data_2NC0 # _entry.id 2NC0 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_code _database_2.database_id _database_2.pdbx_database_accession _database_2.pdbx_DOI RCSB104677 RCSB ? ? 2NC0 PDB pdb_00002nc0 10.2210/pdb2nc0/pdb 25999 BMRB ? 10.13018/BMR25999 D_1000104677 WWPDB ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2016-08-10 2 'Structure model' 1 1 2017-11-15 3 'Structure model' 1 2 2023-06-14 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' Other 5 4 'Structure model' 'Data collection' 6 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' pdbx_database_related 2 3 'Structure model' database_2 3 3 'Structure model' pdbx_database_status 4 3 'Structure model' pdbx_nmr_software 5 3 'Structure model' pdbx_nmr_spectrometer 6 4 'Structure model' chem_comp_atom 7 4 'Structure model' chem_comp_bond 8 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_pdbx_database_related.db_id' 2 2 'Structure model' '_pdbx_database_related.db_name' 3 3 'Structure model' '_database_2.pdbx_DOI' 4 3 'Structure model' '_database_2.pdbx_database_accession' 5 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 6 3 'Structure model' '_pdbx_nmr_software.name' 7 3 'Structure model' '_pdbx_nmr_spectrometer.model' 8 4 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2NC0 _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2016-03-16 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.content_type _pdbx_database_related.details 25999 BMRB unspecified . 2NBX PDB unspecified . 2NBY PDB unspecified . 2NBZ PDB unspecified . 2NC1 PDB unspecified . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Imai, S.' 1 ;D'Souza, V. ; 2 'Wagner, G.' 3 # _citation.id primary _citation.title 'An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation.' _citation.journal_abbrev 'Nat. Struct. Mol. Biol.' _citation.journal_volume 23 _citation.page_first 859 _citation.page_last 864 _citation.year 2016 _citation.journal_id_ASTM ? _citation.country US _citation.journal_id_ISSN 1545-9985 _citation.journal_id_CSD ? _citation.book_publisher ? _citation.pdbx_database_id_PubMed 27525590 _citation.pdbx_database_id_DOI 10.1038/nsmb.3280 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Imai, S.' 1 ? primary 'Kumar, P.' 2 ? primary 'Hellen, C.U.' 3 ? primary ;D'Souza, V.M. ; 4 ? primary 'Wagner, G.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'IRES RNA (28-MER)' _entity.formula_weight 9128.503 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGCUGAAGGAUGGAGACGUCUAGGCCC _entity_poly.pdbx_seq_one_letter_code_can GGGCUGAAGGAUGGAGACGUCUAGGCCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 C n 1 5 U n 1 6 G n 1 7 A n 1 8 A n 1 9 G n 1 10 G n 1 11 A n 1 12 U n 1 13 G n 1 14 G n 1 15 A n 1 16 G n 1 17 A n 1 18 C n 1 19 G n 1 20 U n 1 21 C n 1 22 U n 1 23 A n 1 24 G n 1 25 G n 1 26 C n 1 27 C n 1 28 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 681 681 G G A . n A 1 2 G 2 682 682 G G A . n A 1 3 G 3 683 683 G G A . n A 1 4 C 4 684 684 C C A . n A 1 5 U 5 685 685 U U A . n A 1 6 G 6 686 686 G G A . n A 1 7 A 7 687 687 A A A . n A 1 8 A 8 688 688 A A A . n A 1 9 G 9 689 689 G G A . n A 1 10 G 10 690 690 G G A . n A 1 11 A 11 691 691 A A A . n A 1 12 U 12 692 692 U U A . n A 1 13 G 13 693 693 G G A . n A 1 14 G 14 694 694 G G A . n A 1 15 A 15 695 695 A A A . n A 1 16 G 16 696 696 G G A . n A 1 17 A 17 697 697 A A A . n A 1 18 C 18 776 776 C C A . n A 1 19 G 19 777 777 G G A . n A 1 20 U 20 778 778 U U A . n A 1 21 C 21 779 779 C C A . n A 1 22 U 22 780 780 U U A . n A 1 23 A 23 781 781 A A A . n A 1 24 G 24 782 782 G G A . n A 1 25 G 25 783 783 G G A . n A 1 26 C 26 784 784 C C A . n A 1 27 C 27 785 785 C C A . n A 1 28 C 28 786 786 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2NC0 _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2NC0 _struct.title 'Solution structure of the St domain of EMCV IRES' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2NC0 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'IRES, translation initiation, Viral RNA, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2NC0 _struct_ref.pdbx_db_accession 2NC0 _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2NC0 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2NC0 _struct_ref_seq.db_align_beg 681 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 786 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 681 _struct_ref_seq.pdbx_auth_seq_align_end 786 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 681 A C 786 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 681 A C 786 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 681 A C 786 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 682 A C 785 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 682 A C 785 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 682 A C 785 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 683 A C 784 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 683 A C 784 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 683 A C 784 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 684 A G 783 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 684 A G 783 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 684 A G 783 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 24 O6 ? ? A U 685 A G 782 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 24 N1 ? ? A U 685 A G 782 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A A 8 N6 ? ? ? 1_555 A A 23 N3 ? ? A A 688 A A 781 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog16 hydrog ? ? A G 9 N1 ? ? ? 1_555 A U 22 O2 ? ? A G 689 A U 780 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog17 hydrog ? ? A G 9 O6 ? ? ? 1_555 A U 22 N3 ? ? A G 689 A U 780 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog18 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 690 A C 779 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 690 A C 779 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 690 A C 779 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 20 N3 ? ? A A 691 A U 778 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 20 O4 ? ? A A 691 A U 778 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 12 N3 ? ? ? 1_555 A G 19 O6 ? ? A U 692 A G 777 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog24 hydrog ? ? A U 12 O2 ? ? ? 1_555 A G 19 N1 ? ? A U 692 A G 777 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog25 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 693 A C 776 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 693 A C 776 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 693 A C 776 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 14 N2 ? ? ? 1_555 A A 17 N7 ? ? A G 694 A A 697 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog29 hydrog ? ? A G 14 N3 ? ? ? 1_555 A A 17 N6 ? ? A G 694 A A 697 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 7 "HO2'" A A 687 ? ? N1 A A 781 ? ? 1.39 2 7 O6 A G 693 ? ? O6 A G 777 ? ? 2.15 3 9 "HO2'" A A 687 ? ? N1 A A 781 ? ? 1.44 4 10 "HO2'" A A 687 ? ? N1 A A 781 ? ? 1.51 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 1000 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2NC0 _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2NC0 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '0.5 mM RNA (28-MER), 10 mM potassium phosphate, 10 mM sodium chloride, 100% D2O' 1 '100% D2O' '0.5 mM RNA (28-MER), 10 mM potassium phosphate, 10 mM sodium chloride, 90% H2O/10% D2O' 2 '90% H2O/10% D2O' '0.5 mM [U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt RNA (28-MER), 10 mM potassium phosphate, 10 mM sodium chloride, 100% D2O' 3 '100% D2O' '0.5 mM [U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura RNA (28-MER), 10 mM potassium phosphate, 10 mM sodium chloride, 100% D2O' 4 '100% D2O' '0.5 mM [U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt RNA (28-MER), 10 mM potassium phosphate, 10 mM sodium chloride, 90% H2O/10% D2O' 5 '90% H2O/10% D2O' '0.5 mM [U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura RNA (28-MER), 10 mM potassium phosphate, 10 mM sodium chloride, 90% H2O/10% D2O' 6 '90% H2O/10% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id 'RNA (28-MER)-1' 0.5 ? mM ? 1 'potassium phosphate-2' 10 ? mM ? 1 'sodium chloride-3' 10 ? mM ? 1 'RNA (28-MER)-4' 0.5 ? mM ? 2 'potassium phosphate-5' 10 ? mM ? 2 'sodium chloride-6' 10 ? mM ? 2 'RNA (28-MER)-7' 0.5 ? mM '[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt' 3 'potassium phosphate-8' 10 ? mM ? 3 'sodium chloride-9' 10 ? mM ? 3 'RNA (28-MER)-10' 0.5 ? mM '[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura' 4 'potassium phosphate-11' 10 ? mM ? 4 'sodium chloride-12' 10 ? mM ? 4 'RNA (28-MER)-13' 0.5 ? mM '[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt' 5 'potassium phosphate-14' 10 ? mM ? 5 'sodium chloride-15' 10 ? mM ? 5 'RNA (28-MER)-16' 0.5 ? mM '[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura' 6 'potassium phosphate-17' 10 ? mM ? 6 'sodium chloride-18' 10 ? mM ? 6 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 20 6.5 ambient ? 308 K 2 20 6.5 ambient ? 283 K 3 20 5.5 ambient ? 283 K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 2 2 2 '2D 1H-1H NOESY' 3 3 2 '2D 1H-1H NOESY' 1 4 3 '2D 1H-13C HSQC' 1 5 3 '3D 1H-13C NOESY' 1 6 4 '2D 1H-13C HSQC' 1 7 4 '3D 1H-13C NOESY' 2 8 5 '2D 1H-15N HSQC' 3 9 5 '2D 1H-15N HSQC' 2 10 6 '2D 1H-15N HSQC' 3 11 6 '2D 1H-15N HSQC' # _pdbx_nmr_refine.entry_id 2NC0 _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Keller and Wuthrich' 'chemical shift assignment' CARA ? 1 'Guntert, Mumenthaler and Wuthrich' 'structure solution' CYANA ? 2 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 3 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2NC0 'double helix' 2NC0 'a-form double helix' 2NC0 tetraloop 2NC0 'bulge loop' 2NC0 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 28 1_555 -0.190 -0.079 -0.080 0.593 -3.658 -3.294 1 A_G681:C786_A A 681 ? A 786 ? 19 1 1 A G 2 1_555 A C 27 1_555 -0.155 -0.157 -0.214 -1.235 -6.856 -0.193 2 A_G682:C785_A A 682 ? A 785 ? 19 1 1 A G 3 1_555 A C 26 1_555 -0.106 -0.225 -0.141 -2.469 -9.466 1.939 3 A_G683:C784_A A 683 ? A 784 ? 19 1 1 A C 4 1_555 A G 25 1_555 0.333 -0.243 -0.055 -1.085 -12.172 -1.136 4 A_C684:G783_A A 684 ? A 783 ? 19 1 1 A U 5 1_555 A G 24 1_555 1.642 -0.386 0.028 -4.240 -3.155 -7.180 5 A_U685:G782_A A 685 ? A 782 ? 28 1 1 A A 8 1_555 A A 23 1_555 -6.043 -3.612 0.830 0.272 6.385 -36.424 6 A_A688:A781_A A 688 ? A 781 ? ? 10 1 A G 9 1_555 A U 22 1_555 -2.054 -0.347 -0.037 2.654 -4.875 0.123 7 A_G689:U780_A A 689 ? A 780 ? 28 1 1 A G 10 1_555 A C 21 1_555 -0.389 -0.219 -0.174 -2.067 -7.091 0.922 8 A_G690:C779_A A 690 ? A 779 ? 19 1 1 A A 11 1_555 A U 20 1_555 0.013 -0.273 -0.130 -3.231 -6.073 -0.950 9 A_A691:U778_A A 691 ? A 778 ? 20 1 1 A U 12 1_555 A G 19 1_555 1.225 -0.416 0.003 -3.110 -0.641 -0.606 10 A_U692:G777_A A 692 ? A 777 ? 28 1 1 A G 13 1_555 A C 18 1_555 0.027 -0.109 -0.409 -5.654 3.826 2.903 11 A_G693:C776_A A 693 ? A 776 ? 19 1 1 A G 14 1_555 A A 17 1_555 6.534 -4.084 0.369 8.772 22.116 -4.503 12 A_G694:A697_A A 694 ? A 697 ? 11 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 28 1_555 A G 2 1_555 A C 27 1_555 0.179 -1.755 3.258 -0.303 8.403 31.223 -4.535 -0.371 2.704 15.269 0.550 32.308 1 AA_G681G682:C785C786_AA A 681 ? A 786 ? A 682 ? A 785 ? 1 A G 2 1_555 A C 27 1_555 A G 3 1_555 A C 26 1_555 0.163 -1.661 3.280 -0.883 4.544 31.237 -3.868 -0.459 3.009 8.381 1.629 31.570 2 AA_G682G683:C784C785_AA A 682 ? A 785 ? A 683 ? A 784 ? 1 A G 3 1_555 A C 26 1_555 A C 4 1_555 A G 25 1_555 -0.121 -1.466 3.226 0.196 2.322 34.380 -2.826 0.234 3.123 3.923 -0.331 34.456 3 AA_G683C684:G783C784_AA A 683 ? A 784 ? A 684 ? A 783 ? 1 A C 4 1_555 A G 25 1_555 A U 5 1_555 A G 24 1_555 -0.020 -1.705 3.385 1.684 1.493 35.901 -2.978 0.278 3.309 2.420 -2.728 35.969 4 AA_C684U685:G782G783_AA A 684 ? A 783 ? A 685 ? A 782 ? 1 A U 5 1_555 A G 24 1_555 A A 8 1_555 A A 23 1_555 0.443 -0.698 6.936 58.992 -66.989 -10.990 3.773 3.200 0.132 63.386 55.819 -89.794 5 AA_U685A688:A781G782_AA A 685 ? A 782 ? A 688 ? A 781 ? 1 A A 8 1_555 A A 23 1_555 A G 9 1_555 A U 22 1_555 2.370 -1.164 3.396 -9.567 19.795 52.687 -2.247 -2.986 2.422 21.286 10.287 56.786 6 AA_A688G689:U780A781_AA A 688 ? A 781 ? A 689 ? A 780 ? 1 A G 9 1_555 A U 22 1_555 A G 10 1_555 A C 21 1_555 -0.066 -1.651 3.305 -0.645 6.473 37.163 -3.367 0.022 2.987 10.062 1.003 37.708 7 AA_G689G690:C779U780_AA A 689 ? A 780 ? A 690 ? A 779 ? 1 A G 10 1_555 A C 21 1_555 A A 11 1_555 A U 20 1_555 0.061 -1.661 3.254 0.672 6.869 33.278 -3.882 -0.004 2.864 11.837 -1.158 33.966 8 AA_G690A691:U778C779_AA A 690 ? A 779 ? A 691 ? A 778 ? 1 A A 11 1_555 A U 20 1_555 A U 12 1_555 A G 19 1_555 0.208 -1.458 3.223 0.908 9.731 34.751 -3.636 -0.217 2.734 15.907 -1.484 36.059 9 AA_A691U692:G777U778_AA A 691 ? A 778 ? A 692 ? A 777 ? 1 A U 12 1_555 A G 19 1_555 A G 13 1_555 A C 18 1_555 0.133 -1.856 2.979 3.148 23.794 25.024 -5.704 0.117 0.928 44.071 -5.831 34.540 10 AA_U692G693:C776G777_AA A 692 ? A 777 ? A 693 ? A 776 ? 1 A G 13 1_555 A C 18 1_555 A G 14 1_555 A A 17 1_555 -1.261 -0.583 2.737 -0.458 20.535 53.114 -1.549 1.308 2.392 22.056 0.492 56.677 11 AA_G693G694:A697C776_AA A 693 ? A 776 ? A 694 ? A 697 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 800 Bruker AVANCE 1 'Bruker Avance' 700 Bruker AVANCE 2 'Bruker Avance' # _atom_sites.entry_id 2NC0 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_