data_2MAY # _entry.id 2MAY # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2MAY pdb_00002may 10.2210/pdb2may/pdb RCSB RCSB103425 ? ? BMRB 19381 ? ? WWPDB D_1000103425 ? ? # _pdbx_database_related.db_id 19381 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2MAY _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2013-07-22 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lech, C.' 1 'Heddi, B.' 2 'Adrian, M.' 3 'Li, Z.' 4 'Phan, A.T.' 5 # _citation.id primary _citation.title 'Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes' _citation.journal_abbrev 'To be Published' _citation.journal_volume ? _citation.page_first ? _citation.page_last ? _citation.year ? _citation.journal_id_ASTM ? _citation.country ? _citation.journal_id_ISSN ? _citation.journal_id_CSD 0353 _citation.book_publisher ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_DOI ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Li, Z.' 1 ? primary 'Lech, C.' 2 ? primary 'Adrian, M.' 3 ? primary 'Heddi, B.' 4 ? primary 'Phan, A.T.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "DNA_(5'-D(*TP*TP*GP*LGP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')" _entity.formula_weight 7619.893 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(DT)(DT)(DG)(LCG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT) (DA)(DG)(DG)(DG)(DA) ; _entity_poly.pdbx_seq_one_letter_code_can TTGGGTTAGGGTTAGGGTTAGGGA _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DT n 1 2 DT n 1 3 DG n 1 4 LCG n 1 5 DG n 1 6 DT n 1 7 DT n 1 8 DA n 1 9 DG n 1 10 DG n 1 11 DG n 1 12 DT n 1 13 DT n 1 14 DA n 1 15 DG n 1 16 DG n 1 17 DG n 1 18 DT n 1 19 DT n 1 20 DA n 1 21 DG n 1 22 DG n 1 23 DG n 1 24 DA n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2MAY _struct_ref.pdbx_db_accession 2MAY _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code TTGGGTTAGGGTTAGGGTTAGGGA _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2MAY _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 24 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2MAY _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 24 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 24 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 LCG 'RNA linking' n '[(1R,3R,4R,7S)-7-HYDROXY-3-(GUANIN-9-YL)-2,5-DIOXABICYCLO[2.2.1]HEPT-1-YL]METHYL DIHYDROGEN PHOSPHATE' ? 'C11 H14 N5 O8 P' 375.231 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 1 2 2 '2D 1H-1H NOESY' 1 3 1 '2D 1H-13C HSQC' 1 4 2 '2D 1H-1H TOCSY' 1 5 2 '2D 1H-1H COSY' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 30 _pdbx_nmr_exptl_sample_conditions.pH 7 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system ;1.5 mM DNA (5'-D(*TP*TP*GP*LGP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'), 20 uM DSS, 20 mM potassium phosphate, 90% H2O/10% D2O ; 1 '90% H2O/10% D2O' ;1.5 mM DNA (5'-D(*TP*TP*GP*LGP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3'), 20 uM DSS, 20 mM potassium phosphate, 100% D2O ; 2 '100% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker AVANCE 1 'Bruker Avance' 700 Bruker AVANCE 2 'Bruker Avance' # _pdbx_nmr_refine.entry_id 2MAY _pdbx_nmr_refine.method 'DGSA-distance geometry simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2MAY _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2MAY _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' ? 1 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 2 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2MAY _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2MAY _struct.title 'Structure of a G-quadruplex containing a single LNA modification' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2MAY _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'G-quadruplex, LNA modification, Backbone, loop, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A DG 3 "O3'" ? ? ? 1_555 A LCG 4 P ? ? A DG 3 A LCG 4 1_555 ? ? ? ? ? ? ? 1.614 ? ? covale2 covale both ? A LCG 4 "O3'" ? ? ? 1_555 A DG 5 P ? ? A LCG 4 A DG 5 1_555 ? ? ? ? ? ? ? 1.619 ? ? hydrog1 hydrog ? ? A DT 1 N3 ? ? ? 1_555 A DA 20 N1 ? ? A DT 1 A DA 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DT 1 O4 ? ? ? 1_555 A DA 20 N6 ? ? A DT 1 A DA 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 9 N2 ? ? A DG 3 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 9 N1 ? ? A DG 3 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 3 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 3 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A LCG 4 N1 ? ? ? 1_555 A DG 10 O6 ? ? A LCG 4 A DG 10 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A LCG 4 N2 ? ? ? 1_555 A DG 10 N7 ? ? A LCG 4 A DG 10 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A LCG 4 N7 ? ? ? 1_555 A DG 22 N2 ? ? A LCG 4 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A LCG 4 O6 ? ? ? 1_555 A DG 22 N1 ? ? A LCG 4 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A LCG 4 N7 ? ? ? 1_555 A DG 23 N2 ? ? A LCG 4 A DG 23 1_555 ? ? ? ? ? ? 'LCG-DG MISPAIR' ? ? ? hydrog12 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 11 O6 ? ? A DG 5 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 11 N7 ? ? A DG 5 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 23 N2 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 23 N1 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 9 N7 ? ? ? 1_555 A DG 17 N2 ? ? A DG 9 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 9 O6 ? ? ? 1_555 A DG 17 N1 ? ? A DG 9 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 10 N1 ? ? ? 1_555 A DG 16 O6 ? ? A DG 10 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 10 N2 ? ? ? 1_555 A DG 16 N7 ? ? A DG 10 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 11 N1 ? ? ? 1_555 A DG 15 O6 ? ? A DG 11 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DG 15 N7 ? ? A DG 11 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DT 13 N3 ? ? ? 1_555 A DA 24 N1 ? ? A DT 13 A DA 24 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog23 hydrog ? ? A DT 13 O2 ? ? ? 1_555 A DA 24 N6 ? ? A DT 13 A DA 24 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog24 hydrog ? ? A DG 15 N1 ? ? ? 1_555 A DG 23 O6 ? ? A DG 15 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 15 N2 ? ? ? 1_555 A DG 23 N7 ? ? A DG 15 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 16 N1 ? ? ? 1_555 A DG 22 O6 ? ? A DG 16 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 16 N2 ? ? ? 1_555 A DG 22 N7 ? ? A DG 16 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 17 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 17 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog29 hydrog ? ? A DG 17 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 17 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _atom_sites.entry_id 2MAY _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DT 1 1 1 DT DT A . n A 1 2 DT 2 2 2 DT DT A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 LCG 4 4 4 LCG LG A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DT 6 6 6 DT DT A . n A 1 7 DT 7 7 7 DT DT A . n A 1 8 DA 8 8 8 DA DA A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DT 12 12 12 DT DT A . n A 1 13 DT 13 13 13 DT DT A . n A 1 14 DA 14 14 14 DA DA A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DT 18 18 18 DT DT A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DA 20 20 20 DA DA A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DG 22 22 22 DG DG A . n A 1 23 DG 23 23 23 DG DG A . n A 1 24 DA 24 24 24 DA DA A . n # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id LCG _pdbx_struct_mod_residue.label_seq_id 4 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id LCG _pdbx_struct_mod_residue.auth_seq_id 4 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id DG _pdbx_struct_mod_residue.details ? # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2015-02-04 2 'Structure model' 1 1 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 2 'Structure model' 'Derived calculations' 4 2 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' database_2 2 2 'Structure model' pdbx_database_status 3 2 'Structure model' pdbx_nmr_software 4 2 'Structure model' pdbx_nmr_spectrometer 5 2 'Structure model' struct_conn # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' 3 2 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 2 'Structure model' '_pdbx_nmr_software.name' 5 2 'Structure model' '_pdbx_nmr_spectrometer.model' 6 2 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id ;DNA (5'-D(*TP*TP*GP*LGP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')-1 ; 1.5 ? mM ? 1 DSS-2 20 ? uM ? 1 'potassium phosphate-3' 20 ? mM ? 1 ;DNA (5'-D(*TP*TP*GP*LGP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')-4 ; 1.5 ? mM ? 2 DSS-5 20 ? uM ? 2 'potassium phosphate-6' 20 ? mM ? 2 # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2MAY _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count 56 _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_other-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count ? _pdbx_nmr_constraints.NOE_constraints_total 521 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count 330 _pdbx_nmr_constraints.NOE_long_range_total_count 76 _pdbx_nmr_constraints.NOE_medium_range_total_count ? _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count 115 _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 2 "H4'" A DA 14 ? ? "O4'" A DG 15 ? ? 1.52 2 2 "H1'" A DG 11 ? ? "O3'" A DT 12 ? ? 1.54 3 2 "O2'" A LCG 4 ? ? H71 A DT 7 ? ? 1.59 4 5 "H4'" A DG 5 ? ? "O5'" A DT 6 ? ? 1.54 5 5 OP2 A DT 2 ? ? H2 A DA 8 ? ? 1.56 6 5 H72 A DT 1 ? ? "O4'" A DG 9 ? ? 1.57 7 6 "H4'" A DA 14 ? ? "O5'" A DG 15 ? ? 1.58 8 7 "O2'" A LCG 4 ? ? H73 A DT 7 ? ? 1.57 9 8 H72 A DT 1 ? ? "O4'" A DG 9 ? ? 1.50 10 9 "H1'" A DG 11 ? ? "O3'" A DT 12 ? ? 1.56 11 10 OP1 A DT 2 ? ? H2 A DA 8 ? ? 1.59 # _ndb_struct_conf_na.entry_id 2MAY _ndb_struct_conf_na.feature 'quadruple helix' #