data_2NCI # _entry.id 2NCI # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_code _database_2.database_id _database_2.pdbx_database_accession _database_2.pdbx_DOI RCSB104694 RCSB ? ? 2NCI PDB pdb_00002nci 10.2210/pdb2nci/pdb 26024 BMRB ? 10.13018/BMR26024 D_1000104694 WWPDB ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2016-09-28 2 'Structure model' 1 1 2016-10-05 3 'Structure model' 1 2 2016-10-12 4 'Structure model' 1 3 2016-10-19 5 'Structure model' 1 4 2024-05-01 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Database references' 4 5 'Structure model' 'Data collection' 5 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 5 'Structure model' chem_comp_atom 2 5 'Structure model' chem_comp_bond 3 5 'Structure model' database_2 4 5 'Structure model' pdbx_nmr_software # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 5 'Structure model' '_database_2.pdbx_DOI' 2 5 'Structure model' '_database_2.pdbx_database_accession' 3 5 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2NCI _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2016-04-01 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # _pdbx_database_related.db_id 26024 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Gu, X.' 1 'Schroeder, S.J.' 2 # _citation.id primary _citation.title 'NMR Structures and Dynamics in a Prohead RNA Loop that Binds Metal Ions.' _citation.journal_abbrev 'J Phys Chem Lett' _citation.journal_volume 7 _citation.page_first 3841 _citation.page_last 3846 _citation.year 2016 _citation.journal_id_ASTM ? _citation.country US _citation.journal_id_ISSN 1948-7185 _citation.journal_id_CSD ? _citation.book_publisher ? _citation.pdbx_database_id_PubMed 27631837 _citation.pdbx_database_id_DOI 10.1021/acs.jpclett.6b01465 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Gu, X.' 1 ? primary 'Park, S.Y.' 2 ? primary 'Tonelli, M.' 3 ? primary 'Cornilescu, G.' 4 ? primary 'Xia, T.' 5 ? primary 'Zhong, D.' 6 ? primary 'Schroeder, S.J.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (28-MER)' _entity.formula_weight 8970.373 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGACGUUAAAAGGCUUCGGCCUACGUCC _entity_poly.pdbx_seq_one_letter_code_can GGACGUUAAAAGGCUUCGGCCUACGUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 C n 1 5 G n 1 6 U n 1 7 U n 1 8 A n 1 9 A n 1 10 A n 1 11 A n 1 12 G n 1 13 G n 1 14 C n 1 15 U n 1 16 U n 1 17 C n 1 18 G n 1 19 G n 1 20 C n 1 21 C n 1 22 U n 1 23 A n 1 24 C n 1 25 G n 1 26 U n 1 27 C n 1 28 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'Transcription of RNA using T7 polymerase' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 A 9 9 9 A A A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 C 14 14 14 C C A . n A 1 15 U 15 15 15 U U A . n A 1 16 U 16 16 16 U U A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n A 1 22 U 22 22 22 U U A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 G 25 25 25 G G A . n A 1 26 U 26 26 26 U U A . n A 1 27 C 27 27 27 C C A . n A 1 28 C 28 28 28 C C A . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 2 2 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 3 3 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 4 4 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 5 5 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 6 6 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 7 7 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 8 8 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 9 9 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 10 10 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2NCI _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2NCI _struct.title 'RNA Bulge Loop that Specifically Binds Metal Ions' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2NCI _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA, bulge loop' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2NCI _struct_ref.pdbx_db_accession 2NCI _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2NCI _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2NCI _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 28 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 28 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 3 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 3 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 5 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 5 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 5 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N6 ? ? ? 1_555 A A 23 N3 ? ? A A 8 A A 23 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog16 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 13 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 13 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 13 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 15 O2 ? ? ? 1_555 A G 18 N1 ? ? A U 15 A G 18 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2NCI _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2NCI _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system ;1.5 mM [U-98% 13C; U-98% 15N] ADENOSINE-5'-MONOPHOSPHATE, 1.5 mM [U-98% 13C; U-98% 15N] URIDINE-5'-MONOPHOSPHATE, 1.5 mM GUANOSINE-5'-MONOPHOSPHATE, 1.5 mM CYTIDINE-5'-MONOPHOSPHATE, 1.5 mM cobalt hexamine, 10 mM sodium chloride, 10 mM sodium phosphate, 100% D2O ; 1 '100% D2O' ;1 mM GUANOSINE-5'-MONOPHOSPHATE, 1 mM ADENOSINE-5'-MONOPHOSPHATE, 1 mM CYTIDINE-5'-MONOPHOSPHATE, 1 mM URIDINE-5'-MONOPHOSPHATE, 1 mM cobalt hexamine, 10 mM sodium chloride, 10 mM sodium phosphate, 90% H2O/10% D2O ; 2 '90% H2O/10% D2O' ;1.5 mM [U-98% 13C; U-98% 15N] ADENOSINE-5'-MONOPHOSPHATE, 1.5 mM [U-98% 13C; U-98% 15N] URIDINE-5'-MONOPHOSPHATE, 1.5 mM GUANOSINE-5'-MONOPHOSPHATE, 1.5 mM CYTIDINE-5'-MONOPHOSPHATE, 1.5 mM cobalt hexamine, 5 mg/mL phage, 10 mM sodium chloride, 10 mM sodium phosphate, 100% D2O ; 3 '100% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id "ADENOSINE-5'-MONOPHOSPHATE-1" 1.5 ? mM '[U-98% 13C; U-98% 15N]' 1 "URIDINE-5'-MONOPHOSPHATE-2" 1.5 ? mM '[U-98% 13C; U-98% 15N]' 1 "GUANOSINE-5'-MONOPHOSPHATE-3" 1.5 ? mM ? 1 "CYTIDINE-5'-MONOPHOSPHATE-4" 1.5 ? mM ? 1 'cobalt hexamine-5' 1.5 ? mM ? 1 'sodium chloride-6' 10 ? mM ? 1 'sodium phosphate-7' 10 ? mM ? 1 "GUANOSINE-5'-MONOPHOSPHATE-8" 1 ? mM ? 2 "ADENOSINE-5'-MONOPHOSPHATE-9" 1 ? mM ? 2 "CYTIDINE-5'-MONOPHOSPHATE-10" 1 ? mM ? 2 "URIDINE-5'-MONOPHOSPHATE-11" 1 ? mM ? 2 'cobalt hexamine-12' 1 ? mM ? 2 'sodium chloride-13' 10 ? mM ? 2 'sodium phosphate-14' 10 ? mM ? 2 "ADENOSINE-5'-MONOPHOSPHATE-15" 1.5 ? mM '[U-98% 13C; U-98% 15N]' 3 "URIDINE-5'-MONOPHOSPHATE-16" 1.5 ? mM '[U-98% 13C; U-98% 15N]' 3 "GUANOSINE-5'-MONOPHOSPHATE-17" 1.5 ? mM ? 3 "CYTIDINE-5'-MONOPHOSPHATE-18" 1.5 ? mM ? 3 'cobalt hexamine-19' 1.5 ? mM ? 3 phage-20 5 ? mg/mL ? 3 'sodium chloride-21' 10 ? mM ? 3 'sodium phosphate-22' 10 ? mM ? 3 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 20 6 ambient ? 298 K 2 20 6 ambient ? 274 K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-13C HSQC' 1 2 1 '3D HCCH-TOCSY' 1 3 1 '2D NOESY13CHSQC' 1 4 1 '2D HCNTROSY' 1 5 1 '2D NOESY' 1 6 3 '2D 1H-13C HSQC' 2 7 2 '2D NOESY' 2 8 2 '2D COSY' 1 9 2 '2D 1H-13C HSQC' # _pdbx_nmr_refine.entry_id 2NCI _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal Goddard 'chemical shift assignment' Sparky ? 1 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2NCI 'double helix' 2NCI 'a-form double helix' 2NCI tetraloop 2NCI 'mismatched base pair' 2NCI 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 28 1_555 -0.720 -0.095 -0.218 -6.480 1.686 1.502 1 A_G1:C28_A A 1 ? A 28 ? 19 1 1 A G 2 1_555 A C 27 1_555 -0.723 -0.069 -0.101 -0.708 0.405 2.559 2 A_G2:C27_A A 2 ? A 27 ? 19 1 1 A A 3 1_555 A U 26 1_555 0.018 0.167 -0.020 22.367 -11.450 3.234 3 A_A3:U26_A A 3 ? A 26 ? 20 1 1 A C 4 1_555 A G 25 1_555 0.695 -0.051 -0.271 11.659 -5.224 3.423 4 A_C4:G25_A A 4 ? A 25 ? 19 1 1 A G 5 1_555 A C 24 1_555 -0.868 -0.136 0.031 20.877 5.679 1.273 5 A_G5:C24_A A 5 ? A 24 ? 19 1 1 A A 8 1_555 A A 23 1_555 -6.259 -4.199 -1.568 8.750 6.887 0.041 6 A_A8:A23_A A 8 ? A 23 ? ? 5 1 A G 12 1_555 A C 21 1_555 0.760 0.203 0.202 4.369 0.976 0.800 7 A_G12:C21_A A 12 ? A 21 ? 19 1 1 A G 13 1_555 A C 20 1_555 -0.746 -0.049 -0.098 2.335 -1.405 -1.155 8 A_G13:C20_A A 13 ? A 20 ? 19 1 1 A C 14 1_555 A G 19 1_555 0.725 -0.109 -0.451 13.630 -4.496 3.915 9 A_C14:G19_A A 14 ? A 19 ? 19 1 1 A U 15 1_555 A G 18 1_555 1.012 -4.916 0.566 -20.218 -1.820 -107.278 10 A_U15:G18_A A 15 ? A 18 ? ? 6 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 28 1_555 A G 2 1_555 A C 27 1_555 0.195 -1.709 3.195 -2.017 10.291 27.866 -5.240 -0.754 2.405 20.473 4.013 29.737 1 AA_G1G2:C27C28_AA A 1 ? A 28 ? A 2 ? A 27 ? 1 A G 2 1_555 A C 27 1_555 A A 3 1_555 A U 26 1_555 0.298 -1.319 2.883 3.482 -1.826 32.128 -2.077 0.018 2.967 -3.285 -6.262 32.361 2 AA_G2A3:U26C27_AA A 2 ? A 27 ? A 3 ? A 26 ? 1 A A 3 1_555 A U 26 1_555 A C 4 1_555 A G 25 1_555 0.027 -1.541 3.698 2.126 14.231 32.079 -4.772 0.286 2.783 24.285 -3.627 35.081 3 AA_A3C4:G25U26_AA A 3 ? A 26 ? A 4 ? A 25 ? 1 A C 4 1_555 A G 25 1_555 A G 5 1_555 A C 24 1_555 -0.055 -1.854 3.213 -3.476 -0.253 24.125 -4.313 -0.944 3.208 -0.602 8.262 24.372 4 AA_C4G5:C24G25_AA A 4 ? A 25 ? A 5 ? A 24 ? 1 A G 12 1_555 A C 21 1_555 A G 13 1_555 A C 20 1_555 0.155 -1.985 3.470 -0.532 5.463 21.510 -7.194 -0.600 2.878 14.339 1.395 22.191 5 AA_G12G13:C20C21_AA A 12 ? A 21 ? A 13 ? A 20 ? 1 A G 13 1_555 A C 20 1_555 A C 14 1_555 A G 19 1_555 0.029 -1.395 3.261 0.380 0.632 35.475 -2.381 0.008 3.236 1.037 -0.623 35.482 6 AA_G13C14:G19C20_AA A 13 ? A 20 ? A 14 ? A 19 ? 1 A C 14 1_555 A G 19 1_555 A U 15 1_555 A G 18 1_555 -1.272 -0.606 3.876 14.879 18.034 101.408 -0.689 1.061 3.614 11.546 -9.526 103.340 7 AA_C14U15:G18G19_AA A 14 ? A 19 ? A 15 ? A 18 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 500 Varian VNMRS 1 'Varian VNMRS' 900 Agilent INOVA 2 'Agilent INOVA' 800 Agilent INOVA 3 'Agilent INOVA' 600 Agilent 'NMR System' 4 'Agilent NMR System' # _atom_sites.entry_id 2NCI _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_