data_2ADT # _entry.id 2ADT # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2ADT pdb_00002adt 10.2210/pdb2adt/pdb RCSB RCSB033775 ? ? WWPDB D_1000033775 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2005-07-26 2 'Structure model' 1 1 2008-04-30 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2022-03-09 5 'Structure model' 1 4 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 5 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' database_2 2 4 'Structure model' pdbx_nmr_software 3 4 'Structure model' pdbx_struct_assembly 4 4 'Structure model' pdbx_struct_oper_list 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' 3 4 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2ADT _pdbx_database_status.recvd_initial_deposition_date 2005-07-20 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Davis, J.H.' 1 'Tonelli, M.' 2 'Scott, L.G.' 3 'Jaeger, L.' 4 'Williamson, J.R.' 5 'Butcher, S.E.' 6 # _citation.id primary _citation.title 'RNA Helical Packing in Solution: NMR Structure of a 30 kDa GAAA Tetraloop-Receptor Complex' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 351 _citation.page_first 371 _citation.page_last 382 _citation.year 2005 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 16002091 _citation.pdbx_database_id_DOI 10.1016/j.jmb.2005.05.069 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Davis, J.H.' 1 ? primary 'Tonelli, M.' 2 ? primary 'Scott, L.G.' 3 ? primary 'Jaeger, L.' 4 ? primary 'Williamson, J.R.' 5 ? primary 'Butcher, S.E.' 6 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 43-MER _entity.formula_weight 13873.258 _entity.pdbx_number_of_molecules 2 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details 'GAAA tetraloop-receptor RNA' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_seq_one_letter_code_can GGGAUAUGGAAGAACCGGGGAAACUUGGUUCUUCCUAAGUCCU _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 U n 1 6 A n 1 7 U n 1 8 G n 1 9 G n 1 10 A n 1 11 A n 1 12 G n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 G n 1 18 G n 1 19 G n 1 20 G n 1 21 A n 1 22 A n 1 23 A n 1 24 C n 1 25 U n 1 26 U n 1 27 G n 1 28 G n 1 29 U n 1 30 U n 1 31 C n 1 32 U n 1 33 U n 1 34 C n 1 35 C n 1 36 U n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 C n 1 42 C n 1 43 U n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G GUA A . n A 1 2 G 2 2 2 G GUA A . n A 1 3 G 3 3 3 G GUA A . n A 1 4 A 4 4 4 A ADE A . n A 1 5 U 5 5 5 U URI A . n A 1 6 A 6 6 6 A ADE A . n A 1 7 U 7 7 7 U URI A . n A 1 8 G 8 8 8 G GUA A . n A 1 9 G 9 9 9 G GUA A . n A 1 10 A 10 10 10 A ADE A . n A 1 11 A 11 11 11 A ADE A . n A 1 12 G 12 12 12 G GUA A . n A 1 13 A 13 13 13 A ADE A . n A 1 14 A 14 14 14 A ADE A . n A 1 15 C 15 15 15 C CYT A . n A 1 16 C 16 16 16 C CYT A . n A 1 17 G 17 17 17 G GUA A . n A 1 18 G 18 18 18 G GUA A . n A 1 19 G 19 19 19 G GUA A . n A 1 20 G 20 20 20 G GUA A . n A 1 21 A 21 21 21 A ADE A . n A 1 22 A 22 22 22 A ADE A . n A 1 23 A 23 23 23 A ADE A . n A 1 24 C 24 24 24 C CYT A . n A 1 25 U 25 25 25 U URI A . n A 1 26 U 26 26 26 U URI A . n A 1 27 G 27 27 27 G GUA A . n A 1 28 G 28 28 28 G GUA A . n A 1 29 U 29 29 29 U URI A . n A 1 30 U 30 30 30 U URI A . n A 1 31 C 31 31 31 C CYT A . n A 1 32 U 32 32 32 U URI A . n A 1 33 U 33 33 33 U URI A . n A 1 34 C 34 34 34 C CYT A . n A 1 35 C 35 35 35 C CYT A . n A 1 36 U 36 36 36 U URI A . n A 1 37 A 37 37 37 A ADE A . n A 1 38 A 38 38 38 A ADE A . n A 1 39 G 39 39 39 G GUA A . n A 1 40 U 40 40 40 U URI A . n A 1 41 C 41 41 41 C CYT A . n A 1 42 C 42 42 42 C CYT A . n A 1 43 U 43 43 43 U URI A . n B 1 1 G 1 44 44 G GUA B . n B 1 2 G 2 45 45 G GUA B . n B 1 3 G 3 46 46 G GUA B . n B 1 4 A 4 47 47 A ADE B . n B 1 5 U 5 48 48 U URI B . n B 1 6 A 6 49 49 A ADE B . n B 1 7 U 7 50 50 U URI B . n B 1 8 G 8 51 51 G GUA B . n B 1 9 G 9 52 52 G GUA B . n B 1 10 A 10 53 53 A ADE B . n B 1 11 A 11 54 54 A ADE B . n B 1 12 G 12 55 55 G GUA B . n B 1 13 A 13 56 56 A ADE B . n B 1 14 A 14 57 57 A ADE B . n B 1 15 C 15 58 58 C CYT B . n B 1 16 C 16 59 59 C CYT B . n B 1 17 G 17 60 60 G GUA B . n B 1 18 G 18 61 61 G GUA B . n B 1 19 G 19 62 62 G GUA B . n B 1 20 G 20 63 63 G GUA B . n B 1 21 A 21 64 64 A ADE B . n B 1 22 A 22 65 65 A ADE B . n B 1 23 A 23 66 66 A ADE B . n B 1 24 C 24 67 67 C CYT B . n B 1 25 U 25 68 68 U URI B . n B 1 26 U 26 69 69 U URI B . n B 1 27 G 27 70 70 G GUA B . n B 1 28 G 28 71 71 G GUA B . n B 1 29 U 29 72 72 U URI B . n B 1 30 U 30 73 73 U URI B . n B 1 31 C 31 74 74 C CYT B . n B 1 32 U 32 75 75 U URI B . n B 1 33 U 33 76 76 U URI B . n B 1 34 C 34 77 77 C CYT B . n B 1 35 C 35 78 78 C CYT B . n B 1 36 U 36 79 79 U URI B . n B 1 37 A 37 80 80 A ADE B . n B 1 38 A 38 81 81 A ADE B . n B 1 39 G 39 82 82 G GUA B . n B 1 40 U 40 83 83 U URI B . n B 1 41 C 41 84 84 C CYT B . n B 1 42 C 42 85 85 C CYT B . n B 1 43 U 43 86 86 U URI B . n # _exptl.entry_id 2ADT _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_percent_sol ? _exptl_crystal.density_Matthews ? _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _diffrn.id 1 _diffrn.ambient_temp ? _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type ? # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _database_PDB_matrix.entry_id 2ADT _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 2ADT _struct.title 'NMR structure of a 30 kDa GAAA tetraloop-receptor complex.' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2ADT _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'GAAA tetraloop GAAA tetraloop-receptor, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2ADT _struct_ref.pdbx_db_accession 2ADT _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 2ADT A 1 ? 43 ? 2ADT 1 ? 43 ? 1 43 2 1 2ADT B 1 ? 43 ? 2ADT 44 ? 86 ? 44 86 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A G 1 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 1 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 3 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 39 O6 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 39 N1 ? ? A U 5 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 36 O2 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog14 hydrog ? ? A A 6 N7 ? ? ? 1_555 A U 36 N3 ? ? A A 6 A U 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 B A 21 N6 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog16 hydrog ? ? A A 6 N6 ? ? ? 1_555 B A 21 N1 ? ? A A 6 B A 64 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 A G 39 N2 ? ? A U 7 A G 39 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog18 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 8 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 8 N2 ? ? ? 1_555 B A 23 N3 ? ? A G 8 B A 66 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 9 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 10 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 11 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 12 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 13 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 29 N3 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 29 O4 ? ? A A 14 A U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 15 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 16 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 26 O2 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog43 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 26 N3 ? ? A G 17 A U 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 25 O2 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 25 N3 ? ? A G 18 A U 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog46 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 19 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 20 N2 ? ? ? 1_555 A A 23 N7 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog50 hydrog ? ? A G 20 N3 ? ? ? 1_555 A A 23 N6 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog51 hydrog ? ? A A 21 N1 ? ? ? 1_555 B A 6 N6 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog52 hydrog ? ? A A 21 N6 ? ? ? 1_555 B A 6 N1 ? ? A A 21 B A 49 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog53 hydrog ? ? A A 23 N3 ? ? ? 1_555 B G 8 N2 ? ? A A 23 B G 51 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog54 hydrog ? ? A A 37 N3 ? ? ? 1_555 A A 38 N6 ? ? A A 37 A A 38 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog55 hydrog ? ? B G 1 N1 ? ? ? 1_555 B U 43 O2 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog56 hydrog ? ? B G 1 O6 ? ? ? 1_555 B U 43 N3 ? ? B G 44 B U 86 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog57 hydrog ? ? B G 2 N1 ? ? ? 1_555 B C 42 N3 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? B G 2 N2 ? ? ? 1_555 B C 42 O2 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? B G 2 O6 ? ? ? 1_555 B C 42 N4 ? ? B G 45 B C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? B G 3 N1 ? ? ? 1_555 B C 41 N3 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B G 3 N2 ? ? ? 1_555 B C 41 O2 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B G 3 O6 ? ? ? 1_555 B C 41 N4 ? ? B G 46 B C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B A 4 N1 ? ? ? 1_555 B U 40 N3 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? B A 4 N6 ? ? ? 1_555 B U 40 O4 ? ? B A 47 B U 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? B U 5 N3 ? ? ? 1_555 B G 39 O6 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog66 hydrog ? ? B U 5 O2 ? ? ? 1_555 B G 39 N1 ? ? B U 48 B G 82 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog67 hydrog ? ? B A 6 N6 ? ? ? 1_555 B U 36 O2 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog68 hydrog ? ? B A 6 N7 ? ? ? 1_555 B U 36 N3 ? ? B A 49 B U 79 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog69 hydrog ? ? B G 8 N1 ? ? ? 1_555 B C 35 N3 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? B G 8 N2 ? ? ? 1_555 B C 35 O2 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? B G 8 O6 ? ? ? 1_555 B C 35 N4 ? ? B G 51 B C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? B G 9 N1 ? ? ? 1_555 B C 34 N3 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? B G 9 N2 ? ? ? 1_555 B C 34 O2 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? B G 9 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 52 B C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? B A 10 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? B A 10 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 53 B U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? B A 11 N1 ? ? ? 1_555 B U 32 N3 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? B A 11 N6 ? ? ? 1_555 B U 32 O4 ? ? B A 54 B U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? B G 12 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B G 12 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B G 12 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 55 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B A 13 N1 ? ? ? 1_555 B U 30 N3 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B A 13 N6 ? ? ? 1_555 B U 30 O4 ? ? B A 56 B U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? B A 14 N1 ? ? ? 1_555 B U 29 N3 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? B A 14 N6 ? ? ? 1_555 B U 29 O4 ? ? B A 57 B U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? B C 15 N3 ? ? ? 1_555 B G 28 N1 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B C 15 N4 ? ? ? 1_555 B G 28 O6 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B C 15 O2 ? ? ? 1_555 B G 28 N2 ? ? B C 58 B G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B C 16 N3 ? ? ? 1_555 B G 27 N1 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? B C 16 N4 ? ? ? 1_555 B G 27 O6 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 27 N2 ? ? B C 59 B G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? B C 16 O2 ? ? ? 1_555 B G 28 N1 ? ? B C 59 B G 71 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog93 hydrog ? ? B G 17 N1 ? ? ? 1_555 B U 26 O2 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog94 hydrog ? ? B G 17 O6 ? ? ? 1_555 B U 26 N3 ? ? B G 60 B U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog95 hydrog ? ? B G 18 N1 ? ? ? 1_555 B U 25 O2 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog96 hydrog ? ? B G 18 O6 ? ? ? 1_555 B U 25 N3 ? ? B G 61 B U 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog97 hydrog ? ? B G 19 N1 ? ? ? 1_555 B C 24 N3 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? B G 19 N2 ? ? ? 1_555 B C 24 O2 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? B G 19 O6 ? ? ? 1_555 B C 24 N4 ? ? B G 62 B C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? B G 20 N2 ? ? ? 1_555 B A 23 N7 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog101 hydrog ? ? B G 20 N3 ? ? ? 1_555 B A 23 N6 ? ? B G 63 B A 66 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog102 hydrog ? ? B A 37 N3 ? ? ? 1_555 B A 38 N6 ? ? B A 80 B A 81 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H61 A A 21 ? ? H61 B A 49 ? ? 1.34 2 1 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.53 3 1 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.54 4 1 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.56 5 1 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.57 6 1 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.57 7 2 "O2'" A U 7 ? ? "H5'" A G 8 ? ? 1.40 8 2 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.51 9 2 "HO2'" B U 50 ? ? "O5'" B G 51 ? ? 1.52 10 2 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.53 11 2 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.55 12 2 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.55 13 2 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.58 14 2 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.58 15 3 H61 A A 6 ? ? H61 B A 64 ? ? 1.35 16 3 "HO2'" A G 8 ? ? OP1 A G 9 ? ? 1.37 17 3 "HO2'" B U 48 ? ? OP1 B A 49 ? ? 1.44 18 3 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.48 19 3 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.49 20 3 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.52 21 3 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.56 22 3 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.57 23 3 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.58 24 4 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.54 25 4 "O2'" A G 17 ? ? "H5'" A G 18 ? ? 1.55 26 4 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.57 27 4 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.58 28 5 H61 A A 6 ? ? H61 B A 64 ? ? 1.34 29 5 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.51 30 5 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.51 31 5 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.56 32 5 "HO2'" B U 68 ? ? "O4'" B U 69 ? ? 1.58 33 5 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.60 34 6 H61 A A 21 ? ? H61 B A 49 ? ? 1.33 35 6 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.43 36 6 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.51 37 6 "HO2'" B C 78 ? ? OP1 B U 79 ? ? 1.52 38 6 "HO2'" A U 26 ? ? "O4'" A G 27 ? ? 1.54 39 6 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.56 40 6 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.59 41 7 "HO2'" A A 6 ? ? OP2 A U 7 ? ? 1.40 42 7 "O2'" A G 3 ? ? "H5'" A A 4 ? ? 1.50 43 7 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.52 44 7 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.53 45 7 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.54 46 8 H61 A A 21 ? ? H61 B A 49 ? ? 1.34 47 8 "O2'" A U 29 ? ? "H5'" A U 30 ? ? 1.45 48 8 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.50 49 8 "HO2'" B U 79 ? ? OP1 B A 80 ? ? 1.57 50 8 N3 B A 49 ? ? H6 B U 50 ? ? 1.58 51 8 "O2'" A U 26 ? ? "H5'" A G 27 ? ? 1.58 52 8 "O2'" B A 49 ? ? "H5''" B U 50 ? ? 1.59 53 9 H61 A A 6 ? ? H61 B A 64 ? ? 1.34 54 9 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.49 55 9 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.55 56 9 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.55 57 9 "O2'" A U 26 ? ? "H5'" A G 27 ? ? 1.56 58 9 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.58 59 9 "O2'" A A 6 ? ? "H5''" A U 7 ? ? 1.59 60 10 "HO2'" A A 37 ? ? OP2 A A 38 ? ? 1.32 61 10 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.57 62 11 H61 A A 6 ? ? H61 B A 64 ? ? 1.33 63 11 "O2'" B U 50 ? ? H8 B G 51 ? ? 1.37 64 11 "HO2'" A C 34 ? ? OP1 A C 35 ? ? 1.43 65 11 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.49 66 11 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.53 67 11 "O2'" B A 49 ? ? "H2'" B U 50 ? ? 1.59 68 11 "O2'" A G 9 ? ? "O2'" B C 67 ? ? 2.18 69 12 "HO2'" B A 64 ? ? OP1 B A 65 ? ? 1.29 70 12 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.52 71 12 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.52 72 12 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.56 73 12 "HO2'" A U 26 ? ? "O4'" A G 27 ? ? 1.59 74 13 H61 A A 6 ? ? H61 B A 64 ? ? 1.31 75 13 "O2'" A G 9 ? ? "HO2'" B C 67 ? ? 1.43 76 13 "HO2'" A G 8 ? ? OP1 A G 9 ? ? 1.45 77 13 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.51 78 13 "O2'" B C 67 ? ? "H5'" B U 68 ? ? 1.55 79 13 "O2'" A G 8 ? ? H61 B A 65 ? ? 1.55 80 13 "O2'" B A 53 ? ? "H5'" B A 54 ? ? 1.58 81 14 "O2'" B U 48 ? ? "H5'" B A 49 ? ? 1.41 82 14 "HO2'" B C 78 ? ? OP1 B U 79 ? ? 1.52 83 14 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.53 84 14 "O2'" B G 60 ? ? "H5'" B G 61 ? ? 1.57 85 14 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.58 86 14 "O2'" A U 25 ? ? "H5'" A U 26 ? ? 1.60 87 15 H61 A A 6 ? ? H61 B A 64 ? ? 1.34 88 15 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.51 89 15 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.56 90 15 "O2'" B C 67 ? ? "H5'" B U 68 ? ? 1.58 91 15 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.59 92 16 H61 A A 6 ? ? H61 B A 64 ? ? 1.34 93 16 "O2'" B U 50 ? ? H8 B G 51 ? ? 1.40 94 16 "O2'" A C 41 ? ? "H5'" A C 42 ? ? 1.57 95 16 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.57 96 16 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.58 97 16 "O2'" A A 4 ? ? "H5'" A U 5 ? ? 1.58 98 17 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.48 99 17 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.58 100 17 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.59 101 17 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.59 102 17 "HO2'" B U 50 ? ? "O5'" B G 51 ? ? 1.60 103 18 H61 A A 6 ? ? H61 B A 64 ? ? 1.32 104 18 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.49 105 18 "HO2'" B U 50 ? ? "O5'" B G 51 ? ? 1.54 106 18 "HO2'" A U 26 ? ? "O4'" A G 27 ? ? 1.55 107 18 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.58 108 18 "O2'" B U 69 ? ? "H5'" B G 70 ? ? 1.58 109 18 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.59 110 18 "O2'" B C 67 ? ? "H5'" B U 68 ? ? 1.59 111 19 "O2'" A G 18 ? ? "H5'" A G 19 ? ? 1.48 112 19 "O2'" B G 46 ? ? "H5'" B A 47 ? ? 1.50 113 19 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.53 114 20 H61 A A 22 ? ? "O2'" B G 51 ? ? 1.33 115 20 "O2'" B U 48 ? ? "H5'" B A 49 ? ? 1.43 116 20 "O2'" A C 24 ? ? "H5'" A U 25 ? ? 1.52 117 20 "O2'" A C 42 ? ? "H5'" A U 43 ? ? 1.53 118 20 "HO2'" B A 80 ? ? OP2 B A 81 ? ? 1.55 119 20 "O2'" B C 84 ? ? "H5'" B C 85 ? ? 1.56 120 20 "O2'" B C 85 ? ? "H5'" B U 86 ? ? 1.58 121 20 "O2'" A C 24 ? ? "O2'" B G 52 ? ? 2.17 # _pdbx_nmr_ensemble.entry_id 2ADT _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 2ADT _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system 1 'All NMR samples were between 0.5 and 2.0 mM RNA,100% D2O' '100% D2O' 2 'All NMR samples were between 0.5 and 2.0 mM RNA, 10% D2O, 90 H2O' '10% D2O, 90 H2O' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature_units 1 303 1 6.8 '~50 mM NaCl' atm K 2 283 1 6.8 '~50 Mm Na Cl' atm K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 '2D NOESY' 1 2 1 '2D TOCSY' 1 3 1 3D_13C-separated_NOESY 1 4 2 '2D NOESY' 2 5 2 HNN-COSY 2 6 1 HCCH-TOCSY 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal collection XwinNMR 2.6 'Bruker Biospin' 1 'structure solution' CNS 1.0 ;A.T.Brunger, P.D.Adams, G.M.Clore, W.L.Delano, P.Gros, R.W.Grosse-Kunstleve, J.-S.Jiang, J.Kuszewski, M.Nilges, N.S.Pannu, R.J.Read, L.M.Rice, T.Simonson, G.L.Warren ; 2 'structure solution' X-PLOR-NIH 2.11 'Schwieters, C. D., Kuszewski, J. J., Tjandra, N.' 3 processing NMRPipe 2.3 'Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G.,' 4 'data analysis' Sparky 3.111 'T. D. Goddard and D. G. Kneller' 5 refinement X-PLOR-NIH 2.11 'Schwieters, C. D., Kuszewski, J. J., Tjandra, N.' 6 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2ADT 'double helix' 2ADT 'a-form double helix' 2ADT tetraloop 2ADT 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A U 43 1_555 -1.724 -0.636 -0.954 -7.056 7.720 -10.738 1 A_G1:U43_A A 1 ? A 43 ? 28 ? 1 A G 2 1_555 A C 42 1_555 -0.845 -0.460 -0.748 -4.376 -4.071 -1.515 2 A_G2:C42_A A 2 ? A 42 ? 19 1 1 A G 3 1_555 A C 41 1_555 -0.580 -0.266 -0.584 -5.131 -5.656 -0.304 3 A_G3:C41_A A 3 ? A 41 ? 19 1 1 A A 4 1_555 A U 40 1_555 0.592 -0.051 -0.085 -2.516 -2.448 -2.426 4 A_A4:U40_A A 4 ? A 40 ? 20 1 1 A U 5 1_555 A G 39 1_555 3.438 -1.069 -0.002 1.063 -1.165 -2.369 5 A_U5:G39_A A 5 ? A 39 ? 28 ? 1 A A 37 1_555 A A 38 1_555 6.406 -0.534 -0.698 11.464 -9.415 -3.485 6 A_A37:A38_A A 37 ? A 38 ? ? 9 1 A A 6 1_555 B A 21 1_555 0.730 1.980 -0.315 -48.122 14.103 -172.792 7 A_A6:A64_B A 6 ? B 64 ? 1 2 1 A C 35 1_555 A G 8 1_555 0.837 -0.321 -0.030 -0.073 -2.064 -2.399 8 A_C35:G8_A A 35 ? A 8 ? 19 1 1 A C 34 1_555 A G 9 1_555 -0.422 -0.061 -0.110 0.171 3.092 -1.443 9 A_C34:G9_A A 34 ? A 9 ? 19 1 1 A U 33 1_555 A A 10 1_555 -0.621 -0.140 -0.511 5.461 7.541 -2.045 10 A_U33:A10_A A 33 ? A 10 ? 20 1 1 A U 32 1_555 A A 11 1_555 0.647 -0.310 -0.096 -3.121 -7.788 5.357 11 A_U32:A11_A A 32 ? A 11 ? 20 1 1 A C 31 1_555 A G 12 1_555 0.744 -0.274 -0.555 11.646 -9.572 -0.009 12 A_C31:G12_A A 31 ? A 12 ? 19 1 1 A U 30 1_555 A A 13 1_555 -0.581 -0.093 -0.073 -0.455 1.462 -0.305 13 A_U30:A13_A A 30 ? A 13 ? 20 1 1 A U 29 1_555 A A 14 1_555 -0.323 -0.026 0.237 -3.543 5.458 -2.844 14 A_U29:A14_A A 29 ? A 14 ? 20 1 1 A G 28 1_555 A C 15 1_555 -0.139 -0.089 -0.497 -11.143 0.309 -2.932 15 A_G28:C15_A A 28 ? A 15 ? 19 1 1 A G 27 1_555 A C 16 1_555 0.143 -0.392 -1.079 -5.091 -15.427 11.103 16 A_G27:C16_A A 27 ? A 16 ? 19 1 1 A U 26 1_555 A G 17 1_555 1.949 -0.421 -0.241 0.152 -4.653 -2.310 17 A_U26:G17_A A 26 ? A 17 ? 28 1 1 A U 25 1_555 A G 18 1_555 2.031 -0.369 0.088 -0.459 0.974 2.556 18 A_U25:G18_A A 25 ? A 18 ? 28 1 1 A C 24 1_555 A G 19 1_555 -0.551 -0.037 -0.159 2.968 -0.412 -1.613 19 A_C24:G19_A A 24 ? A 19 ? 19 1 1 A A 23 1_555 A G 20 1_555 -6.601 -3.411 0.084 -17.257 16.930 -14.334 20 A_A23:G20_A A 23 ? A 20 ? 11 10 1 B G 1 1_555 B U 43 1_555 -1.770 -0.605 -0.848 -4.044 9.427 -9.824 21 B_G44:U86_B B 44 ? B 86 ? 28 ? 1 B G 2 1_555 B C 42 1_555 -0.848 -0.439 -0.674 -3.897 -5.306 -1.154 22 B_G45:C85_B B 45 ? B 85 ? 19 1 1 B G 3 1_555 B C 41 1_555 0.568 -0.186 -0.665 -6.894 -6.834 1.450 23 B_G46:C84_B B 46 ? B 84 ? 19 1 1 B A 4 1_555 B U 40 1_555 0.343 -0.033 -0.085 -1.784 -1.297 -2.315 24 B_A47:U83_B B 47 ? B 83 ? 20 1 1 B U 5 1_555 B G 39 1_555 3.457 -1.098 0.046 1.381 -0.374 -2.838 25 B_U48:G82_B B 48 ? B 82 ? 28 ? 1 B A 37 1_555 B A 38 1_555 6.601 -0.666 -1.010 5.403 16.033 1.441 26 B_A80:A81_B B 80 ? B 81 ? ? 9 1 A A 21 1_555 B A 6 1_555 -0.758 -2.162 0.117 38.622 -8.939 179.390 27 A_A21:A49_B A 21 ? B 49 ? 1 2 1 B G 8 1_555 B C 35 1_555 -0.591 -0.206 0.028 -1.206 -2.113 -2.201 28 B_G51:C78_B B 51 ? B 78 ? 19 1 1 B G 9 1_555 B C 34 1_555 -0.186 -0.096 -0.211 2.618 0.972 -2.267 29 B_G52:C77_B B 52 ? B 77 ? 19 1 1 B A 10 1_555 B U 33 1_555 -0.084 -0.131 -0.267 -3.816 4.134 -0.530 30 B_A53:U76_B B 53 ? B 76 ? 20 1 1 B A 11 1_555 B U 32 1_555 -0.732 -0.346 -0.539 -7.760 -14.245 4.232 31 B_A54:U75_B B 54 ? B 75 ? 20 1 1 B G 12 1_555 B C 31 1_555 -0.042 -0.179 -0.809 -9.548 -10.604 2.772 32 B_G55:C74_B B 55 ? B 74 ? 19 1 1 B A 13 1_555 B U 30 1_555 0.609 -0.064 0.062 -0.747 -6.451 -2.941 33 B_A56:U73_B B 56 ? B 73 ? 20 1 1 B A 14 1_555 B U 29 1_555 0.593 -0.077 -0.230 -0.033 11.853 -4.916 34 B_A57:U72_B B 57 ? B 72 ? 20 1 1 B C 15 1_555 B G 28 1_555 -0.257 -0.066 -0.338 4.643 4.377 -3.032 35 B_C58:G71_B B 58 ? B 71 ? 19 1 1 B C 16 1_555 B G 27 1_555 -0.293 -0.313 -0.955 4.108 -13.853 9.915 36 B_C59:G70_B B 59 ? B 70 ? 19 1 1 B G 17 1_555 B U 26 1_555 -2.015 -0.407 -0.134 1.693 -8.561 -3.399 37 B_G60:U69_B B 60 ? B 69 ? 28 ? 1 B G 18 1_555 B U 25 1_555 -2.028 -0.382 -0.046 -0.365 1.305 1.915 38 B_G61:U68_B B 61 ? B 68 ? 28 1 1 B G 19 1_555 B C 24 1_555 0.523 -0.038 -0.144 -4.972 -5.717 -1.849 39 B_G62:C67_B B 62 ? B 67 ? 19 1 1 B G 20 1_555 B A 23 1_555 6.622 -3.428 0.213 15.041 11.542 -14.163 40 B_G63:A66_B B 63 ? B 66 ? 11 9 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A U 43 1_555 A G 2 1_555 A C 42 1_555 0.114 -1.718 3.685 -2.120 -5.220 28.229 -2.085 -0.786 3.914 -10.571 4.293 28.774 1 AA_G1G2:C42U43_AA A 1 ? A 43 ? A 2 ? A 42 ? 1 A G 2 1_555 A C 42 1_555 A G 3 1_555 A C 41 1_555 -0.436 -0.769 4.276 -0.716 -5.913 33.198 -0.049 0.597 4.352 -10.246 1.241 33.713 2 AA_G2G3:C41C42_AA A 2 ? A 42 ? A 3 ? A 41 ? 1 A G 3 1_555 A C 41 1_555 A A 4 1_555 A U 40 1_555 -0.072 -0.430 3.935 -2.310 6.994 36.340 -1.795 -0.255 3.788 11.074 3.657 37.055 3 AA_G3A4:U40C41_AA A 3 ? A 41 ? A 4 ? A 40 ? 1 A A 4 1_555 A U 40 1_555 A U 5 1_555 A G 39 1_555 0.974 -0.242 3.774 2.587 7.878 45.879 -1.071 -0.981 3.732 10.010 -3.288 46.582 4 AA_A4U5:G39U40_AA A 4 ? A 40 ? A 5 ? A 39 ? 1 A U 5 1_555 A G 39 1_555 A A 37 1_555 A A 38 1_555 -3.294 2.281 -0.944 158.279 78.821 -49.737 -1.199 -1.530 1.355 -39.821 79.964 -177.114 5 AA_U5A37:A38G39_AA A 5 ? A 39 ? A 37 ? A 38 ? 1 A A 37 1_555 A A 38 1_555 A A 6 1_555 B A 21 1_555 -1.543 5.080 0.608 -159.140 51.926 -53.876 -2.378 -0.242 -2.432 -27.029 -82.838 -168.769 6 AA_A37A6:A64A38_BA A 37 ? A 38 ? A 6 ? B 64 ? 1 A A 6 1_555 B A 21 1_555 A C 35 1_555 A G 8 1_555 3.978 4.510 -0.860 142.029 34.393 -77.233 -2.022 0.830 -4.334 -18.650 77.015 -153.692 7 AA_A6C35:G8A64_AB A 6 ? B 64 ? A 35 ? A 8 ? 1 A C 35 1_555 A G 8 1_555 A C 34 1_555 A G 9 1_555 1.632 1.389 -3.116 -3.937 -16.233 -32.600 -4.084 3.058 -2.019 26.835 -6.508 -36.526 8 AA_C35C34:G9G8_AA A 35 ? A 8 ? A 34 ? A 9 ? 1 A C 34 1_555 A G 9 1_555 A U 33 1_555 A A 10 1_555 -0.774 1.948 -3.938 1.978 -10.969 -29.690 -5.787 -1.818 -2.991 20.518 3.700 -31.669 9 AA_C34U33:A10G9_AA A 34 ? A 9 ? A 33 ? A 10 ? 1 A U 33 1_555 A A 10 1_555 A U 32 1_555 A A 11 1_555 0.106 0.752 -3.924 -1.206 6.891 -25.701 0.588 0.619 -3.978 -15.136 -2.649 -26.621 10 AA_U33U32:A11A10_AA A 33 ? A 10 ? A 32 ? A 11 ? 1 A U 32 1_555 A A 11 1_555 A C 31 1_555 A G 12 1_555 -0.043 0.503 -4.109 0.234 -25.932 -34.561 -3.838 -0.087 -3.038 37.778 0.342 -42.970 11 AA_U32C31:G12A11_AA A 32 ? A 11 ? A 31 ? A 12 ? 1 A C 31 1_555 A G 12 1_555 A U 30 1_555 A A 13 1_555 -0.411 0.890 -3.125 -2.988 -13.467 -32.294 -3.322 -0.274 -2.587 22.949 -5.092 -35.044 12 AA_C31U30:A13G12_AA A 31 ? A 12 ? A 30 ? A 13 ? 1 A U 30 1_555 A A 13 1_555 A U 29 1_555 A A 14 1_555 -0.278 0.503 -4.119 -1.613 -3.960 -29.751 -1.987 -0.122 -4.029 7.662 -3.122 -30.050 13 AA_U30U29:A14A13_AA A 30 ? A 13 ? A 29 ? A 14 ? 1 A U 29 1_555 A A 14 1_555 A G 28 1_555 A C 15 1_555 -0.496 0.931 -3.467 4.617 -21.575 -25.737 -4.951 -1.571 -2.007 40.286 8.621 -33.778 14 AA_U29G28:C15A14_AA A 29 ? A 14 ? A 28 ? A 15 ? 1 A G 28 1_555 A C 15 1_555 A G 27 1_555 A C 16 1_555 1.744 0.179 -3.199 6.970 -34.059 -33.366 -3.011 1.581 -2.388 46.514 9.519 -47.826 15 AA_G28G27:C16C15_AA A 28 ? A 15 ? A 27 ? A 16 ? 1 A G 27 1_555 A C 16 1_555 A U 26 1_555 A G 17 1_555 -1.933 0.760 -3.678 -9.073 -8.881 -22.368 -4.705 -1.290 -3.625 20.872 -21.322 -25.680 16 AA_G27U26:G17C16_AA A 27 ? A 16 ? A 26 ? A 17 ? 1 A U 26 1_555 A G 17 1_555 A U 25 1_555 A G 18 1_555 0.576 1.165 -3.799 -5.439 -5.865 -29.236 -3.548 2.325 -3.348 11.353 -10.530 -30.288 17 AA_U26U25:G18G17_AA A 26 ? A 17 ? A 25 ? A 18 ? 1 A U 25 1_555 A G 18 1_555 A C 24 1_555 A G 19 1_555 -0.654 0.975 -4.128 1.292 -7.721 -37.808 -2.649 -1.186 -3.839 11.761 1.968 -38.581 18 AA_U25C24:G19G18_AA A 25 ? A 18 ? A 24 ? A 19 ? 1 A C 24 1_555 A G 19 1_555 A A 23 1_555 A G 20 1_555 -0.717 -0.268 -2.863 -0.837 -16.846 -43.498 -0.934 -0.845 -2.791 21.780 -1.082 -46.505 19 AA_C24A23:G20G19_AA A 24 ? A 19 ? A 23 ? A 20 ? 1 B G 1 1_555 B U 43 1_555 B G 2 1_555 B C 42 1_555 0.122 -1.811 3.680 -2.223 -3.732 27.366 -2.734 -0.879 3.866 -7.826 4.661 27.703 20 BB_G44G45:C85U86_BB B 44 ? B 86 ? B 45 ? B 85 ? 1 B G 2 1_555 B C 42 1_555 B G 3 1_555 B C 41 1_555 -0.568 -0.404 4.258 -0.470 -2.372 40.028 -0.235 0.758 4.280 -3.462 0.685 40.098 21 BB_G45G46:C84C85_BB B 45 ? B 85 ? B 46 ? B 84 ? 1 B G 3 1_555 B C 41 1_555 B A 4 1_555 B U 40 1_555 -0.254 -0.561 3.776 -2.667 7.000 31.139 -2.458 -0.089 3.578 12.809 4.879 32.006 22 BB_G46A47:U83C84_BB B 46 ? B 84 ? B 47 ? B 83 ? 1 B A 4 1_555 B U 40 1_555 B U 5 1_555 B G 39 1_555 0.792 -0.237 3.725 2.045 11.714 44.480 -1.453 -0.813 3.587 15.155 -2.646 45.964 23 BB_A47U48:G82U83_BB B 47 ? B 83 ? B 48 ? B 82 ? 1 B U 5 1_555 B G 39 1_555 B A 37 1_555 B A 38 1_555 -2.818 2.843 -1.606 160.696 77.548 -10.127 -1.332 -1.595 1.156 -39.085 80.993 -178.435 24 BB_U48A80:A81G82_BB B 48 ? B 82 ? B 80 ? B 81 ? 1 B A 37 1_555 B A 38 1_555 A A 21 1_555 B A 6 1_555 -1.611 4.894 -1.274 -160.975 54.087 -107.908 -2.238 -0.173 -2.843 -27.353 -81.408 -174.014 25 BA_A80A21:A49A81_BB B 80 ? B 81 ? A 21 ? B 49 ? 1 A A 21 1_555 B A 6 1_555 B G 8 1_555 B C 35 1_555 4.785 -2.616 3.913 -24.546 17.878 28.472 -4.671 -8.102 -1.162 28.152 38.653 41.396 26 AB_A21G51:C78A49_BB A 21 ? B 49 ? B 51 ? B 78 ? 1 B G 8 1_555 B C 35 1_555 B G 9 1_555 B C 34 1_555 1.076 -1.060 3.441 -0.718 12.797 29.394 -4.200 -2.079 2.728 23.842 1.338 32.011 27 BB_G51G52:C77C78_BB B 51 ? B 78 ? B 52 ? B 77 ? 1 B G 9 1_555 B C 34 1_555 B A 10 1_555 B U 33 1_555 -0.555 -1.921 3.739 -2.233 11.781 33.034 -5.046 0.569 2.933 19.920 3.776 35.086 28 BB_G52A53:U76C77_BB B 52 ? B 77 ? B 53 ? B 76 ? 1 B A 10 1_555 B U 33 1_555 B A 11 1_555 B U 32 1_555 0.728 -0.561 4.197 3.567 5.612 32.177 -2.225 -0.504 4.098 9.993 -6.350 32.839 29 BB_A53A54:U75U76_BB B 53 ? B 76 ? B 54 ? B 75 ? 1 B A 11 1_555 B U 32 1_555 B G 12 1_555 B C 31 1_555 -0.696 -0.285 3.732 0.790 12.693 30.548 -2.921 1.374 3.335 22.885 -1.424 33.031 30 BB_A54G55:C74U75_BB B 54 ? B 75 ? B 55 ? B 74 ? 1 B G 12 1_555 B C 31 1_555 B A 13 1_555 B U 30 1_555 -0.454 -1.090 3.136 -3.710 12.742 29.852 -3.945 0.226 2.511 23.337 6.795 32.607 31 BB_G55A56:U73C74_BB B 55 ? B 74 ? B 56 ? B 73 ? 1 B A 13 1_555 B U 30 1_555 B A 14 1_555 B U 29 1_555 -0.121 -1.058 3.972 0.404 13.490 29.070 -4.723 0.303 3.179 25.231 -0.755 31.989 32 BB_A56A57:U72U73_BB B 56 ? B 73 ? B 57 ? B 72 ? 1 B A 14 1_555 B U 29 1_555 B C 15 1_555 B G 28 1_555 -0.142 -0.926 3.750 0.433 19.201 27.460 -5.007 0.323 2.573 35.474 -0.801 33.404 33 BB_A57C58:G71U72_BB B 57 ? B 72 ? B 58 ? B 71 ? 1 B C 15 1_555 B G 28 1_555 B C 16 1_555 B G 27 1_555 2.360 -0.223 2.787 8.959 23.963 32.760 -2.705 -2.449 2.598 36.378 -13.600 41.349 34 BB_C58C59:G70G71_BB B 58 ? B 71 ? B 59 ? B 70 ? 1 B C 16 1_555 B G 27 1_555 B G 17 1_555 B U 26 1_555 -1.950 -0.882 3.380 -8.628 12.506 23.439 -5.037 1.836 3.055 27.400 18.904 27.875 35 BB_C59G60:U69G70_BB B 59 ? B 70 ? B 60 ? B 69 ? 1 B G 17 1_555 B U 26 1_555 B G 18 1_555 B U 25 1_555 0.179 -1.175 3.857 -5.309 8.986 28.693 -4.245 -1.528 3.264 17.421 10.293 30.495 36 BB_G60G61:U68U69_BB B 60 ? B 69 ? B 61 ? B 68 ? 1 B G 18 1_555 B U 25 1_555 B G 19 1_555 B C 24 1_555 -0.606 -0.653 4.241 1.148 7.023 37.708 -2.115 1.106 4.040 10.749 -1.757 38.349 37 BB_G61G62:C67U68_BB B 61 ? B 68 ? B 62 ? B 67 ? 1 B G 19 1_555 B C 24 1_555 B G 20 1_555 B A 23 1_555 -0.584 -0.012 2.827 -3.809 10.571 45.811 -0.772 0.458 2.797 13.344 4.808 47.097 38 BB_G62G63:A66C67_BB B 62 ? B 67 ? B 63 ? B 66 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 DMX Bruker 600 ? 2 DMX Bruker 750 ? 3 INOVA Varian 600 ? 4 INOVA Varian 800 ? 5 INOVA Varian 900 ? # _atom_sites.entry_id 2ADT _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ #