:A25_A A 6 ? A 25 ? ? ? 1 A C 10 1_555 A G 23 1_555 0.102 -0.130 -0.037 8.806 -21.261 -3.648 7 A_C10:G23_A A 10 ? A 23 ? 19 1 1 A C 11 1_555 A G 22 1_555 0.326 -0.106 -0.180 -5.232 -11.139 4.228 8 A_C11:G22_A A 11 ? A 22 ? 19 1 1 A A 12 1_555 A U 21 1_555 0.014 -0.180 0.747 12.293 3.223 6.460 9 A_A12:U21_A A 12 ? A 21 ? 20 1 1 A G 13 1_555 A U 20 1_555 -3.149 -0.665 -0.510 8.241 -3.411 7.671 10 A_G13:U20_A A 13 ? A 20 ? 28 ? 1 A C 14 1_555 A G 19 1_555 0.900 -0.476 -1.263 16.513 -13.713 1.909 11 A_C14:G19_A A 14 ? A 19 ? 19 1 1 A G 15 1_555 A A 18 1_555 5.633 -5.647 2.403 12.020 12.647 -18.824 12 A_G15:A18_A A 15 ? A 18 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 30 1_555 A C 2 1_555 A G 29 1_555 -1.833 -1.448 3.515 -16.697 16.676 29.523 -4.669 0.415 2.945 27.804 27.839 37.630 1 AA_G1C2:G29C30_AA A 1 ? A 30 ? A 2 ? A 29 ? 1 A C 2 1_555 A G 29 1_555 A G 3 1_555 A C 28 1_555 0.023 -2.050 1.846 -12.897 -1.583 18.275 -4.934 -2.880 1.641 -4.341 35.380 22.392 2 AA_C2G3:C28G29_AA A 2 ? A 29 ? A 3 ? A 28 ? 1 A G 3 1_555 A C 28 1_555 A A 4 1_555 A U 27 1_555 -0.092 -1.178 3.283 15.028 13.557 44.550 -2.423 1.214 2.679 16.889 -18.722 48.718 3 AA_G3A4:U27C28_AA A 3 ? A 28 ? A 4 ? A 27 ? 1 A A 4 1_555 A U 27 1_555 A C 5 1_555 A G 26 1_555 0.392 -1.344 2.959 -3.766 6.944 32.233 -3.355 -1.229 2.561 12.279 6.659 33.162 4 AA_A4C5:G26U27_AA A 4 ? A 27 ? A 5 ? A 26 ? 1 A C 5 1_555 A G 26 1_555 A C 6 1_555 A A 25 1_555 1.427 -0.946 3.145 9.376 8.325 50.593 -1.623 -1.014 3.163 9.573 -10.782 52.024 5 AA_C5C6:A25G26_AA A 5 ? A 26 ? A 6 ? A 25 ? 1 A C 10 1_555 A G 23 1_555 A C 11 1_555 A G 22 1_555 -0.698 -1.977 3.287 -0.155 16.098 35.016 -4.772 1.044 2.205 25.176 0.242 38.434 6 AA_C10C11:G22G23_AA A 10 ? A 23 ? A 11 ? A 22 ? 1 A C 11 1_555 A G 22 1_555 A A 12 1_555 A U 21 1_555 0.030 -1.695 2.536 -7.355 7.129 32.663 -3.695 -0.890 2.076 12.304 12.693 34.190 7 AA_C11A12:U21G22_AA A 11 ? A 22 ? A 12 ? A 21 ? 1 A A 12 1_555 A U 21 1_555 A G 13 1_555 A U 20 1_555 0.656 -2.554 2.993 4.064 11.744 17.636 -10.161 -0.602 1.197 33.439 -11.572 21.546 8 AA_A12G13:U20U21_AA A 12 ? A 21 ? A 13 ? A 20 ? 1 A G 13 1_555 A U 20 1_555 A C 14 1_555 A G 19 1_555 -0.602 -0.760 2.908 4.897 5.406 48.369 -1.275 1.050 2.744 6.554 -5.937 48.883 9 AA_G13C14:G19U20_AA A 13 ? A 20 ? A 14 ? A 19 ? 1 A C 14 1_555 A G 19 1_555 A G 15 1_555 A A 18 1_555 -2.419 -1.549 3.384 -10.613 33.665 49.123 -3.221 1.898 2.406 35.699 11.255 59.844 10 AA_C14G15:A18G19_AA A 14 ? A 19 ? A 15 ? A 18 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength 1 UNITYPLUS Varian 500 2 UNITYINOVA Bruker 600 3 DMX Bruker 750 # _atom_sites.entry_id 2LDZ _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ #