data_2LKR # _entry.id 2LKR # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2LKR pdb_00002lkr 10.2210/pdb2lkr/pdb RCSB RCSB102501 ? ? BMRB 17961 ? ? WWPDB D_1000102501 ? ? # loop_ _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.content_type _pdbx_database_related.details 17961 BMRB unspecified . 2LK3 PDB unspecified . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2LKR _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2011-10-19 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Burke, J.E.' 1 'Sashital, D.G.' 2 'Zuo, X.' 3 'Wang, Y.' 4 'Butcher, S.E.' 5 # _citation.id primary _citation.title 'Structure of the yeast U2/U6 snRNA complex.' _citation.journal_abbrev Rna _citation.journal_volume 18 _citation.page_first 673 _citation.page_last 683 _citation.year 2012 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 22328579 _citation.pdbx_database_id_DOI 10.1261/rna.031138.111 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Burke, J.E.' 1 ? primary 'Sashital, D.G.' 2 ? primary 'Zuo, X.' 3 ? primary 'Wang, Y.X.' 4 ? primary 'Butcher, S.E.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (111-MER)' _entity.formula_weight 35561.965 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGCAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUCUUCGGGAAUCUCUUUGC CUUUUGGCUUAGAUCAAGUGUAGUAUCUGUC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGCAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUCUUCGGGAAUCUCUUUGC CUUUUGGCUUAGAUCAAGUGUAGUAUCUGUC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 A n 1 5 A n 1 6 U n 1 7 A n 1 8 C n 1 9 A n 1 10 G n 1 11 A n 1 12 G n 1 13 A n 1 14 U n 1 15 G n 1 16 A n 1 17 U n 1 18 C n 1 19 A n 1 20 G n 1 21 C n 1 22 A n 1 23 G n 1 24 U n 1 25 U n 1 26 C n 1 27 C n 1 28 C n 1 29 C n 1 30 U n 1 31 G n 1 32 C n 1 33 A n 1 34 U n 1 35 A n 1 36 A n 1 37 G n 1 38 G n 1 39 A n 1 40 U n 1 41 G n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 G n 1 47 U n 1 48 U n 1 49 U n 1 50 U n 1 51 A n 1 52 C n 1 53 A n 1 54 A n 1 55 A n 1 56 G n 1 57 A n 1 58 G n 1 59 A n 1 60 U n 1 61 U n 1 62 U n 1 63 C n 1 64 U n 1 65 U n 1 66 C n 1 67 G n 1 68 G n 1 69 G n 1 70 A n 1 71 A n 1 72 U n 1 73 C n 1 74 U n 1 75 C n 1 76 U n 1 77 U n 1 78 U n 1 79 G n 1 80 C n 1 81 C n 1 82 U n 1 83 U n 1 84 U n 1 85 U n 1 86 G n 1 87 G n 1 88 C n 1 89 U n 1 90 U n 1 91 A n 1 92 G n 1 93 A n 1 94 U n 1 95 C n 1 96 A n 1 97 A n 1 98 G n 1 99 U n 1 100 G n 1 101 U n 1 102 A n 1 103 G n 1 104 U n 1 105 A n 1 106 U n 1 107 C n 1 108 U n 1 109 G n 1 110 U n 1 111 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type ? _entity_src_gen.pdbx_beg_seq_num ? _entity_src_gen.pdbx_end_seq_num ? _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Saccharomyces cerevisiae' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 4932 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'cell-free synthesis' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id ? _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector pUC19 _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2LKR _struct_ref.pdbx_db_accession 2LKR _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2LKR _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 111 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2LKR _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 111 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 111 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 1 2 2 '2D 1H-15N TROSY-HMQC' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 12 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 283 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '0.6-0.8 mM RNA (111-MER), 10 mM potassium phosphate, 2 mM magnesium chloride, 90% H2O/10% D2O' 1 '90% H2O/10% D2O' ;0.3-0.5 mM [U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura RNA (111-MER), 10 mM potassium phosphate, 2 mM magnesium chloride, 90% H2O/10% D2O ; 2 '90% H2O/10% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 750 Bruker DMX 1 'Bruker DMX' 700 Bruker DMX 2 'Bruker DMX' # _pdbx_nmr_refine.entry_id 2LKR _pdbx_nmr_refine.method 'molecular dynamics' _pdbx_nmr_refine.details 'Low temperature restrained molecular dynamics of MC-Sym generated models' _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2LKR _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2LKR _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' 2.21 1 Goddard 'chemical shift assignment' Sparky 3.114 2 'Bruker Biospin' processing TopSpin 2.1 3 'Parisien, Major' 'structure solution' MC-Sym 4.2.2 4 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2LKR _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2LKR _struct.title 'Yeast U2/U6 complex' _struct.pdbx_model_details 'lowest energy, model 1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2LKR _struct_keywords.pdbx_keywords RNA _struct_keywords.text '3-helix junction, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 111 N3 ? ? A G 1 A C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 111 O2 ? ? A G 1 A C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 111 N4 ? ? A G 1 A C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A U 110 O2 ? ? A G 2 A U 110 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 110 N3 ? ? A G 2 A U 110 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 109 N1 ? ? A C 3 A G 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 109 O6 ? ? A C 3 A G 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 109 N2 ? ? A C 3 A G 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 108 N3 ? ? A A 4 A U 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 108 O4 ? ? A A 4 A U 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 106 N3 ? ? A A 5 A U 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 106 O4 ? ? A A 5 A U 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 105 N1 ? ? A U 6 A A 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 105 N6 ? ? A U 6 A A 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 104 N3 ? ? A A 7 A U 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 104 O4 ? ? A A 7 A U 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 103 N1 ? ? A C 8 A G 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 103 O6 ? ? A C 8 A G 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 103 N2 ? ? A C 8 A G 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 9 N3 ? ? ? 1_555 A A 11 N6 ? ? A A 9 A A 11 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A A 9 N1 ? ? ? 1_555 A G 103 N1 ? ? A A 9 A G 103 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog22 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 96 N1 ? ? A U 14 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 96 N6 ? ? A U 14 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 95 N3 ? ? A G 15 A C 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 95 O2 ? ? A G 15 A C 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 95 N4 ? ? A G 15 A C 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 16 N1 ? ? ? 1_555 A U 94 N3 ? ? A A 16 A U 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 16 N6 ? ? ? 1_555 A U 94 O4 ? ? A A 16 A U 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 93 N1 ? ? A U 17 A A 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 93 N6 ? ? A U 17 A A 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 92 N1 ? ? A C 18 A G 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 92 O6 ? ? A C 18 A G 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 92 N2 ? ? A C 18 A G 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A A 19 N1 ? ? ? 1_555 A U 89 N3 ? ? A A 19 A U 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A A 19 N6 ? ? ? 1_555 A U 89 O4 ? ? A A 19 A U 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 88 N3 ? ? A G 20 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 88 O2 ? ? A G 20 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 88 N4 ? ? A G 20 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 87 N1 ? ? A C 21 A G 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 87 O6 ? ? A C 21 A G 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 87 N2 ? ? A C 21 A G 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 44 N3 ? ? A G 23 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 44 O2 ? ? A G 23 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 44 N4 ? ? A G 23 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 24 N3 ? ? ? 1_555 A A 43 N1 ? ? A U 24 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A U 24 O4 ? ? ? 1_555 A A 43 N6 ? ? A U 24 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 24 O4 ? ? ? 1_555 A C 44 N4 ? ? A U 24 A C 44 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog48 hydrog ? ? A U 25 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 25 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 25 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 25 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 41 N1 ? ? A C 26 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 41 O6 ? ? A C 26 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 41 N2 ? ? A C 26 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 27 N4 ? ? ? 1_555 A A 42 N3 ? ? A C 27 A A 42 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog54 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 28 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 28 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 28 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 29 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 29 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 29 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 29 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 29 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 29 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 29 O2 ? ? ? 1_555 A A 39 N6 ? ? A C 29 A A 39 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog61 hydrog ? ? A U 30 N3 ? ? ? 1_555 A A 36 N1 ? ? A U 30 A A 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A U 30 O4 ? ? ? 1_555 A A 36 N6 ? ? A U 30 A A 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 31 N3 ? ? ? 1_555 A U 34 N3 ? ? A G 31 A U 34 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog64 hydrog ? ? A G 31 N2 ? ? ? 1_555 A A 35 N7 ? ? A G 31 A A 35 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog65 hydrog ? ? A G 31 N3 ? ? ? 1_555 A A 35 N6 ? ? A G 31 A A 35 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog66 hydrog ? ? A G 31 N2 ? ? ? 1_555 A A 36 N1 ? ? A G 31 A A 36 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog67 hydrog ? ? A C 52 N3 ? ? ? 1_555 A G 79 N1 ? ? A C 52 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 52 N4 ? ? ? 1_555 A G 79 O6 ? ? A C 52 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 52 O2 ? ? ? 1_555 A G 79 N2 ? ? A C 52 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A C 52 N3 ? ? ? 1_555 A C 80 N4 ? ? A C 52 A C 80 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog71 hydrog ? ? A A 53 N1 ? ? ? 1_555 A U 78 N3 ? ? A A 53 A U 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 53 N6 ? ? ? 1_555 A U 78 O4 ? ? A A 53 A U 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A A 54 N1 ? ? ? 1_555 A U 77 N3 ? ? A A 54 A U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A A 54 N6 ? ? ? 1_555 A U 77 O4 ? ? A A 54 A U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A A 55 N1 ? ? ? 1_555 A U 76 N3 ? ? A A 55 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A A 55 N6 ? ? ? 1_555 A U 76 O4 ? ? A A 55 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A A 55 N1 ? ? ? 1_555 A U 77 N3 ? ? A A 55 A U 77 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog78 hydrog ? ? A G 56 N1 ? ? ? 1_555 A C 75 N3 ? ? A G 56 A C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 56 N2 ? ? ? 1_555 A C 75 O2 ? ? A G 56 A C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 56 O6 ? ? ? 1_555 A C 75 N4 ? ? A G 56 A C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A A 57 N1 ? ? ? 1_555 A U 74 N3 ? ? A A 57 A U 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A A 57 N6 ? ? ? 1_555 A U 74 O4 ? ? A A 57 A U 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 58 N1 ? ? ? 1_555 A C 73 N3 ? ? A G 58 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 58 N2 ? ? ? 1_555 A C 73 O2 ? ? A G 58 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A G 58 O6 ? ? ? 1_555 A C 73 N4 ? ? A G 58 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A A 59 N6 ? ? ? 1_555 A A 71 N1 ? ? A A 59 A A 71 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog87 hydrog ? ? A A 59 N1 ? ? ? 1_555 A U 72 N3 ? ? A A 59 A U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A A 59 N6 ? ? ? 1_555 A U 72 O4 ? ? A A 59 A U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A U 60 N3 ? ? ? 1_555 A A 71 N1 ? ? A U 60 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A U 60 O4 ? ? ? 1_555 A A 71 N6 ? ? A U 60 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A U 61 N3 ? ? ? 1_555 A A 70 N1 ? ? A U 61 A A 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A U 61 O4 ? ? ? 1_555 A A 70 N6 ? ? A U 61 A A 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A U 62 N3 ? ? ? 1_555 A G 69 O6 ? ? A U 62 A G 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog94 hydrog ? ? A U 62 O2 ? ? ? 1_555 A G 69 N1 ? ? A U 62 A G 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog95 hydrog ? ? A C 63 N3 ? ? ? 1_555 A G 68 N1 ? ? A C 63 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 63 N4 ? ? ? 1_555 A G 68 O6 ? ? A C 63 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 63 O2 ? ? ? 1_555 A G 68 N2 ? ? A C 63 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 63 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 63 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 63 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 63 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A C 63 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 63 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A U 64 O2 ? ? ? 1_555 A G 67 N1 ? ? A U 64 A G 67 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog102 hydrog ? ? A U 90 O2 ? ? ? 1_555 A A 91 N6 ? ? A U 90 A A 91 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2LKR _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 A 4 4 4 A A A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 U 14 14 14 U U A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 U 17 17 17 U U A . n A 1 18 C 18 18 18 C C A . n A 1 19 A 19 19 19 A A A . n A 1 20 G 20 20 20 G G A . n A 1 21 C 21 21 21 C C A . n A 1 22 A 22 22 22 A A A . n A 1 23 G 23 23 23 G G A . n A 1 24 U 24 24 24 U U A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n A 1 28 C 28 28 28 C C A . n A 1 29 C 29 29 29 C C A . n A 1 30 U 30 30 30 U U A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 A 33 33 33 A A A . n A 1 34 U 34 34 34 U U A . n A 1 35 A 35 35 35 A A A . n A 1 36 A 36 36 36 A A A . n A 1 37 G 37 37 37 G G A . n A 1 38 G 38 38 38 G G A . n A 1 39 A 39 39 39 A A A . n A 1 40 U 40 40 40 U U A . n A 1 41 G 41 41 41 G G A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 C 44 44 44 C C A . n A 1 45 C 45 45 45 C C A . n A 1 46 G 46 46 46 G G A . n A 1 47 U 47 47 47 U U A . n A 1 48 U 48 48 48 U U A . n A 1 49 U 49 49 49 U U A . n A 1 50 U 50 50 50 U U A . n A 1 51 A 51 51 51 A A A . n A 1 52 C 52 52 52 C C A . n A 1 53 A 53 53 53 A A A . n A 1 54 A 54 54 54 A A A . n A 1 55 A 55 55 55 A A A . n A 1 56 G 56 56 56 G G A . n A 1 57 A 57 57 57 A A A . n A 1 58 G 58 58 58 G G A . n A 1 59 A 59 59 59 A A A . n A 1 60 U 60 60 60 U U A . n A 1 61 U 61 61 61 U U A . n A 1 62 U 62 62 62 U U A . n A 1 63 C 63 63 63 C C A . n A 1 64 U 64 64 64 U U A . n A 1 65 U 65 65 65 U U A . n A 1 66 C 66 66 66 C C A . n A 1 67 G 67 67 67 G G A . n A 1 68 G 68 68 68 G G A . n A 1 69 G 69 69 69 G G A . n A 1 70 A 70 70 70 A A A . n A 1 71 A 71 71 71 A A A . n A 1 72 U 72 72 72 U U A . n A 1 73 C 73 73 73 C C A . n A 1 74 U 74 74 74 U U A . n A 1 75 C 75 75 75 C C A . n A 1 76 U 76 76 76 U U A . n A 1 77 U 77 77 77 U U A . n A 1 78 U 78 78 78 U U A . n A 1 79 G 79 79 79 G G A . n A 1 80 C 80 80 80 C C A . n A 1 81 C 81 81 81 C C A . n A 1 82 U 82 82 82 U U A . n A 1 83 U 83 83 83 U U A . n A 1 84 U 84 84 84 U U A . n A 1 85 U 85 85 85 U U A . n A 1 86 G 86 86 86 G G A . n A 1 87 G 87 87 87 G G A . n A 1 88 C 88 88 88 C C A . n A 1 89 U 89 89 89 U U A . n A 1 90 U 90 90 90 U U A . n A 1 91 A 91 91 91 A A A . n A 1 92 G 92 92 92 G G A . n A 1 93 A 93 93 93 A A A . n A 1 94 U 94 94 94 U U A . n A 1 95 C 95 95 95 C C A . n A 1 96 A 96 96 96 A A A . n A 1 97 A 97 97 97 A A A . n A 1 98 G 98 98 98 G G A . n A 1 99 U 99 99 99 U U A . n A 1 100 G 100 100 100 G G A . n A 1 101 U 101 101 101 U U A . n A 1 102 A 102 102 102 A A A . n A 1 103 G 103 103 103 G G A . n A 1 104 U 104 104 104 U U A . n A 1 105 A 105 105 105 A A A . n A 1 106 U 106 106 106 U U A . n A 1 107 C 107 107 107 C C A . n A 1 108 U 108 108 108 U U A . n A 1 109 G 109 109 109 G G A . n A 1 110 U 110 110 110 U U A . n A 1 111 C 111 111 111 C C A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2012-02-22 2 'Structure model' 1 1 2012-04-04 3 'Structure model' 1 2 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_database_status 3 3 'Structure model' pdbx_nmr_software # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 3 'Structure model' '_pdbx_nmr_software.name' # _pdbx_nmr_ensemble_rms.atom_type ? _pdbx_nmr_ensemble_rms.bond_angle_rms_dev ? _pdbx_nmr_ensemble_rms.bond_angle_rms_dev_error ? _pdbx_nmr_ensemble_rms.chain_range_begin ? _pdbx_nmr_ensemble_rms.chain_range_end ? _pdbx_nmr_ensemble_rms.coord_average_rmsd_method ? _pdbx_nmr_ensemble_rms.covalent_bond_rms_dev ? _pdbx_nmr_ensemble_rms.covalent_bond_rms_dev_error ? _pdbx_nmr_ensemble_rms.dihedral_angles_rms_dev ? _pdbx_nmr_ensemble_rms.dihedral_angles_rms_dev_error ? _pdbx_nmr_ensemble_rms.distance_rms_dev 0.033 _pdbx_nmr_ensemble_rms.distance_rms_dev_error 0.002 _pdbx_nmr_ensemble_rms.entry_id 2LKR _pdbx_nmr_ensemble_rms.improper_torsion_angle_rms_dev ? _pdbx_nmr_ensemble_rms.improper_torsion_angle_rms_dev_error ? _pdbx_nmr_ensemble_rms.peptide_planarity_rms_dev ? _pdbx_nmr_ensemble_rms.peptide_planarity_rms_dev_error ? _pdbx_nmr_ensemble_rms.residue_range_begin ? _pdbx_nmr_ensemble_rms.residue_range_end ? # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'RNA (111-MER)-1' ? 0.6-0.8 mM ? 1 'potassium phosphate-2' 10 ? mM ? 1 'magnesium chloride-3' 2 ? mM ? 1 'RNA (111-MER)-4' ? 0.3-0.5 mM '[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura' 2 'potassium phosphate-5' 10 ? mM ? 2 'magnesium chloride-6' 2 ? mM ? 2 # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2LKR _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count ? _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_other-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count ? _pdbx_nmr_constraints.NOE_constraints_total 818 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count ? _pdbx_nmr_constraints.NOE_long_range_total_count ? _pdbx_nmr_constraints.NOE_medium_range_total_count ? _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count ? _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 2 H22 A G 38 ? ? H62 A A 39 ? ? 1.25 2 2 H62 A A 11 ? ? H22 A G 12 ? ? 1.34 3 2 "HO2'" A A 35 ? ? "O4'" A A 36 ? ? 1.53 4 2 O2 A C 107 ? ? H5 A U 108 ? ? 1.56 5 2 "H4'" A A 9 ? ? OP1 A G 10 ? ? 1.57 6 2 "O2'" A U 40 ? ? "H5'" A G 41 ? ? 1.57 7 2 "H4'" A C 107 ? ? "O5'" A U 108 ? ? 1.58 8 3 "O2'" A C 8 ? ? "H2'" A A 9 ? ? 1.54 9 3 "O2'" A U 64 ? ? H42 A C 66 ? ? 1.57 10 4 H21 A G 10 ? ? H62 A A 11 ? ? 1.22 11 4 "H4'" A U 84 ? ? O6 A G 86 ? ? 1.52 12 5 "H1'" A A 33 ? ? OP2 A U 34 ? ? 1.44 13 5 "HO2'" A C 107 ? ? OP1 A U 108 ? ? 1.52 14 5 "HO2'" A A 35 ? ? "O4'" A A 36 ? ? 1.55 15 5 "O2'" A G 37 ? ? "H5'" A G 38 ? ? 1.56 16 5 "O2'" A U 64 ? ? H42 A C 66 ? ? 1.59 17 5 "O2'" A U 64 ? ? N4 A C 66 ? ? 2.19 18 6 H22 A G 31 ? ? H62 A A 35 ? ? 1.05 19 6 "HO2'" A G 12 ? ? H21 A G 100 ? ? 1.32 20 6 "HO2'" A A 35 ? ? "O4'" A A 36 ? ? 1.55 21 6 "H2'" A C 32 ? ? N7 A A 33 ? ? 1.58 22 6 "O2'" A C 26 ? ? H6 A C 27 ? ? 1.59 23 6 N3 A A 33 ? ? N1 A A 35 ? ? 1.76 24 7 "HO2'" A A 35 ? ? "O4'" A A 36 ? ? 1.56 25 7 "O2'" A G 37 ? ? "H5'" A G 38 ? ? 1.59 26 7 "O2'" A G 31 ? ? N1 A A 33 ? ? 1.81 27 8 H22 A G 31 ? ? H62 A A 35 ? ? 1.28 28 8 "O2'" A C 80 ? ? "H5'" A C 81 ? ? 1.49 29 8 "O2'" A U 101 ? ? H8 A A 102 ? ? 1.54 30 8 "H2'" A C 32 ? ? N7 A A 33 ? ? 1.56 31 8 "HO2'" A A 35 ? ? "O4'" A A 36 ? ? 1.56 32 8 N3 A A 33 ? ? N1 A A 35 ? ? 1.79 33 9 H22 A G 31 ? ? H62 A A 35 ? ? 1.31 34 9 "H2'" A C 32 ? ? N7 A A 33 ? ? 1.46 35 9 N3 A A 33 ? ? H61 A A 35 ? ? 1.51 36 9 "O2'" A C 26 ? ? H6 A C 27 ? ? 1.60 37 9 "O2'" A G 37 ? ? "H5'" A G 38 ? ? 1.60 38 9 N3 A A 33 ? ? N1 A A 35 ? ? 1.86 39 9 N3 A A 33 ? ? N6 A A 35 ? ? 2.07 40 10 "HO2'" A G 31 ? ? N1 A A 33 ? ? 1.46 41 10 H41 A C 8 ? ? O2 A U 104 ? ? 1.50 42 10 "HO2'" A A 35 ? ? "O4'" A A 36 ? ? 1.58 43 10 "HO2'" A C 63 ? ? "O4'" A U 64 ? ? 1.59 44 10 "O2'" A G 31 ? ? N1 A A 33 ? ? 1.98 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 N1 A C 28 ? ? C6 A C 28 ? ? 1.330 1.367 -0.037 0.006 N 2 2 "C2'" A A 33 ? ? "C1'" A A 33 ? ? 1.457 1.526 -0.069 0.008 N 3 2 "C2'" A U 34 ? ? "C1'" A U 34 ? ? 1.474 1.526 -0.052 0.008 N 4 2 N1 A U 34 ? ? C6 A U 34 ? ? 1.310 1.375 -0.065 0.009 N 5 3 C8 A A 33 ? ? N9 A A 33 ? ? 1.314 1.373 -0.059 0.008 N 6 4 N1 A C 28 ? ? C6 A C 28 ? ? 1.329 1.367 -0.038 0.006 N 7 4 C8 A A 33 ? ? N9 A A 33 ? ? 1.316 1.373 -0.057 0.008 N 8 5 N1 A C 28 ? ? C6 A C 28 ? ? 1.328 1.367 -0.039 0.006 N 9 5 "C2'" A U 34 ? ? "C1'" A U 34 ? ? 1.474 1.526 -0.052 0.008 N 10 6 N1 A C 28 ? ? C6 A C 28 ? ? 1.330 1.367 -0.037 0.006 N 11 6 C8 A G 31 ? ? N9 A G 31 ? ? 1.316 1.374 -0.058 0.007 N 12 6 N3 A A 33 ? ? C4 A A 33 ? ? 1.277 1.344 -0.067 0.006 N 13 6 C4 A A 33 ? ? C5 A A 33 ? ? 1.335 1.383 -0.048 0.007 N 14 6 C8 A A 33 ? ? N9 A A 33 ? ? 1.284 1.373 -0.089 0.008 N 15 6 C5 A A 35 ? ? C6 A A 35 ? ? 1.347 1.406 -0.059 0.009 N 16 6 N9 A A 35 ? ? C4 A A 35 ? ? 1.325 1.374 -0.049 0.006 N 17 7 N1 A C 3 ? ? C6 A C 3 ? ? 1.315 1.367 -0.052 0.006 N 18 7 "C2'" A A 33 ? ? "C1'" A A 33 ? ? 1.463 1.526 -0.063 0.008 N 19 8 N1 A C 28 ? ? C6 A C 28 ? ? 1.326 1.367 -0.041 0.006 N 20 8 C8 A G 31 ? ? N9 A G 31 ? ? 1.316 1.374 -0.058 0.007 N 21 8 N3 A A 33 ? ? C4 A A 33 ? ? 1.273 1.344 -0.071 0.006 N 22 8 C4 A A 33 ? ? C5 A A 33 ? ? 1.332 1.383 -0.051 0.007 N 23 8 C8 A A 33 ? ? N9 A A 33 ? ? 1.270 1.373 -0.103 0.008 N 24 8 C5 A A 35 ? ? C6 A A 35 ? ? 1.336 1.406 -0.070 0.009 N 25 8 N9 A A 35 ? ? C4 A A 35 ? ? 1.321 1.374 -0.053 0.006 N 26 9 N1 A C 3 ? ? C6 A C 3 ? ? 1.327 1.367 -0.040 0.006 N 27 9 N1 A C 28 ? ? C6 A C 28 ? ? 1.325 1.367 -0.042 0.006 N 28 9 N3 A A 33 ? ? C4 A A 33 ? ? 1.282 1.344 -0.062 0.006 N 29 9 C4 A A 33 ? ? C5 A A 33 ? ? 1.326 1.383 -0.057 0.007 N 30 9 C8 A A 33 ? ? N9 A A 33 ? ? 1.284 1.373 -0.089 0.008 N 31 9 C5 A A 35 ? ? C6 A A 35 ? ? 1.344 1.406 -0.062 0.009 N 32 9 N9 A A 35 ? ? C4 A A 35 ? ? 1.333 1.374 -0.041 0.006 N 33 10 C8 A G 31 ? ? N9 A G 31 ? ? 1.327 1.374 -0.047 0.007 N 34 10 "C2'" A A 33 ? ? "C1'" A A 33 ? ? 1.473 1.526 -0.053 0.008 N 35 10 N9 A A 33 ? ? C4 A A 33 ? ? 1.334 1.374 -0.040 0.006 N 36 10 "C2'" A U 74 ? ? "C1'" A U 74 ? ? 1.475 1.526 -0.051 0.008 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A C 3 ? ? "C1'" A C 3 ? ? N1 A C 3 ? ? 114.82 108.50 6.32 0.70 N 2 1 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 133.70 119.70 14.00 1.20 Y 3 1 C8 A A 4 ? ? N9 A A 4 ? ? C4 A A 4 ? ? 103.35 105.80 -2.45 0.40 N 4 1 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 128.91 119.70 9.21 1.20 Y 5 1 P A C 27 ? ? "O5'" A C 27 ? ? "C5'" A C 27 ? ? 130.68 120.90 9.78 1.60 N 6 1 "C1'" A U 34 ? ? "O4'" A U 34 ? ? "C4'" A U 34 ? ? 103.87 109.70 -5.83 0.70 N 7 1 "O4'" A U 34 ? ? "C1'" A U 34 ? ? N1 A U 34 ? ? 112.86 108.50 4.36 0.70 N 8 1 "C5'" A A 35 ? ? "C4'" A A 35 ? ? "O4'" A A 35 ? ? 118.03 109.80 8.23 0.90 N 9 1 "C1'" A A 35 ? ? "O4'" A A 35 ? ? "C4'" A A 35 ? ? 101.33 109.70 -8.37 0.70 N 10 2 "C5'" A A 35 ? ? "C4'" A A 35 ? ? "O4'" A A 35 ? ? 115.46 109.80 5.66 0.90 N 11 2 "C1'" A A 35 ? ? "O4'" A A 35 ? ? "C4'" A A 35 ? ? 102.02 109.70 -7.68 0.70 N 12 2 "O4'" A U 74 ? ? "C1'" A U 74 ? ? N1 A U 74 ? ? 115.91 108.50 7.41 0.70 N 13 2 P A C 75 ? ? "O5'" A C 75 ? ? "C5'" A C 75 ? ? 133.65 120.90 12.75 1.60 N 14 2 "O4'" A C 75 ? ? "C1'" A C 75 ? ? N1 A C 75 ? ? 113.29 108.50 4.79 0.70 N 15 3 "C1'" A C 3 ? ? "O4'" A C 3 ? ? "C4'" A C 3 ? ? 105.18 109.70 -4.52 0.70 N 16 3 "O4'" A C 3 ? ? "C1'" A C 3 ? ? N1 A C 3 ? ? 115.15 108.50 6.65 0.70 N 17 3 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 134.02 119.70 14.32 1.20 Y 18 3 "O4'" A A 4 ? ? "C1'" A A 4 ? ? N9 A A 4 ? ? 113.24 108.50 4.74 0.70 N 19 3 C8 A A 4 ? ? N9 A A 4 ? ? C4 A A 4 ? ? 103.10 105.80 -2.70 0.40 N 20 3 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 128.98 119.70 9.28 1.20 Y 21 3 P A C 27 ? ? "O5'" A C 27 ? ? "C5'" A C 27 ? ? 132.12 120.90 11.22 1.60 N 22 3 "C3'" A C 28 ? ? "C2'" A C 28 ? ? "C1'" A C 28 ? ? 106.71 101.50 5.21 0.80 N 23 3 "C1'" A A 35 ? ? "O4'" A A 35 ? ? "C4'" A A 35 ? ? 104.90 109.70 -4.80 0.70 N 24 3 "C1'" A G 67 ? ? "O4'" A G 67 ? ? "C4'" A G 67 ? ? 105.48 109.70 -4.22 0.70 N 25 4 "O4'" A C 3 ? ? "C1'" A C 3 ? ? N1 A C 3 ? ? 114.23 108.50 5.73 0.70 N 26 4 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 132.53 119.70 12.83 1.20 Y 27 4 "O4'" A A 4 ? ? "C1'" A A 4 ? ? N9 A A 4 ? ? 113.16 108.50 4.66 0.70 N 28 4 C8 A A 4 ? ? N9 A A 4 ? ? C4 A A 4 ? ? 103.06 105.80 -2.74 0.40 N 29 4 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 129.00 119.70 9.30 1.20 Y 30 4 P A C 27 ? ? "O5'" A C 27 ? ? "C5'" A C 27 ? ? 131.60 120.90 10.70 1.60 N 31 4 "C3'" A C 28 ? ? "C2'" A C 28 ? ? "C1'" A C 28 ? ? 106.67 101.50 5.17 0.80 N 32 4 "C1'" A A 35 ? ? "O4'" A A 35 ? ? "C4'" A A 35 ? ? 104.80 109.70 -4.90 0.70 N 33 5 "O4'" A C 3 ? ? "C1'" A C 3 ? ? N1 A C 3 ? ? 113.36 108.50 4.86 0.70 N 34 5 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 133.52 119.70 13.82 1.20 Y 35 5 "O4'" A A 4 ? ? "C1'" A A 4 ? ? N9 A A 4 ? ? 113.18 108.50 4.68 0.70 N 36 5 C8 A A 4 ? ? N9 A A 4 ? ? C4 A A 4 ? ? 102.87 105.80 -2.93 0.40 N 37 5 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 130.59 119.70 10.89 1.20 Y 38 5 "C3'" A C 28 ? ? "C2'" A C 28 ? ? "C1'" A C 28 ? ? 106.38 101.50 4.88 0.80 N 39 5 "O4'" A U 34 ? ? "C1'" A U 34 ? ? N1 A U 34 ? ? 114.69 108.50 6.19 0.70 N 40 5 "C1'" A A 35 ? ? "O4'" A A 35 ? ? "C4'" A A 35 ? ? 104.46 109.70 -5.24 0.70 N 41 5 "C1'" A U 84 ? ? "O4'" A U 84 ? ? "C4'" A U 84 ? ? 105.35 109.70 -4.35 0.70 N 42 6 "O4'" A C 3 ? ? "C1'" A C 3 ? ? N1 A C 3 ? ? 113.43 108.50 4.93 0.70 N 43 6 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 132.92 119.70 13.22 1.20 Y 44 6 "O4'" A A 4 ? ? "C1'" A A 4 ? ? N9 A A 4 ? ? 112.82 108.50 4.32 0.70 N 45 6 C8 A A 4 ? ? N9 A A 4 ? ? C4 A A 4 ? ? 103.22 105.80 -2.58 0.40 N 46 6 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 131.35 119.70 11.65 1.20 Y 47 6 C2 A A 33 ? ? N3 A A 33 ? ? C4 A A 33 ? ? 113.92 110.60 3.32 0.50 N 48 7 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 131.98 119.70 12.28 1.20 Y 49 7 "O4'" A A 4 ? ? "C1'" A A 4 ? ? N9 A A 4 ? ? 113.11 108.50 4.61 0.70 N 50 7 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 127.60 119.70 7.90 1.20 Y 51 7 P A C 27 ? ? "O5'" A C 27 ? ? "C5'" A C 27 ? ? 131.17 120.90 10.27 1.60 N 52 7 "C1'" A U 34 ? ? "O4'" A U 34 ? ? "C4'" A U 34 ? ? 104.99 109.70 -4.71 0.70 N 53 8 "O4'" A C 3 ? ? "C1'" A C 3 ? ? N1 A C 3 ? ? 114.39 108.50 5.89 0.70 N 54 8 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 133.21 119.70 13.51 1.20 Y 55 8 "O4'" A A 4 ? ? "C1'" A A 4 ? ? N9 A A 4 ? ? 113.05 108.50 4.55 0.70 N 56 8 C8 A A 4 ? ? N9 A A 4 ? ? C4 A A 4 ? ? 103.02 105.80 -2.78 0.40 N 57 8 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 128.60 119.70 8.90 1.20 Y 58 8 P A C 27 ? ? "O5'" A C 27 ? ? "C5'" A C 27 ? ? 131.30 120.90 10.40 1.60 N 59 8 "C3'" A C 28 ? ? "C2'" A C 28 ? ? "C1'" A C 28 ? ? 106.75 101.50 5.25 0.80 N 60 8 N9 A A 33 ? ? C4 A A 33 ? ? C5 A A 33 ? ? 108.23 105.80 2.43 0.40 N 61 9 "C3'" A C 3 ? ? "O3'" A C 3 ? ? P A A 4 ? ? 132.66 119.70 12.96 1.20 Y 62 9 "O4'" A A 4 ? ? "C1'" A A 4 ? ? N9 A A 4 ? ? 113.59 108.50 5.09 0.70 N 63 9 "C3'" A C 26 ? ? "O3'" A C 26 ? ? P A C 27 ? ? 129.98 119.70 10.28 1.20 Y 64 9 P A C 27 ? ? "O5'" A C 27 ? ? "C5'" A C 27 ? ? 131.51 120.90 10.61 1.60 N 65 9 "C3'" A C 28 ? ? "C2'" A C 28 ? ? "C1'" A C 28 ? ? 106.38 101.50 4.88 0.80 N 66 9 C2 A A 33 ? ? N3 A A 33 ? ? C4 A A 33 ? ? 113.97 110.60 3.37 0.50 N 67 9 N9 A A 33 ? ? C4 A A 33 ? ? C5 A A 33 ? ? 108.20 105.80 2.40 0.40 N 68 9 "O4'" A A 35 ? ? "C1'" A A 35 ? ? N9 A A 35 ? ? 102.81 108.20 -5.39 0.80 N 69 10 "C3'" A G 31 ? ? "C2'" A G 31 ? ? "C1'" A G 31 ? ? 106.44 101.50 4.94 0.80 N 70 10 "C3'" A U 34 ? ? "O3'" A U 34 ? ? P A A 35 ? ? 127.29 119.70 7.59 1.20 Y 71 10 "C5'" A A 35 ? ? "C4'" A A 35 ? ? "O4'" A A 35 ? ? 115.56 109.80 5.76 0.90 N 72 10 "C1'" A A 35 ? ? "O4'" A A 35 ? ? "C4'" A A 35 ? ? 101.89 109.70 -7.81 0.70 N 73 10 "O4'" A U 74 ? ? "C1'" A U 74 ? ? N1 A U 74 ? ? 117.16 108.50 8.66 0.70 N 74 10 "C3'" A U 74 ? ? "O3'" A U 74 ? ? P A C 75 ? ? 127.72 119.70 8.02 1.20 Y 75 10 P A C 75 ? ? "O5'" A C 75 ? ? "C5'" A C 75 ? ? 131.70 120.90 10.80 1.60 N 76 10 "C1'" A U 106 ? ? "O4'" A U 106 ? ? "C4'" A U 106 ? ? 105.03 109.70 -4.67 0.70 N 77 10 "C3'" A U 106 ? ? "O3'" A U 106 ? ? P A C 107 ? ? 126.96 119.70 7.26 1.20 Y # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 C A 3 ? ? 0.149 'SIDE CHAIN' 2 1 A A 35 ? ? 0.093 'SIDE CHAIN' 3 2 U A 34 ? ? 0.114 'SIDE CHAIN' 4 2 A A 35 ? ? 0.080 'SIDE CHAIN' 5 2 C A 66 ? ? 0.077 'SIDE CHAIN' 6 3 C A 3 ? ? 0.137 'SIDE CHAIN' 7 3 C A 8 ? ? 0.073 'SIDE CHAIN' 8 3 C A 27 ? ? 0.056 'SIDE CHAIN' 9 3 G A 31 ? ? 0.055 'SIDE CHAIN' 10 3 A A 35 ? ? 0.064 'SIDE CHAIN' 11 3 C A 66 ? ? 0.065 'SIDE CHAIN' 12 4 C A 3 ? ? 0.121 'SIDE CHAIN' 13 4 C A 27 ? ? 0.059 'SIDE CHAIN' 14 4 A A 35 ? ? 0.065 'SIDE CHAIN' 15 4 C A 66 ? ? 0.069 'SIDE CHAIN' 16 5 C A 3 ? ? 0.119 'SIDE CHAIN' 17 5 A A 35 ? ? 0.100 'SIDE CHAIN' 18 5 C A 66 ? ? 0.075 'SIDE CHAIN' 19 6 C A 3 ? ? 0.099 'SIDE CHAIN' 20 6 A A 35 ? ? 0.055 'SIDE CHAIN' 21 7 C A 3 ? ? 0.067 'SIDE CHAIN' 22 7 A A 35 ? ? 0.050 'SIDE CHAIN' 23 8 C A 3 ? ? 0.131 'SIDE CHAIN' 24 8 C A 27 ? ? 0.056 'SIDE CHAIN' 25 8 C A 28 ? ? 0.061 'SIDE CHAIN' 26 8 A A 35 ? ? 0.081 'SIDE CHAIN' 27 8 C A 66 ? ? 0.076 'SIDE CHAIN' 28 9 C A 3 ? ? 0.090 'SIDE CHAIN' 29 9 C A 27 ? ? 0.056 'SIDE CHAIN' 30 9 A A 35 ? ? 0.083 'SIDE CHAIN' 31 10 A A 7 ? ? 0.050 'SIDE CHAIN' 32 10 U A 34 ? ? 0.062 'SIDE CHAIN' 33 10 A A 35 ? ? 0.072 'SIDE CHAIN' 34 10 C A 75 ? ? 0.055 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2LKR 'double helix' 2LKR 'a-form double helix' 2LKR tetraloop 2LKR 'bulge loop' 2LKR 'mismatched base pair' 2LKR 'internal loop' 2LKR 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 111 1_555 -0.610 -0.164 0.011 -1.377 -0.580 -6.944 1 A_G1:C111_A A 1 ? A 111 ? 19 1 1 A G 2 1_555 A U 110 1_555 -2.567 -0.644 -0.247 4.154 26.396 -11.401 2 A_G2:U110_A A 2 ? A 110 ? 28 1 1 A C 3 1_555 A G 109 1_555 0.844 0.155 -0.254 45.469 -27.389 -7.188 3 A_C3:G109_A A 3 ? A 109 ? 19 1 1 A A 4 1_555 A U 108 1_555 -0.229 -0.555 -0.820 41.800 18.369 -13.708 4 A_A4:U108_A A 4 ? A 108 ? 20 1 1 A A 5 1_555 A U 106 1_555 0.684 -0.987 2.006 20.237 -12.209 -29.546 5 A_A5:U106_A A 5 ? A 106 ? 20 1 1 A U 6 1_555 A A 105 1_555 -0.399 -0.060 0.068 -14.630 -12.302 -0.794 6 A_U6:A105_A A 6 ? A 105 ? 20 1 1 A A 7 1_555 A U 104 1_555 0.414 0.053 -0.065 -29.670 7.632 -2.009 7 A_A7:U104_A A 7 ? A 104 ? 20 1 1 A C 8 1_555 A G 103 1_555 0.110 0.079 0.246 -45.717 -10.901 5.122 8 A_C8:G103_A A 8 ? A 103 ? 19 1 1 A A 9 1_555 A A 11 1_555 4.422 -3.314 -2.404 5.562 -3.118 -35.423 9 A_A9:A11_A A 9 ? A 11 ? ? 5 1 A U 14 1_555 A A 96 1_555 -0.137 0.136 -0.054 8.841 51.420 -18.000 10 A_U14:A96_A A 14 ? A 96 ? 20 1 1 A G 15 1_555 A C 95 1_555 0.046 -0.174 -0.853 -17.441 2.161 -10.751 11 A_G15:C95_A A 15 ? A 95 ? 19 1 1 A A 16 1_555 A U 94 1_555 0.392 -0.007 -0.158 -4.612 -1.029 3.659 12 A_A16:U94_A A 16 ? A 94 ? 20 1 1 A U 17 1_555 A A 93 1_555 -0.294 0.067 -0.107 -0.091 -0.856 -1.226 13 A_U17:A93_A A 17 ? A 93 ? 20 1 1 A C 18 1_555 A G 92 1_555 0.628 -0.204 0.104 -7.754 3.032 -1.587 14 A_C18:G92_A A 18 ? A 92 ? 19 1 1 A A 19 1_555 A U 89 1_555 0.155 0.010 -0.211 -0.811 -18.872 -0.445 15 A_A19:U89_A A 19 ? A 89 ? 20 1 1 A G 20 1_555 A C 88 1_555 -0.598 -0.251 0.045 2.698 -3.770 -3.806 16 A_G20:C88_A A 20 ? A 88 ? 19 1 1 A C 21 1_555 A G 87 1_555 0.627 -0.144 -0.596 23.581 -20.101 4.701 17 A_C21:G87_A A 21 ? A 87 ? 19 1 1 A G 23 1_555 A C 44 1_555 -0.137 -0.123 -1.360 -45.109 17.046 -7.710 18 A_G23:C44_A A 23 ? A 44 ? 19 1 1 A U 24 1_555 A A 43 1_555 0.024 -0.022 -0.564 -18.375 8.349 -23.024 19 A_U24:A43_A A 24 ? A 43 ? 20 1 1 A U 25 1_555 A A 42 1_555 0.112 -0.154 0.172 -10.133 -19.448 -3.654 20 A_U25:A42_A A 25 ? A 42 ? 20 1 1 A C 26 1_555 A G 41 1_555 0.498 -0.119 -0.270 6.245 -32.157 0.062 21 A_C26:G41_A A 26 ? A 41 ? 19 1 1 A C 28 1_555 A G 38 1_555 -1.069 -0.201 -1.191 4.801 11.012 -8.356 22 A_C28:G38_A A 28 ? A 38 ? 19 1 1 A C 29 1_555 A G 37 1_555 -0.496 0.085 -0.727 11.465 -8.697 4.041 23 A_C29:G37_A A 29 ? A 37 ? 19 1 1 A U 30 1_555 A A 36 1_555 0.164 -0.262 -0.701 -11.976 -0.184 -7.666 24 A_U30:A36_A A 30 ? A 36 ? 20 1 1 A G 31 1_555 A U 34 1_555 -1.838 -2.502 -2.449 0.130 -25.498 -127.160 25 A_G31:U34_A A 31 ? A 34 ? ? 6 1 A C 52 1_555 A G 79 1_555 0.699 -0.189 0.460 -31.333 -2.070 1.024 26 A_C52:G79_A A 52 ? A 79 ? 19 1 1 A A 53 1_555 A U 78 1_555 0.845 0.125 -0.122 -15.742 -10.565 -8.790 27 A_A53:U78_A A 53 ? A 78 ? 20 1 1 A A 54 1_555 A U 77 1_555 0.561 0.246 -0.314 -19.729 -20.875 -4.105 28 A_A54:U77_A A 54 ? A 77 ? 20 1 1 A A 55 1_555 A U 76 1_555 0.185 -0.037 -0.084 -14.539 -28.523 -0.648 29 A_A55:U76_A A 55 ? A 76 ? 20 1 1 A G 56 1_555 A C 75 1_555 -0.411 0.023 0.102 -4.530 -13.909 0.803 30 A_G56:C75_A A 56 ? A 75 ? 19 1 1 A A 57 1_555 A U 74 1_555 0.462 0.104 0.045 2.997 -11.181 -9.931 31 A_A57:U74_A A 57 ? A 74 ? 20 1 1 A G 58 1_555 A C 73 1_555 -0.300 -0.126 -0.184 3.972 -15.985 -6.083 32 A_G58:C73_A A 58 ? A 73 ? 19 1 1 A A 59 1_555 A U 72 1_555 -0.514 -0.426 0.729 -22.257 -18.960 -15.632 33 A_A59:U72_A A 59 ? A 72 ? 20 1 1 A U 60 1_555 A A 71 1_555 -0.274 -0.021 0.281 2.802 -4.369 -1.175 34 A_U60:A71_A A 60 ? A 71 ? 20 1 1 A U 61 1_555 A A 70 1_555 0.232 -0.043 -0.035 31.936 10.344 -9.642 35 A_U61:A70_A A 61 ? A 70 ? 20 1 1 A U 62 1_555 A G 69 1_555 3.088 -0.405 -0.082 -7.875 -6.035 10.875 36 A_U62:G69_A A 62 ? A 69 ? 28 1 1 A C 63 1_555 A G 68 1_555 0.716 -0.055 -0.806 22.738 -3.559 3.041 37 A_C63:G68_A A 63 ? A 68 ? 19 1 1 A U 64 1_555 A G 67 1_555 0.210 -5.006 0.442 -32.512 -12.799 -122.743 38 A_U64:G67_A A 64 ? A 67 ? ? 6 1 A U 90 1_555 A A 91 1_555 5.483 -0.824 -2.387 -11.100 -8.790 -9.435 39 A_U90:A91_A A 90 ? A 91 ? ? 9 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 111 1_555 A G 2 1_555 A U 110 1_555 -2.593 -2.864 5.776 -5.308 -55.599 -2.540 6.048 -3.052 -2.821 87.209 -8.326 -55.905 1 AA_G1G2:U110C111_AA A 1 ? A 111 ? A 2 ? A 110 ? 1 A G 2 1_555 A U 110 1_555 A C 3 1_555 A G 109 1_555 1.933 2.151 3.985 16.341 -40.826 41.737 4.409 -1.033 1.947 -45.101 -18.052 59.906 2 AA_G2C3:G109U110_AA A 2 ? A 110 ? A 3 ? A 109 ? 1 A C 3 1_555 A G 109 1_555 A A 4 1_555 A U 108 1_555 -4.392 -0.153 2.793 -5.285 68.358 41.014 -2.018 3.321 1.700 62.614 4.841 78.585 3 AA_C3A4:U108G109_AA A 3 ? A 109 ? A 4 ? A 108 ? 1 A A 5 1_555 A U 106 1_555 A U 6 1_555 A A 105 1_555 0.644 -2.235 4.414 13.698 18.088 31.713 -6.079 1.088 2.836 28.930 -21.909 38.824 4 AA_A5U6:A105U106_AA A 5 ? A 106 ? A 6 ? A 105 ? 1 A U 6 1_555 A A 105 1_555 A A 7 1_555 A U 104 1_555 0.140 -0.959 4.806 -2.463 0.224 35.222 -1.630 -0.765 4.779 0.370 4.065 35.306 5 AA_U6A7:U104A105_AA A 6 ? A 105 ? A 7 ? A 104 ? 1 A A 7 1_555 A U 104 1_555 A C 8 1_555 A G 103 1_555 0.240 -0.871 4.169 3.019 21.279 28.482 -5.170 0.138 2.869 37.276 -5.289 35.547 6 AA_A7C8:G103U104_AA A 7 ? A 104 ? A 8 ? A 103 ? 1 A C 8 1_555 A G 103 1_555 A A 9 1_555 A A 11 1_555 -1.264 2.187 3.006 7.333 12.046 55.187 1.652 1.722 3.203 12.771 -7.775 56.823 7 AA_C8A9:A11G103_AA A 8 ? A 103 ? A 9 ? A 11 ? 1 A U 14 1_555 A A 96 1_555 A G 15 1_555 A C 95 1_555 1.566 -1.840 4.478 8.416 32.517 25.202 -6.658 -1.141 1.642 52.412 -13.565 41.773 8 AA_U14G15:C95A96_AA A 14 ? A 96 ? A 15 ? A 95 ? 1 A G 15 1_555 A C 95 1_555 A A 16 1_555 A U 94 1_555 0.818 -0.485 3.265 -3.056 21.549 28.108 -3.802 -1.771 2.248 37.989 5.387 35.415 9 AA_G15A16:U94C95_AA A 15 ? A 95 ? A 16 ? A 94 ? 1 A A 16 1_555 A U 94 1_555 A U 17 1_555 A A 93 1_555 -0.525 -0.535 3.203 -2.470 27.097 21.812 -4.732 0.529 1.654 51.768 4.718 34.743 10 AA_A16U17:A93U94_AA A 16 ? A 94 ? A 17 ? A 93 ? 1 A U 17 1_555 A A 93 1_555 A C 18 1_555 A G 92 1_555 -0.349 -0.408 3.892 -4.263 23.657 31.181 -3.925 -0.078 2.916 37.776 6.808 39.188 11 AA_U17C18:G92A93_AA A 17 ? A 93 ? A 18 ? A 92 ? 1 A C 18 1_555 A G 92 1_555 A A 19 1_555 A U 89 1_555 2.409 -1.471 5.089 -29.048 44.746 40.288 -3.668 -3.717 1.249 46.609 30.258 65.948 12 AA_C18A19:U89G92_AA A 18 ? A 92 ? A 19 ? A 89 ? 1 A A 19 1_555 A U 89 1_555 A G 20 1_555 A C 88 1_555 -0.130 -1.736 3.208 -5.009 -4.055 36.684 -2.174 -0.469 3.362 -6.382 7.883 37.227 13 AA_A19G20:C88U89_AA A 19 ? A 89 ? A 20 ? A 88 ? 1 A G 23 1_555 A C 44 1_555 A U 24 1_555 A A 43 1_555 -0.680 -1.549 2.739 -0.262 13.664 27.297 -4.943 1.256 1.784 26.919 0.516 30.469 14 AA_G23U24:A43C44_AA A 23 ? A 44 ? A 24 ? A 43 ? 1 A U 24 1_555 A A 43 1_555 A U 25 1_555 A A 42 1_555 0.878 -0.528 3.732 0.103 1.284 33.313 -1.164 -1.511 3.712 2.239 -0.179 33.337 15 AA_U24U25:A42A43_AA A 24 ? A 43 ? A 25 ? A 42 ? 1 A U 25 1_555 A A 42 1_555 A C 26 1_555 A G 41 1_555 1.142 -0.545 3.185 7.970 -15.509 33.621 1.269 -0.681 3.298 -24.847 -12.769 37.757 16 AA_U25C26:G41A42_AA A 25 ? A 42 ? A 26 ? A 41 ? 1 A C 26 1_555 A G 41 1_555 A C 28 1_555 A G 38 1_555 1.861 -4.348 3.990 -20.055 42.347 72.911 -4.110 -1.800 1.273 32.627 15.452 84.876 17 AA_C26C28:G38G41_AA A 26 ? A 41 ? A 28 ? A 38 ? 1 A C 28 1_555 A G 38 1_555 A C 29 1_555 A G 37 1_555 0.407 -1.248 3.835 -2.938 -1.601 32.813 -1.879 -1.304 3.840 -2.824 5.184 32.979 18 AA_C28C29:G37G38_AA A 28 ? A 38 ? A 29 ? A 37 ? 1 A C 29 1_555 A G 37 1_555 A U 30 1_555 A A 36 1_555 -1.218 -0.034 5.228 -3.245 15.125 32.233 -3.612 1.226 4.833 25.492 5.470 35.663 19 AA_C29U30:A36G37_AA A 29 ? A 37 ? A 30 ? A 36 ? 1 A U 30 1_555 A A 36 1_555 A G 31 1_555 A U 34 1_555 2.385 0.628 4.264 -0.827 3.208 111.554 0.330 -1.454 4.264 1.940 0.500 111.587 20 AA_U30G31:U34A36_AA A 30 ? A 36 ? A 31 ? A 34 ? 1 A C 52 1_555 A G 79 1_555 A A 53 1_555 A U 78 1_555 0.319 -1.386 2.480 4.770 5.156 33.000 -3.004 0.018 2.267 8.951 -8.281 33.719 21 AA_C52A53:U78G79_AA A 52 ? A 79 ? A 53 ? A 78 ? 1 A A 53 1_555 A U 78 1_555 A A 54 1_555 A U 77 1_555 0.460 -1.677 2.994 5.941 14.010 29.925 -4.807 0.006 2.077 25.186 -10.681 33.493 22 AA_A53A54:U77U78_AA A 53 ? A 78 ? A 54 ? A 77 ? 1 A A 54 1_555 A U 77 1_555 A A 55 1_555 A U 76 1_555 0.056 -1.480 2.576 -0.568 13.566 29.091 -4.374 -0.172 1.730 25.339 1.061 32.041 23 AA_A54A55:U76U77_AA A 54 ? A 77 ? A 55 ? A 76 ? 1 A A 55 1_555 A U 76 1_555 A G 56 1_555 A C 75 1_555 0.170 -1.559 2.526 -1.426 9.720 31.017 -3.980 -0.479 1.951 17.629 2.586 32.500 24 AA_A55G56:C75U76_AA A 55 ? A 76 ? A 56 ? A 75 ? 1 A G 56 1_555 A C 75 1_555 A A 57 1_555 A U 74 1_555 -0.656 -1.313 2.578 -1.588 5.237 39.828 -2.367 0.817 2.417 7.644 2.317 40.187 25 AA_G56A57:U74C75_AA A 56 ? A 75 ? A 57 ? A 74 ? 1 A A 57 1_555 A U 74 1_555 A G 58 1_555 A C 73 1_555 -0.525 -1.653 3.206 3.133 0.245 21.852 -4.407 2.528 3.082 0.643 -8.210 22.074 26 AA_A57G58:C73U74_AA A 57 ? A 74 ? A 58 ? A 73 ? 1 A G 58 1_555 A C 73 1_555 A A 59 1_555 A U 72 1_555 -0.814 -2.071 3.868 -14.558 2.176 31.107 -3.925 -1.407 3.723 3.802 25.437 34.336 27 AA_G58A59:U72C73_AA A 58 ? A 73 ? A 59 ? A 72 ? 1 A A 59 1_555 A U 72 1_555 A U 60 1_555 A A 71 1_555 0.911 -1.487 2.551 5.304 -0.117 36.813 -2.320 -0.863 2.657 -0.184 -8.346 37.181 28 AA_A59U60:A71U72_AA A 59 ? A 72 ? A 60 ? A 71 ? 1 A U 60 1_555 A A 71 1_555 A U 61 1_555 A A 70 1_555 0.096 -1.660 2.681 -1.686 -5.634 31.452 -2.134 -0.437 2.918 -10.281 3.076 31.983 29 AA_U60U61:A70A71_AA A 60 ? A 71 ? A 61 ? A 70 ? 1 A U 61 1_555 A A 70 1_555 A U 62 1_555 A G 69 1_555 1.951 -1.332 3.931 20.102 26.190 48.750 -3.084 -0.685 3.400 28.306 -21.725 58.307 30 AA_U61U62:G69A70_AA A 61 ? A 70 ? A 62 ? A 69 ? 1 A U 62 1_555 A G 69 1_555 A C 63 1_555 A G 68 1_555 -0.508 -1.626 2.456 8.366 10.184 9.049 -9.573 4.889 0.095 43.019 -35.340 15.976 31 AA_U62C63:G68G69_AA A 62 ? A 69 ? A 63 ? A 68 ? 1 A C 63 1_555 A G 68 1_555 A U 64 1_555 A G 67 1_555 -1.575 0.325 3.843 30.032 32.702 93.596 -0.379 1.559 3.346 21.538 -19.779 101.334 32 AA_C63U64:G67G68_AA A 63 ? A 68 ? A 64 ? A 67 ? #