data_2ET3 # _entry.id 2ET3 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.376 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2ET3 pdb_00002et3 10.2210/pdb2et3/pdb NDB DR0015 ? ? RCSB RCSB035058 ? ? WWPDB D_1000035058 ? ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1MWL 'CRYSTAL STRUCTURE OF GENETICIN BOUND TO THE EUBACTERIAL 16S RRNA A SITE' unspecified PDB 1J7T 'COMPLEX BETWEEN PAROMOMYCIN AND THE 16S-RRNA A-SITE AT 2.5A RESOLUTION' unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2ET3 _pdbx_database_status.recvd_initial_deposition_date 2005-10-27 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _audit_author.name 'Westhof, E.' _audit_author.pdbx_ordinal 1 # _citation.id primary _citation.title ;Crystal structures of complexes between aminoglycosides and decoding A site oligonucleotides: role of the number of rings and positive charges in the specific binding leading to miscoding. ; _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 33 _citation.page_first 5677 _citation.page_last 5690 _citation.year 2005 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 16214802 _citation.pdbx_database_id_DOI 10.1093/nar/gki862 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Francois, B.' 1 ? primary 'Russell, R.J.' 2 ? primary 'Murray, J.B.' 3 ? primary 'Aboul-ela, F.' 4 ? primary 'Masquida, B.' 5 ? primary 'Vicens, Q.' 6 ? primary 'Westhof, E.' 7 ? # _cell.entry_id 2ET3 _cell.length_a 32.160 _cell.length_b 45.410 _cell.length_c 96.900 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 8 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2ET3 _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn "5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'" 7048.259 2 ? ? ? ? 2 non-polymer syn ;(2R,3R,4R,5R)-2-((1S,2S,3R,4S,6R)-4,6-DIAMINO-3-((2R,3R,6S)-3-AMINO-6-(AMINOMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-2-HYDR OXYCYCLOHEXYLOXY)-5-METHYL-4-(METHYLAMINO)-TETRAHYDRO-2H-PYRAN-3,5-DIOL ; 449.542 2 ? ? ? ? 3 water nat water 18.015 8 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code CGCGUCACACCGGUGAAGUCGC _entity_poly.pdbx_seq_one_letter_code_can CGCGUCACACCGGUGAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 C n 1 7 A n 1 8 C n 1 9 A n 1 10 C n 1 11 C n 1 12 G n 1 13 G n 1 14 U n 1 15 G n 1 16 A n 1 17 A n 1 18 G n 1 19 U n 1 20 C n 1 21 G n 1 22 C n # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 2ET3 _struct_ref.pdbx_db_accession 2ET3 _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 2ET3 A 1 ? 22 ? 2ET3 1 ? 22 ? 1 22 2 1 2ET3 B 1 ? 22 ? 2ET3 24 ? 45 ? 24 45 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 LLL non-polymer . ;(2R,3R,4R,5R)-2-((1S,2S,3R,4S,6R)-4,6-DIAMINO-3-((2R,3R,6S)-3-AMINO-6-(AMINOMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-2-HYDR OXYCYCLOHEXYLOXY)-5-METHYL-4-(METHYLAMINO)-TETRAHYDRO-2H-PYRAN-3,5-DIOL ; 'GENTAMICIN C1A' 'C19 H39 N5 O7' 449.542 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.entry_id 2ET3 _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.51 _exptl_crystal.density_percent_sol 50.99 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 310 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 6.4 _exptl_crystal_grow.pdbx_details 'MPD, NACL, MGSO4, GLYCEROL, NA CACODYLATE, pH 6.4, VAPOR DIFFUSION, HANGING DROP, temperature 310K' _exptl_crystal_grow.pdbx_pH_range . # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.details 1 1 1 MPD ? ? ? 1 2 1 NACL ? ? ? 1 3 1 MGSO4 ? ? ? 1 4 1 GLYCEROL ? ? ? 1 5 1 'NA CACODYLATE' ? ? ? 1 6 1 H2O ? ? ? 1 7 2 MPD ? ? ? 1 8 2 NACL ? ? ? 1 9 2 MGSO4 ? ? ? 1 10 2 'NA CACODYLATE' ? ? ? # _diffrn.id 1 _diffrn.ambient_temp 110 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 4' _diffrn_detector.pdbx_collection_date ? _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.936 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'ESRF BEAMLINE ID29' _diffrn_source.pdbx_synchrotron_site ESRF _diffrn_source.pdbx_synchrotron_beamline ID29 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 0.936 # _reflns.entry_id 2ET3 _reflns.observed_criterion_sigma_I 5 _reflns.observed_criterion_sigma_F 5 _reflns.d_resolution_low 50 _reflns.d_resolution_high 2.8 _reflns.number_obs 4000 _reflns.number_all 4000 _reflns.percent_possible_obs ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy ? _reflns.R_free_details ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _refine.entry_id 2ET3 _refine.ls_number_reflns_obs 2974 _refine.ls_number_reflns_all 3796 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.5 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 20 _refine.ls_d_res_high 2.8 _refine.ls_percent_reflns_obs 78.3 _refine.ls_R_factor_obs 0.2095 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2095 _refine.ls_R_factor_R_free 0.251 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free 298 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model 'PDB Entry: 1J7T' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ;G. PARKINSON, J. VOJTECHOVSKY, L. CLOWNEY,A.T. BRUNGER, H.M. BERMAN, NEW PARAMETERSFOR THE REFINEMENT OF NUCLEIC ACID CONTAINING STRUCTURES, ACTA CRYST. D, 52,57-64 (1996) ; _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.overall_SU_B ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_analyze.entry_id 2ET3 _refine_analyze.Luzzati_coordinate_error_obs 0.35 _refine_analyze.Luzzati_sigma_a_obs 0.21 _refine_analyze.Luzzati_d_res_low_obs 5.0 _refine_analyze.Luzzati_coordinate_error_free 0.46 _refine_analyze.Luzzati_sigma_a_free 0.40 _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 900 _refine_hist.pdbx_number_atoms_ligand 62 _refine_hist.number_atoms_solvent 8 _refine_hist.number_atoms_total 970 _refine_hist.d_res_high 2.8 _refine_hist.d_res_low 20 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function c_bond_d 0.0073 ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d 1.1268 ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d 10.922 ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d 1.406 ? ? ? 'X-RAY DIFFRACTION' ? # _struct.entry_id 2ET3 _struct.title 'Complex Between Gentamicin C1A and the 16S-RRNA A-Site' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2ET3 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA-AMINOGLYCOSIDE INTERACTIONS, A SITE, UOU PAIRS, AA BULGES, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 2 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 2 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 2 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 21 N1 ? ? A C 3 B G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 21 O6 ? ? A C 3 B G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 21 N2 ? ? A C 3 B G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 4 B C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 4 B C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 4 B C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 5 O4 ? ? ? 1_555 B U 19 N3 ? ? A U 5 B U 42 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A U 5 N3 ? ? ? 1_555 B C 20 N3 ? ? A U 5 B C 43 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog12 hydrog ? ? A U 5 O4 ? ? ? 1_555 B C 20 N4 ? ? A U 5 B C 43 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog13 hydrog ? ? A C 6 N3 ? ? ? 1_555 B G 18 N1 ? ? A C 6 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N4 ? ? ? 1_555 B G 18 O6 ? ? A C 6 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 O2 ? ? ? 1_555 B G 18 N2 ? ? A C 6 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 8 N3 ? ? ? 1_555 B G 15 N1 ? ? A C 8 B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 N4 ? ? ? 1_555 B G 15 O6 ? ? A C 8 B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 O2 ? ? ? 1_555 B G 15 N2 ? ? A C 8 B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 9 N1 ? ? ? 1_555 B U 14 N3 ? ? A A 9 B U 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 9 N6 ? ? ? 1_555 B U 14 O4 ? ? A A 9 B U 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 10 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 10 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 10 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 11 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 11 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 11 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 12 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 12 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 12 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 13 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 13 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 13 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 14 N3 ? ? ? 1_555 B A 9 N1 ? ? A U 14 B A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 14 O4 ? ? ? 1_555 B A 9 N6 ? ? A U 14 B A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 15 N1 ? ? ? 1_555 B C 8 N3 ? ? A G 15 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 15 N2 ? ? ? 1_555 B C 8 O2 ? ? A G 15 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 15 O6 ? ? ? 1_555 B C 8 N4 ? ? A G 15 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 18 N1 ? ? ? 1_555 B C 6 N3 ? ? A G 18 B C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 18 N2 ? ? ? 1_555 B C 6 O2 ? ? A G 18 B C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 18 O6 ? ? ? 1_555 B C 6 N4 ? ? A G 18 B C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 19 N3 ? ? ? 1_555 B U 5 O4 ? ? A U 19 B U 28 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog42 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 20 B G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 20 B G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 20 B G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 21 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 21 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 21 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 22 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 22 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 22 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A LLL 50 ? 10 'BINDING SITE FOR RESIDUE LLL A 50' AC2 Software B LLL 51 ? 11 'BINDING SITE FOR RESIDUE LLL B 51' 1 ? ? ? ? ? ? ? # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 10 G A 15 ? G A 15 . ? 1_555 ? 2 AC1 10 A A 17 ? A A 17 . ? 1_555 ? 3 AC1 10 G A 18 ? G A 18 . ? 1_555 ? 4 AC1 10 U A 19 ? U A 19 . ? 1_555 ? 5 AC1 10 C B 3 ? C B 26 . ? 1_555 ? 6 AC1 10 G B 4 ? G B 27 . ? 1_555 ? 7 AC1 10 U B 5 ? U B 28 . ? 1_555 ? 8 AC1 10 C B 6 ? C B 29 . ? 1_555 ? 9 AC1 10 A B 7 ? A B 30 . ? 1_555 ? 10 AC1 10 C B 8 ? C B 31 . ? 1_555 ? 11 AC2 11 C A 3 ? C A 3 . ? 1_555 ? 12 AC2 11 G A 4 ? G A 4 . ? 1_555 ? 13 AC2 11 U A 5 ? U A 5 . ? 1_555 ? 14 AC2 11 C A 6 ? C A 6 . ? 1_555 ? 15 AC2 11 A A 7 ? A A 7 . ? 1_555 ? 16 AC2 11 C A 8 ? C A 8 . ? 1_555 ? 17 AC2 11 G B 15 ? G B 38 . ? 1_555 ? 18 AC2 11 A B 16 ? A B 39 . ? 1_555 ? 19 AC2 11 A B 17 ? A B 40 . ? 1_555 ? 20 AC2 11 G B 18 ? G B 41 . ? 1_555 ? 21 AC2 11 U B 19 ? U B 42 . ? 1_555 ? # _database_PDB_matrix.entry_id 2ET3 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 2ET3 _atom_sites.fract_transf_matrix[1][1] 0.031095 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.022022 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010320 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 1 ? ? ? A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 A 7 7 7 A A A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 U 14 14 14 U U A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 G 18 18 18 G G A . n A 1 19 U 19 19 19 U U A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n B 1 1 C 1 24 ? ? ? B . n B 1 2 G 2 25 25 G G B . n B 1 3 C 3 26 26 C C B . n B 1 4 G 4 27 27 G G B . n B 1 5 U 5 28 28 U U B . n B 1 6 C 6 29 29 C C B . n B 1 7 A 7 30 30 A A B . n B 1 8 C 8 31 31 C C B . n B 1 9 A 9 32 32 A A B . n B 1 10 C 10 33 33 C C B . n B 1 11 C 11 34 34 C C B . n B 1 12 G 12 35 35 G G B . n B 1 13 G 13 36 36 G G B . n B 1 14 U 14 37 37 U U B . n B 1 15 G 15 38 38 G G B . n B 1 16 A 16 39 39 A A B . n B 1 17 A 17 40 40 A A B . n B 1 18 G 18 41 41 G G B . n B 1 19 U 19 42 42 U U B . n B 1 20 C 20 43 43 C C B . n B 1 21 G 21 44 44 G G B . n B 1 22 C 22 45 45 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 LLL 1 50 50 LLL LLL A . D 2 LLL 1 51 51 LLL LLL B . E 3 HOH 1 102 102 HOH HOH A . E 3 HOH 2 105 105 HOH HOH A . E 3 HOH 3 106 106 HOH HOH A . E 3 HOH 4 107 107 HOH HOH A . E 3 HOH 5 108 108 HOH HOH A . F 3 HOH 1 101 101 HOH HOH B . F 3 HOH 2 104 104 HOH HOH B . F 3 HOH 3 109 109 HOH HOH B . # _struct_site_keywords.site_id 1 _struct_site_keywords.text BIS-INTERCALATION # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2005-12-13 2 'Structure model' 1 1 2008-05-01 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2023-08-23 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Derived calculations' 6 4 'Structure model' 'Refinement description' 7 4 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp 2 4 'Structure model' chem_comp_atom 3 4 'Structure model' chem_comp_bond 4 4 'Structure model' database_2 5 4 'Structure model' entity 6 4 'Structure model' pdbx_entity_nonpoly 7 4 'Structure model' pdbx_initial_refinement_model 8 4 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_chem_comp.name' 2 4 'Structure model' '_database_2.pdbx_DOI' 3 4 'Structure model' '_database_2.pdbx_database_accession' 4 4 'Structure model' '_entity.pdbx_description' 5 4 'Structure model' '_pdbx_entity_nonpoly.name' 6 4 'Structure model' '_struct_site.pdbx_auth_asym_id' 7 4 'Structure model' '_struct_site.pdbx_auth_comp_id' 8 4 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal HKL-2000 'data collection' . ? 1 SCALEPACK 'data scaling' . ? 2 AMoRE phasing . ? 3 CNS refinement 1.1 ? 4 HKL-2000 'data reduction' . ? 5 # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A C 1 ? A C 1 2 1 Y 1 B C 24 ? B C 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 LLL C11 C N R 114 LLL O11 O N N 115 LLL C21 C N R 116 LLL N21 N N N 117 LLL C31 C N N 118 LLL C41 C N N 119 LLL C51 C N S 120 LLL O51 O N N 121 LLL C61 C N N 122 LLL N61 N N N 123 LLL C12 C N R 124 LLL N12 N N N 125 LLL C22 C N N 126 LLL C32 C N S 127 LLL N32 N N N 128 LLL C42 C N R 129 LLL C52 C N S 130 LLL O52 O N N 131 LLL C62 C N S 132 LLL O62 O N N 133 LLL C13 C N R 134 LLL C23 C N R 135 LLL O23 O N N 136 LLL C33 C N R 137 LLL N33 N N N 138 LLL C43 C N R 139 LLL O43 O N N 140 LLL C53 C N N 141 LLL O53 O N N 142 LLL C83 C N N 143 LLL C93 C N N 144 LLL H11 H N N 145 LLL H21 H N N 146 LLL H211 H N N 147 LLL H212 H N N 148 LLL H311 H N N 149 LLL H312 H N N 150 LLL H411 H N N 151 LLL H412 H N N 152 LLL H51 H N N 153 LLL H611 H N N 154 LLL H612 H N N 155 LLL H11A H N N 156 LLL H12A H N N 157 LLL H12 H N N 158 LLL H121 H N N 159 LLL H122 H N N 160 LLL H221 H N N 161 LLL H222 H N N 162 LLL H32 H N N 163 LLL H321 H N N 164 LLL H322 H N N 165 LLL H42 H N N 166 LLL H52 H N N 167 LLL H3 H N N 168 LLL H62 H N N 169 LLL H13 H N N 170 LLL H23 H N N 171 LLL H2 H N N 172 LLL H1 H N N 173 LLL H33 H N N 174 LLL H43 H N N 175 LLL H531 H N N 176 LLL H532 H N N 177 LLL H831 H N N 178 LLL H832 H N N 179 LLL H833 H N N 180 LLL H931 H N N 181 LLL H932 H N N 182 LLL H933 H N N 183 U OP3 O N N 184 U P P N N 185 U OP1 O N N 186 U OP2 O N N 187 U "O5'" O N N 188 U "C5'" C N N 189 U "C4'" C N R 190 U "O4'" O N N 191 U "C3'" C N S 192 U "O3'" O N N 193 U "C2'" C N R 194 U "O2'" O N N 195 U "C1'" C N R 196 U N1 N N N 197 U C2 C N N 198 U O2 O N N 199 U N3 N N N 200 U C4 C N N 201 U O4 O N N 202 U C5 C N N 203 U C6 C N N 204 U HOP3 H N N 205 U HOP2 H N N 206 U "H5'" H N N 207 U "H5''" H N N 208 U "H4'" H N N 209 U "H3'" H N N 210 U "HO3'" H N N 211 U "H2'" H N N 212 U "HO2'" H N N 213 U "H1'" H N N 214 U H3 H N N 215 U H5 H N N 216 U H6 H N N 217 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 LLL C11 O11 sing N N 118 LLL C11 C21 sing N N 119 LLL C11 O51 sing N N 120 LLL C11 H11 sing N N 121 LLL O11 C42 sing N N 122 LLL C21 N21 sing N N 123 LLL C21 C31 sing N N 124 LLL C21 H21 sing N N 125 LLL N21 H211 sing N N 126 LLL N21 H212 sing N N 127 LLL C31 C41 sing N N 128 LLL C31 H311 sing N N 129 LLL C31 H312 sing N N 130 LLL C41 C51 sing N N 131 LLL C41 H411 sing N N 132 LLL C41 H412 sing N N 133 LLL C51 O51 sing N N 134 LLL C51 C61 sing N N 135 LLL C51 H51 sing N N 136 LLL C61 N61 sing N N 137 LLL C61 H611 sing N N 138 LLL C61 H612 sing N N 139 LLL N61 H11A sing N N 140 LLL N61 H12A sing N N 141 LLL C12 N12 sing N N 142 LLL C12 C22 sing N N 143 LLL C12 C62 sing N N 144 LLL C12 H12 sing N N 145 LLL N12 H121 sing N N 146 LLL N12 H122 sing N N 147 LLL C22 C32 sing N N 148 LLL C22 H221 sing N N 149 LLL C22 H222 sing N N 150 LLL C32 N32 sing N N 151 LLL C32 C42 sing N N 152 LLL C32 H32 sing N N 153 LLL N32 H321 sing N N 154 LLL N32 H322 sing N N 155 LLL C42 C52 sing N N 156 LLL C42 H42 sing N N 157 LLL C52 O52 sing N N 158 LLL C52 C62 sing N N 159 LLL C52 H52 sing N N 160 LLL O52 H3 sing N N 161 LLL C62 O62 sing N N 162 LLL C62 H62 sing N N 163 LLL O62 C13 sing N N 164 LLL C13 C23 sing N N 165 LLL C13 O53 sing N N 166 LLL C13 H13 sing N N 167 LLL C23 O23 sing N N 168 LLL C23 C33 sing N N 169 LLL C23 H23 sing N N 170 LLL O23 H2 sing N N 171 LLL C33 N33 sing N N 172 LLL C33 C43 sing N N 173 LLL C33 H1 sing N N 174 LLL N33 C93 sing N N 175 LLL N33 H33 sing N N 176 LLL C43 O43 sing N N 177 LLL C43 C53 sing N N 178 LLL C43 C83 sing N N 179 LLL O43 H43 sing N N 180 LLL C53 O53 sing N N 181 LLL C53 H531 sing N N 182 LLL C53 H532 sing N N 183 LLL C83 H831 sing N N 184 LLL C83 H832 sing N N 185 LLL C83 H833 sing N N 186 LLL C93 H931 sing N N 187 LLL C93 H932 sing N N 188 LLL C93 H933 sing N N 189 U OP3 P sing N N 190 U OP3 HOP3 sing N N 191 U P OP1 doub N N 192 U P OP2 sing N N 193 U P "O5'" sing N N 194 U OP2 HOP2 sing N N 195 U "O5'" "C5'" sing N N 196 U "C5'" "C4'" sing N N 197 U "C5'" "H5'" sing N N 198 U "C5'" "H5''" sing N N 199 U "C4'" "O4'" sing N N 200 U "C4'" "C3'" sing N N 201 U "C4'" "H4'" sing N N 202 U "O4'" "C1'" sing N N 203 U "C3'" "O3'" sing N N 204 U "C3'" "C2'" sing N N 205 U "C3'" "H3'" sing N N 206 U "O3'" "HO3'" sing N N 207 U "C2'" "O2'" sing N N 208 U "C2'" "C1'" sing N N 209 U "C2'" "H2'" sing N N 210 U "O2'" "HO2'" sing N N 211 U "C1'" N1 sing N N 212 U "C1'" "H1'" sing N N 213 U N1 C2 sing N N 214 U N1 C6 sing N N 215 U C2 O2 doub N N 216 U C2 N3 sing N N 217 U N3 C4 sing N N 218 U N3 H3 sing N N 219 U C4 O4 doub N N 220 U C4 C5 sing N N 221 U C5 C6 doub N N 222 U C5 H5 sing N N 223 U C6 H6 sing N N 224 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2ET3 'double helix' 2ET3 'a-form double helix' 2ET3 'mismatched base pair' 2ET3 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 B C 22 1_555 -0.439 -0.182 -0.024 2.713 2.162 4.807 1 A_G2:C45_B A 2 ? B 45 ? 19 1 1 A C 3 1_555 B G 21 1_555 0.290 -0.264 -0.221 19.612 -8.973 -4.807 2 A_C3:G44_B A 3 ? B 44 ? 19 1 1 A G 4 1_555 B C 20 1_555 -0.137 -0.200 -0.772 -3.233 -4.593 0.654 3 A_G4:C43_B A 4 ? B 43 ? 19 1 1 A U 5 1_555 B U 19 1_555 -1.845 -1.366 -0.836 6.885 -3.509 -14.995 4 A_U5:U42_B A 5 ? B 42 ? ? ? 1 A C 6 1_555 B G 18 1_555 0.128 -0.118 -0.337 -1.612 6.233 -2.524 5 A_C6:G41_B A 6 ? B 41 ? 19 1 1 A C 8 1_555 B G 15 1_555 0.222 -0.318 -0.474 6.811 -17.407 3.999 6 A_C8:G38_B A 8 ? B 38 ? 19 1 1 A A 9 1_555 B U 14 1_555 0.115 -0.351 0.809 2.124 -7.619 1.883 7 A_A9:U37_B A 9 ? B 37 ? 20 1 1 A C 10 1_555 B G 13 1_555 0.196 -0.048 0.100 10.013 -15.002 5.441 8 A_C10:G36_B A 10 ? B 36 ? 19 1 1 A C 11 1_555 B G 12 1_555 -0.113 -0.211 0.236 -6.374 -1.996 -2.869 9 A_C11:G35_B A 11 ? B 35 ? 19 1 1 A G 12 1_555 B C 11 1_555 0.142 -0.212 0.184 -0.825 -5.773 -1.378 10 A_G12:C34_B A 12 ? B 34 ? 19 1 1 A G 13 1_555 B C 10 1_555 -0.323 -0.177 -0.182 -5.394 -15.190 0.779 11 A_G13:C33_B A 13 ? B 33 ? 19 1 1 A U 14 1_555 B A 9 1_555 0.157 -0.142 0.186 0.256 -10.861 6.097 12 A_U14:A32_B A 14 ? B 32 ? 20 1 1 A G 15 1_555 B C 8 1_555 -0.284 -0.178 -0.857 -15.047 -14.662 4.672 13 A_G15:C31_B A 15 ? B 31 ? 19 1 1 A G 18 1_555 B C 6 1_555 0.021 -0.100 0.167 -3.161 -5.223 -3.051 14 A_G18:C29_B A 18 ? B 29 ? 19 1 1 A U 19 1_555 B U 5 1_555 1.838 -1.763 -0.915 -0.607 -1.745 -15.653 15 A_U19:U28_B A 19 ? B 28 ? ? ? 1 A C 20 1_555 B G 4 1_555 0.279 -0.216 0.373 -5.057 3.488 -0.433 16 A_C20:G27_B A 20 ? B 27 ? 19 1 1 A G 21 1_555 B C 3 1_555 -0.208 -0.078 -0.079 -10.473 -8.110 3.407 17 A_G21:C26_B A 21 ? B 26 ? 19 1 1 A C 22 1_555 B G 2 1_555 0.196 -0.084 -0.237 9.232 -5.596 0.111 18 A_C22:G25_B A 22 ? B 25 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 B C 22 1_555 A C 3 1_555 B G 21 1_555 -0.989 -2.086 2.789 -1.080 -1.423 35.208 -3.261 1.494 2.897 -2.350 1.784 35.252 1 AA_G2C3:G44C45_BB A 2 ? B 45 ? A 3 ? B 44 ? 1 A C 3 1_555 B G 21 1_555 A G 4 1_555 B C 20 1_555 -0.104 -1.764 3.774 1.990 12.444 28.601 -5.757 0.590 2.771 23.785 -3.803 31.201 2 AA_C3G4:C43G44_BB A 3 ? B 44 ? A 4 ? B 43 ? 1 A G 4 1_555 B C 20 1_555 A U 5 1_555 B U 19 1_555 -0.827 -1.605 2.918 -2.149 0.950 27.871 -3.521 1.256 2.917 1.967 4.453 27.968 3 AA_G4U5:U42C43_BB A 4 ? B 43 ? A 5 ? B 42 ? 1 A U 5 1_555 B U 19 1_555 A C 6 1_555 B G 18 1_555 1.215 -2.361 3.697 -4.512 -0.566 37.978 -3.526 -2.487 3.568 -0.866 6.903 38.239 4 AA_U5C6:G41U42_BB A 5 ? B 42 ? A 6 ? B 41 ? 1 A C 6 1_555 B G 18 1_555 A C 8 1_555 B G 15 1_555 1.111 -3.092 6.377 -8.551 14.927 77.828 -3.172 -1.300 5.681 11.748 6.730 79.411 5 AA_C6C8:G38G41_BB A 6 ? B 41 ? A 8 ? B 38 ? 1 A C 8 1_555 B G 15 1_555 A A 9 1_555 B U 14 1_555 0.061 -1.546 3.125 -8.705 11.714 35.884 -3.613 -1.042 2.443 18.117 13.464 38.647 6 AA_C8A9:U37G38_BB A 8 ? B 38 ? A 9 ? B 37 ? 1 A A 9 1_555 B U 14 1_555 A C 10 1_555 B G 13 1_555 0.790 -2.201 2.925 7.425 -1.526 28.725 -3.994 -0.070 3.137 -3.010 -14.647 29.688 7 AA_A9C10:G36U37_BB A 9 ? B 37 ? A 10 ? B 36 ? 1 A C 10 1_555 B G 13 1_555 A C 11 1_555 B G 12 1_555 -0.766 -2.343 3.319 -4.057 8.949 30.336 -5.788 0.708 2.617 16.564 7.510 31.852 8 AA_C10C11:G35G36_BB A 10 ? B 36 ? A 11 ? B 35 ? 1 A C 11 1_555 B G 12 1_555 A G 12 1_555 B C 11 1_555 -0.544 -2.077 2.874 -1.148 5.348 28.602 -5.098 0.875 2.472 10.702 2.297 29.109 9 AA_C11G12:C34G35_BB A 11 ? B 35 ? A 12 ? B 34 ? 1 A G 12 1_555 B C 11 1_555 A G 13 1_555 B C 10 1_555 0.086 -1.601 3.223 1.178 6.152 29.318 -4.285 0.062 2.837 11.984 -2.294 29.965 10 AA_G12G13:C33C34_BB A 12 ? B 34 ? A 13 ? B 33 ? 1 A G 13 1_555 B C 10 1_555 A U 14 1_555 B A 9 1_555 0.529 -1.228 3.066 -1.026 2.186 33.711 -2.439 -1.063 2.966 3.764 1.766 33.794 11 AA_G13U14:A32C33_BB A 13 ? B 33 ? A 14 ? B 32 ? 1 A U 14 1_555 B A 9 1_555 A G 15 1_555 B C 8 1_555 -0.079 -1.272 3.365 7.236 20.263 34.009 -4.019 0.888 2.235 31.089 -11.102 40.073 12 AA_U14G15:C31A32_BB A 14 ? B 32 ? A 15 ? B 31 ? 1 A G 15 1_555 B C 8 1_555 A G 18 1_555 B C 6 1_555 -1.343 -3.771 6.159 2.742 16.204 80.235 -3.620 1.152 5.413 12.455 -2.107 81.621 13 AA_G15G18:C29C31_BB A 15 ? B 31 ? A 18 ? B 29 ? 1 A G 18 1_555 B C 6 1_555 A U 19 1_555 B U 5 1_555 -1.700 -2.319 3.324 6.838 -2.298 33.904 -3.545 3.896 3.079 -3.886 -11.564 34.641 14 AA_G18U19:U28C29_BB A 18 ? B 29 ? A 19 ? B 28 ? 1 A U 19 1_555 B U 5 1_555 A C 20 1_555 B G 4 1_555 1.049 -2.129 3.449 -8.133 7.200 29.867 -5.137 -3.324 2.515 13.424 15.162 31.738 15 AA_U19C20:G27U28_BB A 19 ? B 28 ? A 20 ? B 27 ? 1 A C 20 1_555 B G 4 1_555 A G 21 1_555 B C 3 1_555 0.384 -2.045 3.027 6.206 9.362 26.332 -5.918 0.401 2.217 19.462 -12.903 28.589 16 AA_C20G21:C26G27_BB A 20 ? B 27 ? A 21 ? B 26 ? 1 A G 21 1_555 B C 3 1_555 A C 22 1_555 B G 2 1_555 -0.111 -1.838 2.838 2.129 -0.159 33.761 -3.136 0.489 2.834 -0.273 -3.661 33.826 17 AA_G21C22:G25C26_BB A 21 ? B 26 ? A 22 ? B 25 ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ;(2R,3R,4R,5R)-2-((1S,2S,3R,4S,6R)-4,6-DIAMINO-3-((2R,3R,6S)-3-AMINO-6-(AMINOMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-2-HYDR OXYCYCLOHEXYLOXY)-5-METHYL-4-(METHYLAMINO)-TETRAHYDRO-2H-PYRAN-3,5-DIOL ; LLL 3 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 1J7T _pdbx_initial_refinement_model.details 'PDB Entry: 1J7T' #