data_2LWK # _entry.id 2LWK # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2LWK pdb_00002lwk 10.2210/pdb2lwk/pdb RCSB RCSB102921 ? ? BMRB 18633 ? 10.13018/BMR18633 WWPDB D_1000102921 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2012-08-29 2 'Structure model' 1 1 2013-09-18 3 'Structure model' 1 2 2014-10-15 4 'Structure model' 1 3 2023-06-14 5 'Structure model' 1 4 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Structure summary' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 4 'Structure model' Other 7 5 'Structure model' 'Data collection' 8 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_nmr_software 4 4 'Structure model' struct_site 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond 7 5 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 4 'Structure model' '_pdbx_nmr_software.name' 5 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 6 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 7 4 'Structure model' '_struct_site.pdbx_auth_seq_id' 8 5 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2LWK _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2012-08-01 _pdbx_database_status.SG_entry Y _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # _pdbx_database_related.db_id 18633 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lee, M.-K.' 1 'Varani, G.' 2 'Choi, B.-S.' 3 'Pellecchia, M.' 4 'Seattle Structural Genomics Center for Infectious Disease (SSGCID)' 5 # _citation.id primary _citation.title 'A novel small-molecule binds to the influenza A virus RNA promoter and inhibits viral replication.' _citation.journal_abbrev 'Chem.Commun.(Camb.)' _citation.journal_volume 50 _citation.page_first 368 _citation.page_last 370 _citation.year 2014 _citation.journal_id_ASTM ? _citation.country UK _citation.journal_id_ISSN 1359-7345 _citation.journal_id_CSD ? _citation.book_publisher ? _citation.pdbx_database_id_PubMed 24247110 _citation.pdbx_database_id_DOI 10.1039/c3cc46973e # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lee, M.K.' 1 ? primary 'Bottini, A.' 2 ? primary 'Kim, M.' 3 ? primary 'Bardaro, M.F.' 4 ? primary 'Zhang, Z.' 5 ? primary 'Pellecchia, M.' 6 ? primary 'Choi, B.S.' 7 ? primary 'Varani, G.' 8 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (32-MER)' 10258.100 1 ? ? ? ? 2 non-polymer syn '6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine' 289.333 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GAGUAGAAACAAGGCUUCGGCCUGCUUUUGCU _entity_poly.pdbx_seq_one_letter_code_can GAGUAGAAACAAGGCUUCGGCCUGCUUUUGCU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name '6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine' _pdbx_entity_nonpoly.comp_id 0EC # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 G n 1 4 U n 1 5 A n 1 6 G n 1 7 A n 1 8 A n 1 9 A n 1 10 C n 1 11 A n 1 12 A n 1 13 G n 1 14 G n 1 15 C n 1 16 U n 1 17 U n 1 18 C n 1 19 G n 1 20 G n 1 21 C n 1 22 C n 1 23 U n 1 24 G n 1 25 C n 1 26 U n 1 27 U n 1 28 U n 1 29 U n 1 30 G n 1 31 C n 1 32 U n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 0EC non-polymer . '6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine' ? 'C14 H19 N5 O2' 289.333 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 A 2 2 2 A A A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 A 5 5 5 A A A . n A 1 6 G 6 6 6 G G A . n A 1 7 A 7 7 7 A A A . n A 1 8 A 8 8 8 A A A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 C 15 15 15 C C A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 C 25 25 25 C C A . n A 1 26 U 26 26 26 U U A . n A 1 27 U 27 27 27 U U A . n A 1 28 U 28 28 28 U U A . n A 1 29 U 29 29 29 U U A . n A 1 30 G 30 30 30 G G A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id 0EC _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 33 _pdbx_nonpoly_scheme.pdb_mon_id 0EC _pdbx_nonpoly_scheme.auth_mon_id LIG _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2LWK _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2LWK _struct.title 'Solution structure of small molecule-influenza RNA complex' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2LWK _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'double helix, RNA, Structural Genomics, Seattle Structural Genomics Center for Infectious Disease, SSGCID' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2LWK _struct_ref.pdbx_db_accession 2LWK _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2LWK _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 32 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2LWK _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 32 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 32 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 2 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A A 2 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 2 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 3 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 3 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 3 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 4 N3 ? ? ? 1_555 A G 30 O6 ? ? A U 4 A G 30 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog7 hydrog ? ? A U 4 O2 ? ? ? 1_555 A G 30 N1 ? ? A U 4 A G 30 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog8 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 5 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 5 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 6 N1 ? ? ? 1_555 A U 28 O2 ? ? A G 6 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog11 hydrog ? ? A G 6 O6 ? ? ? 1_555 A U 28 N3 ? ? A G 6 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 27 N3 ? ? A A 7 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 27 O4 ? ? A A 7 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 8 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 8 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 9 N6 ? ? ? 1_555 A C 25 N3 ? ? A A 9 A C 25 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog17 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 24 N1 ? ? A C 10 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 24 O6 ? ? A C 10 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 24 N2 ? ? A C 10 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 23 O2 ? ? A A 11 A U 23 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog21 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 13 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 13 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 13 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 14 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 14 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 14 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 15 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 15 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 15 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 16 O2 ? ? ? 1_555 A G 19 N1 ? ? A U 16 A G 19 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id 0EC _struct_site.pdbx_auth_seq_id 101 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 8 _struct_site.details 'BINDING SITE FOR RESIDUE 0EC A 101' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 8 A A 9 ? A A 9 . ? 1_555 ? 2 AC1 8 C A 10 ? C A 10 . ? 1_555 ? 3 AC1 8 A A 11 ? A A 11 . ? 1_555 ? 4 AC1 8 A A 12 ? A A 12 . ? 1_555 ? 5 AC1 8 G A 13 ? G A 13 . ? 1_555 ? 6 AC1 8 C A 22 ? C A 22 . ? 1_555 ? 7 AC1 8 U A 23 ? U A 23 . ? 1_555 ? 8 AC1 8 G A 24 ? G A 24 . ? 1_555 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H61 A A 9 ? ? H41 A C 25 ? ? 1.25 2 1 H41 A C 10 ? ? O6 A G 24 ? ? 1.44 3 2 H61 A A 9 ? ? H41 A C 25 ? ? 1.22 4 2 H41 A C 10 ? ? O6 A G 24 ? ? 1.43 5 3 H61 A A 9 ? ? H41 A C 25 ? ? 1.26 6 3 H41 A C 10 ? ? O6 A G 24 ? ? 1.41 7 3 "HO2'" A G 19 ? ? "O5'" A G 20 ? ? 1.44 8 4 H61 A A 9 ? ? H41 A C 25 ? ? 1.24 9 4 H61 A A 11 ? ? O4 A U 23 ? ? 1.41 10 4 H41 A C 10 ? ? O6 A G 24 ? ? 1.52 11 5 H61 A A 9 ? ? H41 A C 25 ? ? 1.32 12 5 H41 A C 10 ? ? O6 A G 24 ? ? 1.44 13 6 H61 A A 9 ? ? H41 A C 25 ? ? 1.31 14 6 H41 A C 10 ? ? O6 A G 24 ? ? 1.46 15 6 N3 A C 10 ? ? H1 A G 24 ? ? 1.60 16 7 H61 A A 9 ? ? H41 A C 25 ? ? 1.29 17 7 H41 A C 10 ? ? O6 A G 24 ? ? 1.47 18 7 N3 A C 10 ? ? H1 A G 24 ? ? 1.59 19 8 H61 A A 9 ? ? H41 A C 25 ? ? 1.25 20 8 H61 A A 11 ? ? O4 A U 23 ? ? 1.53 21 8 H41 A C 10 ? ? O6 A G 24 ? ? 1.57 22 9 H61 A A 9 ? ? H41 A C 25 ? ? 1.29 23 10 H61 A A 9 ? ? H41 A C 25 ? ? 1.21 24 10 H41 A C 10 ? ? O6 A G 24 ? ? 1.47 25 10 "O2'" A G 19 ? ? "H5'" A G 20 ? ? 1.59 26 10 "O2'" A C 22 ? ? "H5'" A U 23 ? ? 1.60 27 11 H61 A A 9 ? ? H41 A C 25 ? ? 1.30 28 11 H41 A C 10 ? ? O6 A G 24 ? ? 1.49 29 12 H61 A A 9 ? ? H41 A C 25 ? ? 1.30 30 12 H41 A C 10 ? ? O6 A G 24 ? ? 1.58 31 13 H61 A A 9 ? ? H41 A C 25 ? ? 1.28 32 13 H41 A C 10 ? ? O6 A G 24 ? ? 1.53 33 14 H61 A A 9 ? ? H41 A C 25 ? ? 1.28 34 14 H41 A C 10 ? ? O6 A G 24 ? ? 1.53 35 14 N3 A C 10 ? ? H1 A G 24 ? ? 1.60 36 15 H61 A A 9 ? ? H41 A C 25 ? ? 1.26 37 15 H61 A A 11 ? ? O4 A U 23 ? ? 1.41 38 15 H41 A C 10 ? ? O6 A G 24 ? ? 1.45 39 16 H61 A A 9 ? ? H41 A C 25 ? ? 1.29 40 16 H41 A C 10 ? ? O6 A G 24 ? ? 1.51 # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 10 _pdbx_validate_rmsd_bond.auth_atom_id_1 "C4'" _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 C _pdbx_validate_rmsd_bond.auth_seq_id_1 18 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 "C3'" _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 C _pdbx_validate_rmsd_bond.auth_seq_id_2 18 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.454 _pdbx_validate_rmsd_bond.bond_target_value 1.521 _pdbx_validate_rmsd_bond.bond_deviation -0.067 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.010 _pdbx_validate_rmsd_bond.linker_flag N # _pdbx_SG_project.id 1 _pdbx_SG_project.project_name ? _pdbx_SG_project.full_name_of_center 'Seattle Structural Genomics Center for Infectious Disease' _pdbx_SG_project.initial_of_center SSGCID # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 16 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2LWK _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2LWK _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '1 mM influenza A virus RNA promoter, 90% H2O, 10% D2O' 1 '90% H2O/10% D2O' '1 mM influenza A virus RNA promoter, 100% D2O' 2 '100% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'influenza A virus RNA promoter-1' 1 ? mM ? 1 'influenza A virus RNA promoter-2' 1 ? mM ? 2 # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 50 _pdbx_nmr_exptl_sample_conditions.pH 6.0 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 283 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 'H2O NOESY' 1 2 2 'D2O NOESY' # _pdbx_nmr_refine.entry_id 2LWK _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_software.authors 'C.D.Schwieters, J.J.Kuszewski, N.Tjandra and G.M.Clore' _pdbx_nmr_software.classification refinement _pdbx_nmr_software.name 'X-PLOR NIH' _pdbx_nmr_software.version ? _pdbx_nmr_software.ordinal 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 0EC C1 C Y N 1 0EC N2 N Y N 2 0EC C3 C Y N 3 0EC C4 C Y N 4 0EC C5 C Y N 5 0EC N5 N N N 6 0EC N6 N Y N 7 0EC C7 C Y N 8 0EC C8 C Y N 9 0EC O8 O N N 10 0EC C9 C Y N 11 0EC O9 O N N 12 0EC C10 C Y N 13 0EC N11 N N N 14 0EC C12 C N N 15 0EC C13 C N N 16 0EC N14 N N N 17 0EC C15 C N N 18 0EC C16 C N N 19 0EC C8A C N N 20 0EC C9A C N N 21 0EC H7 H N N 22 0EC H10 H N N 23 0EC HN14 H N N 24 0EC H12 H N N 25 0EC H12A H N N 26 0EC H13 H N N 27 0EC H13A H N N 28 0EC HN5 H N N 29 0EC H15 H N N 30 0EC HN5A H N N 31 0EC H15A H N N 32 0EC H16 H N N 33 0EC H16A H N N 34 0EC H8A H N N 35 0EC H8AA H N N 36 0EC H8AB H N N 37 0EC H9A H N N 38 0EC H9AA H N N 39 0EC H9AB H N N 40 A OP3 O N N 41 A P P N N 42 A OP1 O N N 43 A OP2 O N N 44 A "O5'" O N N 45 A "C5'" C N N 46 A "C4'" C N R 47 A "O4'" O N N 48 A "C3'" C N S 49 A "O3'" O N N 50 A "C2'" C N R 51 A "O2'" O N N 52 A "C1'" C N R 53 A N9 N Y N 54 A C8 C Y N 55 A N7 N Y N 56 A C5 C Y N 57 A C6 C Y N 58 A N6 N N N 59 A N1 N Y N 60 A C2 C Y N 61 A N3 N Y N 62 A C4 C Y N 63 A HOP3 H N N 64 A HOP2 H N N 65 A "H5'" H N N 66 A "H5''" H N N 67 A "H4'" H N N 68 A "H3'" H N N 69 A "HO3'" H N N 70 A "H2'" H N N 71 A "HO2'" H N N 72 A "H1'" H N N 73 A H8 H N N 74 A H61 H N N 75 A H62 H N N 76 A H2 H N N 77 C OP3 O N N 78 C P P N N 79 C OP1 O N N 80 C OP2 O N N 81 C "O5'" O N N 82 C "C5'" C N N 83 C "C4'" C N R 84 C "O4'" O N N 85 C "C3'" C N S 86 C "O3'" O N N 87 C "C2'" C N R 88 C "O2'" O N N 89 C "C1'" C N R 90 C N1 N N N 91 C C2 C N N 92 C O2 O N N 93 C N3 N N N 94 C C4 C N N 95 C N4 N N N 96 C C5 C N N 97 C C6 C N N 98 C HOP3 H N N 99 C HOP2 H N N 100 C "H5'" H N N 101 C "H5''" H N N 102 C "H4'" H N N 103 C "H3'" H N N 104 C "HO3'" H N N 105 C "H2'" H N N 106 C "HO2'" H N N 107 C "H1'" H N N 108 C H41 H N N 109 C H42 H N N 110 C H5 H N N 111 C H6 H N N 112 G OP3 O N N 113 G P P N N 114 G OP1 O N N 115 G OP2 O N N 116 G "O5'" O N N 117 G "C5'" C N N 118 G "C4'" C N R 119 G "O4'" O N N 120 G "C3'" C N S 121 G "O3'" O N N 122 G "C2'" C N R 123 G "O2'" O N N 124 G "C1'" C N R 125 G N9 N Y N 126 G C8 C Y N 127 G N7 N Y N 128 G C5 C Y N 129 G C6 C N N 130 G O6 O N N 131 G N1 N N N 132 G C2 C N N 133 G N2 N N N 134 G N3 N N N 135 G C4 C Y N 136 G HOP3 H N N 137 G HOP2 H N N 138 G "H5'" H N N 139 G "H5''" H N N 140 G "H4'" H N N 141 G "H3'" H N N 142 G "HO3'" H N N 143 G "H2'" H N N 144 G "HO2'" H N N 145 G "H1'" H N N 146 G H8 H N N 147 G H1 H N N 148 G H21 H N N 149 G H22 H N N 150 U OP3 O N N 151 U P P N N 152 U OP1 O N N 153 U OP2 O N N 154 U "O5'" O N N 155 U "C5'" C N N 156 U "C4'" C N R 157 U "O4'" O N N 158 U "C3'" C N S 159 U "O3'" O N N 160 U "C2'" C N R 161 U "O2'" O N N 162 U "C1'" C N R 163 U N1 N N N 164 U C2 C N N 165 U O2 O N N 166 U N3 N N N 167 U C4 C N N 168 U O4 O N N 169 U C5 C N N 170 U C6 C N N 171 U HOP3 H N N 172 U HOP2 H N N 173 U "H5'" H N N 174 U "H5''" H N N 175 U "H4'" H N N 176 U "H3'" H N N 177 U "HO3'" H N N 178 U "H2'" H N N 179 U "HO2'" H N N 180 U "H1'" H N N 181 U H3 H N N 182 U H5 H N N 183 U H6 H N N 184 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 0EC N6 C1 doub Y N 1 0EC C1 N11 sing N N 2 0EC C1 N2 sing Y N 3 0EC C3 N2 doub Y N 4 0EC C4 C3 sing Y N 5 0EC C3 C7 sing Y N 6 0EC C5 C4 doub Y N 7 0EC C10 C4 sing Y N 8 0EC N5 C5 sing N N 9 0EC C5 N6 sing Y N 10 0EC HN5A N5 sing N N 11 0EC N5 HN5 sing N N 12 0EC C8 C7 doub Y N 13 0EC C7 H7 sing N N 14 0EC C9 C8 sing Y N 15 0EC C8 O8 sing N N 16 0EC C8A O8 sing N N 17 0EC C10 C9 doub Y N 18 0EC O9 C9 sing N N 19 0EC C9A O9 sing N N 20 0EC H10 C10 sing N N 21 0EC C16 N11 sing N N 22 0EC N11 C12 sing N N 23 0EC C13 C12 sing N N 24 0EC C12 H12 sing N N 25 0EC C12 H12A sing N N 26 0EC N14 C13 sing N N 27 0EC H13 C13 sing N N 28 0EC C13 H13A sing N N 29 0EC C15 N14 sing N N 30 0EC N14 HN14 sing N N 31 0EC H15A C15 sing N N 32 0EC H15 C15 sing N N 33 0EC C15 C16 sing N N 34 0EC H16 C16 sing N N 35 0EC C16 H16A sing N N 36 0EC H8A C8A sing N N 37 0EC H8AB C8A sing N N 38 0EC C8A H8AA sing N N 39 0EC H9AB C9A sing N N 40 0EC H9AA C9A sing N N 41 0EC C9A H9A sing N N 42 A OP3 P sing N N 43 A OP3 HOP3 sing N N 44 A P OP1 doub N N 45 A P OP2 sing N N 46 A P "O5'" sing N N 47 A OP2 HOP2 sing N N 48 A "O5'" "C5'" sing N N 49 A "C5'" "C4'" sing N N 50 A "C5'" "H5'" sing N N 51 A "C5'" "H5''" sing N N 52 A "C4'" "O4'" sing N N 53 A "C4'" "C3'" sing N N 54 A "C4'" "H4'" sing N N 55 A "O4'" "C1'" sing N N 56 A "C3'" "O3'" sing N N 57 A "C3'" "C2'" sing N N 58 A "C3'" "H3'" sing N N 59 A "O3'" "HO3'" sing N N 60 A "C2'" "O2'" sing N N 61 A "C2'" "C1'" sing N N 62 A "C2'" "H2'" sing N N 63 A "O2'" "HO2'" sing N N 64 A "C1'" N9 sing N N 65 A "C1'" "H1'" sing N N 66 A N9 C8 sing Y N 67 A N9 C4 sing Y N 68 A C8 N7 doub Y N 69 A C8 H8 sing N N 70 A N7 C5 sing Y N 71 A C5 C6 sing Y N 72 A C5 C4 doub Y N 73 A C6 N6 sing N N 74 A C6 N1 doub Y N 75 A N6 H61 sing N N 76 A N6 H62 sing N N 77 A N1 C2 sing Y N 78 A C2 N3 doub Y N 79 A C2 H2 sing N N 80 A N3 C4 sing Y N 81 C OP3 P sing N N 82 C OP3 HOP3 sing N N 83 C P OP1 doub N N 84 C P OP2 sing N N 85 C P "O5'" sing N N 86 C OP2 HOP2 sing N N 87 C "O5'" "C5'" sing N N 88 C "C5'" "C4'" sing N N 89 C "C5'" "H5'" sing N N 90 C "C5'" "H5''" sing N N 91 C "C4'" "O4'" sing N N 92 C "C4'" "C3'" sing N N 93 C "C4'" "H4'" sing N N 94 C "O4'" "C1'" sing N N 95 C "C3'" "O3'" sing N N 96 C "C3'" "C2'" sing N N 97 C "C3'" "H3'" sing N N 98 C "O3'" "HO3'" sing N N 99 C "C2'" "O2'" sing N N 100 C "C2'" "C1'" sing N N 101 C "C2'" "H2'" sing N N 102 C "O2'" "HO2'" sing N N 103 C "C1'" N1 sing N N 104 C "C1'" "H1'" sing N N 105 C N1 C2 sing N N 106 C N1 C6 sing N N 107 C C2 O2 doub N N 108 C C2 N3 sing N N 109 C N3 C4 doub N N 110 C C4 N4 sing N N 111 C C4 C5 sing N N 112 C N4 H41 sing N N 113 C N4 H42 sing N N 114 C C5 C6 doub N N 115 C C5 H5 sing N N 116 C C6 H6 sing N N 117 G OP3 P sing N N 118 G OP3 HOP3 sing N N 119 G P OP1 doub N N 120 G P OP2 sing N N 121 G P "O5'" sing N N 122 G OP2 HOP2 sing N N 123 G "O5'" "C5'" sing N N 124 G "C5'" "C4'" sing N N 125 G "C5'" "H5'" sing N N 126 G "C5'" "H5''" sing N N 127 G "C4'" "O4'" sing N N 128 G "C4'" "C3'" sing N N 129 G "C4'" "H4'" sing N N 130 G "O4'" "C1'" sing N N 131 G "C3'" "O3'" sing N N 132 G "C3'" "C2'" sing N N 133 G "C3'" "H3'" sing N N 134 G "O3'" "HO3'" sing N N 135 G "C2'" "O2'" sing N N 136 G "C2'" "C1'" sing N N 137 G "C2'" "H2'" sing N N 138 G "O2'" "HO2'" sing N N 139 G "C1'" N9 sing N N 140 G "C1'" "H1'" sing N N 141 G N9 C8 sing Y N 142 G N9 C4 sing Y N 143 G C8 N7 doub Y N 144 G C8 H8 sing N N 145 G N7 C5 sing Y N 146 G C5 C6 sing N N 147 G C5 C4 doub Y N 148 G C6 O6 doub N N 149 G C6 N1 sing N N 150 G N1 C2 sing N N 151 G N1 H1 sing N N 152 G C2 N2 sing N N 153 G C2 N3 doub N N 154 G N2 H21 sing N N 155 G N2 H22 sing N N 156 G N3 C4 sing N N 157 U OP3 P sing N N 158 U OP3 HOP3 sing N N 159 U P OP1 doub N N 160 U P OP2 sing N N 161 U P "O5'" sing N N 162 U OP2 HOP2 sing N N 163 U "O5'" "C5'" sing N N 164 U "C5'" "C4'" sing N N 165 U "C5'" "H5'" sing N N 166 U "C5'" "H5''" sing N N 167 U "C4'" "O4'" sing N N 168 U "C4'" "C3'" sing N N 169 U "C4'" "H4'" sing N N 170 U "O4'" "C1'" sing N N 171 U "C3'" "O3'" sing N N 172 U "C3'" "C2'" sing N N 173 U "C3'" "H3'" sing N N 174 U "O3'" "HO3'" sing N N 175 U "C2'" "O2'" sing N N 176 U "C2'" "C1'" sing N N 177 U "C2'" "H2'" sing N N 178 U "O2'" "HO2'" sing N N 179 U "C1'" N1 sing N N 180 U "C1'" "H1'" sing N N 181 U N1 C2 sing N N 182 U N1 C6 sing N N 183 U C2 O2 doub N N 184 U C2 N3 sing N N 185 U N3 C4 sing N N 186 U N3 H3 sing N N 187 U C4 O4 doub N N 188 U C4 C5 sing N N 189 U C5 C6 doub N N 190 U C5 H5 sing N N 191 U C6 H6 sing N N 192 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2LWK 'double helix' 2LWK 'a-form double helix' 2LWK tetraloop 2LWK 'bulge loop' 2LWK 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 2 1_555 A U 32 1_555 -0.240 -0.249 0.175 -6.361 -13.878 -0.980 1 A_A2:U32_A A 2 ? A 32 ? 20 1 1 A G 3 1_555 A C 31 1_555 0.022 -0.111 0.166 -5.916 -15.846 -2.686 2 A_G3:C31_A A 3 ? A 31 ? 19 1 1 A U 4 1_555 A G 30 1_555 1.789 -0.281 0.174 -5.506 -16.118 -5.639 3 A_U4:G30_A A 4 ? A 30 ? 28 1 1 A A 5 1_555 A U 29 1_555 0.237 -0.288 0.565 -3.318 -19.737 -6.990 4 A_A5:U29_A A 5 ? A 29 ? 20 1 1 A G 6 1_555 A U 28 1_555 -1.764 -0.453 0.309 4.120 -18.615 -9.689 5 A_G6:U28_A A 6 ? A 28 ? 28 1 1 A A 7 1_555 A U 27 1_555 -0.070 -0.241 0.393 5.806 -22.047 -5.702 6 A_A7:U27_A A 7 ? A 27 ? 20 1 1 A A 8 1_555 A U 26 1_555 -0.228 -0.305 0.387 1.785 -19.776 -3.621 7 A_A8:U26_A A 8 ? A 26 ? 20 1 1 A A 9 1_555 A C 25 1_555 -0.618 -0.199 0.240 2.383 -19.757 -3.548 8 A_A9:C25_A A 9 ? A 25 ? ? ? 1 A C 10 1_555 A G 24 1_555 0.025 -0.459 0.023 4.274 -15.266 -7.439 9 A_C10:G24_A A 10 ? A 24 ? 19 1 1 A A 11 1_555 A U 23 1_555 -4.206 -0.381 0.112 9.905 -3.249 -14.880 10 A_A11:U23_A A 11 ? A 23 ? ? ? 1 A G 13 1_555 A C 22 1_555 -0.757 -0.274 -0.041 -6.009 -2.442 -2.030 11 A_G13:C22_A A 13 ? A 22 ? 19 1 1 A G 14 1_555 A C 21 1_555 0.142 -0.070 0.095 -2.252 -8.838 -2.025 12 A_G14:C21_A A 14 ? A 21 ? 19 1 1 A C 15 1_555 A G 20 1_555 0.512 -0.190 -0.034 -3.643 -8.313 -1.258 13 A_C15:G20_A A 15 ? A 20 ? 19 1 1 A U 16 1_555 A G 19 1_555 0.868 -5.516 0.445 6.119 -5.755 -121.116 14 A_U16:G19_A A 16 ? A 19 ? ? 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 2 1_555 A U 32 1_555 A G 3 1_555 A C 31 1_555 -0.043 -1.765 3.252 0.622 11.133 30.170 -4.992 0.178 2.461 20.527 -1.147 32.119 1 AA_A2G3:C31U32_AA A 2 ? A 32 ? A 3 ? A 31 ? 1 A G 3 1_555 A C 31 1_555 A U 4 1_555 A G 30 1_555 -0.021 -1.474 3.360 2.014 7.409 36.441 -3.279 0.296 3.008 11.689 -3.178 37.214 2 AA_G3U4:G30C31_AA A 3 ? A 31 ? A 4 ? A 30 ? 1 A U 4 1_555 A G 30 1_555 A A 5 1_555 A U 29 1_555 -0.122 -1.928 2.887 1.275 16.589 23.980 -6.395 0.439 1.299 35.037 -2.693 29.117 3 AA_U4A5:U29G30_AA A 4 ? A 30 ? A 5 ? A 29 ? 1 A A 5 1_555 A U 29 1_555 A G 6 1_555 A U 28 1_555 -0.007 -1.893 2.790 -1.001 11.654 22.319 -6.792 -0.193 1.614 27.787 2.387 25.163 4 AA_A5G6:U28U29_AA A 5 ? A 29 ? A 6 ? A 28 ? 1 A G 6 1_555 A U 28 1_555 A A 7 1_555 A U 27 1_555 0.239 -1.429 3.326 -1.112 6.457 36.331 -3.112 -0.525 3.028 10.252 1.766 36.897 5 AA_G6A7:U27U28_AA A 6 ? A 28 ? A 7 ? A 27 ? 1 A A 7 1_555 A U 27 1_555 A A 8 1_555 A U 26 1_555 -0.036 -1.701 3.272 -2.579 11.136 29.788 -4.949 -0.363 2.486 20.726 4.800 31.860 6 AA_A7A8:U26U27_AA A 7 ? A 27 ? A 8 ? A 26 ? 1 A A 8 1_555 A U 26 1_555 A A 9 1_555 A C 25 1_555 -0.243 -1.623 3.263 -0.916 9.450 28.958 -4.834 0.293 2.621 18.288 1.773 30.443 7 AA_A8A9:C25U26_AA A 8 ? A 26 ? A 9 ? A 25 ? 1 A A 9 1_555 A C 25 1_555 A C 10 1_555 A G 24 1_555 -0.204 -1.671 3.378 -0.932 6.776 32.188 -4.089 0.204 2.979 12.052 1.658 32.888 8 AA_A9C10:G24C25_AA A 9 ? A 25 ? A 10 ? A 24 ? 1 A C 10 1_555 A G 24 1_555 A A 11 1_555 A U 23 1_555 -0.630 -1.780 3.299 -5.255 8.024 16.781 -8.992 -0.535 2.306 25.012 16.379 19.312 9 AA_C10A11:U23G24_AA A 10 ? A 24 ? A 11 ? A 23 ? 1 A A 11 1_555 A U 23 1_555 A G 13 1_555 A C 22 1_555 -1.166 -2.626 6.396 14.477 6.355 54.755 -3.423 2.737 5.636 6.753 -15.385 56.822 10 AA_A11G13:C22U23_AA A 11 ? A 23 ? A 13 ? A 22 ? 1 A G 13 1_555 A C 22 1_555 A G 14 1_555 A C 21 1_555 0.096 -1.750 3.280 -0.293 12.220 30.064 -5.081 -0.218 2.404 22.426 0.537 32.401 11 AA_G13G14:C21C22_AA A 13 ? A 22 ? A 14 ? A 21 ? 1 A G 14 1_555 A C 21 1_555 A C 15 1_555 A G 20 1_555 0.093 -1.729 3.540 1.557 10.818 29.458 -5.218 0.118 2.750 20.409 -2.937 31.378 12 AA_G14C15:G20C21_AA A 14 ? A 21 ? A 15 ? A 20 ? 1 A C 15 1_555 A G 20 1_555 A U 16 1_555 A G 19 1_555 -2.149 -0.627 3.032 3.675 9.522 92.319 -0.596 1.547 2.906 6.585 -2.541 92.754 13 AA_C15U16:G19G20_AA A 15 ? A 20 ? A 16 ? A 19 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 500 Bruker DRX 1 'Bruker DRX' 600 Bruker DRX 2 'Bruker DRX' 750 Bruker DRX 3 ? # _atom_sites.entry_id 2LWK _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ #