data_2ET3
# 
_entry.id   2ET3 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.376 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
_database_2.pdbx_database_accession 
_database_2.pdbx_DOI 
PDB   2ET3         pdb_00002et3 10.2210/pdb2et3/pdb 
NDB   DR0015       ?            ?                   
RCSB  RCSB035058   ?            ?                   
WWPDB D_1000035058 ?            ?                   
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.db_id 
_pdbx_database_related.details 
_pdbx_database_related.content_type 
PDB 1MWL 'CRYSTAL STRUCTURE OF GENETICIN BOUND TO THE EUBACTERIAL 16S RRNA A SITE' unspecified 
PDB 1J7T 'COMPLEX BETWEEN PAROMOMYCIN AND THE 16S-RRNA A-SITE AT 2.5A RESOLUTION'  unspecified 
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        2ET3 
_pdbx_database_status.recvd_initial_deposition_date   2005-10-27 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
# 
_audit_author.name           'Westhof, E.' 
_audit_author.pdbx_ordinal   1 
# 
_citation.id                        primary 
_citation.title                     
;Crystal structures of complexes between aminoglycosides and decoding A site oligonucleotides: role of the number of rings and positive charges in the specific binding leading to miscoding.
;
_citation.journal_abbrev            'Nucleic Acids Res.' 
_citation.journal_volume            33 
_citation.page_first                5677 
_citation.page_last                 5690 
_citation.year                      2005 
_citation.journal_id_ASTM           NARHAD 
_citation.country                   UK 
_citation.journal_id_ISSN           0305-1048 
_citation.journal_id_CSD            0389 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   16214802 
_citation.pdbx_database_id_DOI      10.1093/nar/gki862 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Francois, B.'  1 ? 
primary 'Russell, R.J.' 2 ? 
primary 'Murray, J.B.'  3 ? 
primary 'Aboul-ela, F.' 4 ? 
primary 'Masquida, B.'  5 ? 
primary 'Vicens, Q.'    6 ? 
primary 'Westhof, E.'   7 ? 
# 
_cell.entry_id           2ET3 
_cell.length_a           32.160 
_cell.length_b           45.410 
_cell.length_c           96.900 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              8 
_cell.pdbx_unique_axis   ? 
# 
_symmetry.entry_id                         2ET3 
_symmetry.space_group_name_H-M             'P 21 21 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                19 
_symmetry.space_group_name_Hall            ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     syn "5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'" 7048.259 2 ? ? ? ? 
2 non-polymer syn 
;(2R,3R,4R,5R)-2-((1S,2S,3R,4S,6R)-4,6-DIAMINO-3-((2R,3R,6S)-3-AMINO-6-(AMINOMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-2-HYDR OXYCYCLOHEXYLOXY)-5-METHYL-4-(METHYLAMINO)-TETRAHYDRO-2H-PYRAN-3,5-DIOL
;
449.542  2 ? ? ? ? 
3 water       nat water 18.015   8 ? ? ? ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   no 
_entity_poly.pdbx_seq_one_letter_code       CGCGUCACACCGGUGAAGUCGC 
_entity_poly.pdbx_seq_one_letter_code_can   CGCGUCACACCGGUGAAGUCGC 
_entity_poly.pdbx_strand_id                 A,B 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  C n 
1 2  G n 
1 3  C n 
1 4  G n 
1 5  U n 
1 6  C n 
1 7  A n 
1 8  C n 
1 9  A n 
1 10 C n 
1 11 C n 
1 12 G n 
1 13 G n 
1 14 U n 
1 15 G n 
1 16 A n 
1 17 A n 
1 18 G n 
1 19 U n 
1 20 C n 
1 21 G n 
1 22 C n 
# 
_struct_ref.id                         1 
_struct_ref.entity_id                  1 
_struct_ref.db_name                    PDB 
_struct_ref.db_code                    2ET3 
_struct_ref.pdbx_db_accession          2ET3 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.pdbx_seq_one_letter_code   ? 
_struct_ref.pdbx_align_begin           ? 
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1 1 2ET3 A 1 ? 22 ? 2ET3 1  ? 22 ? 1  22 
2 1 2ET3 B 1 ? 22 ? 2ET3 24 ? 45 ? 24 45 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A   'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ?                'C10 H14 N5 O7 P' 347.221 
C   'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ?                'C9 H14 N3 O8 P'  323.197 
G   'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ?                'C10 H14 N5 O8 P' 363.221 
HOH non-polymer   . WATER ?                'H2 O'            18.015  
LLL non-polymer   . 
;(2R,3R,4R,5R)-2-((1S,2S,3R,4S,6R)-4,6-DIAMINO-3-((2R,3R,6S)-3-AMINO-6-(AMINOMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-2-HYDR OXYCYCLOHEXYLOXY)-5-METHYL-4-(METHYLAMINO)-TETRAHYDRO-2H-PYRAN-3,5-DIOL
;
'GENTAMICIN C1A' 'C19 H39 N5 O7'   449.542 
U   'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ?                'C9 H13 N2 O9 P'  324.181 
# 
_exptl.entry_id          2ET3 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.51 
_exptl_crystal.density_percent_sol   50.99 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
# 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            310 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              6.4 
_exptl_crystal_grow.pdbx_details    
'MPD, NACL, MGSO4, GLYCEROL, NA CACODYLATE, pH 6.4, VAPOR DIFFUSION, HANGING DROP, temperature 310K' 
_exptl_crystal_grow.pdbx_pH_range   . 
# 
loop_
_exptl_crystal_grow_comp.crystal_id 
_exptl_crystal_grow_comp.id 
_exptl_crystal_grow_comp.sol_id 
_exptl_crystal_grow_comp.name 
_exptl_crystal_grow_comp.volume 
_exptl_crystal_grow_comp.conc 
_exptl_crystal_grow_comp.details 
1 1  1 MPD             ? ? ? 
1 2  1 NACL            ? ? ? 
1 3  1 MGSO4           ? ? ? 
1 4  1 GLYCEROL        ? ? ? 
1 5  1 'NA CACODYLATE' ? ? ? 
1 6  1 H2O             ? ? ? 
1 7  2 MPD             ? ? ? 
1 8  2 NACL            ? ? ? 
1 9  2 MGSO4           ? ? ? 
1 10 2 'NA CACODYLATE' ? ? ? 
# 
_diffrn.id                     1 
_diffrn.ambient_temp           110 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 4' 
_diffrn_detector.pdbx_collection_date   ? 
_diffrn_detector.details                ? 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   0.936 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'ESRF BEAMLINE ID29' 
_diffrn_source.pdbx_synchrotron_site       ESRF 
_diffrn_source.pdbx_synchrotron_beamline   ID29 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        0.936 
# 
_reflns.entry_id                     2ET3 
_reflns.observed_criterion_sigma_I   5 
_reflns.observed_criterion_sigma_F   5 
_reflns.d_resolution_low             50 
_reflns.d_resolution_high            2.8 
_reflns.number_obs                   4000 
_reflns.number_all                   4000 
_reflns.percent_possible_obs         ? 
_reflns.pdbx_Rmerge_I_obs            ? 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        ? 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              ? 
_reflns.R_free_details               ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
# 
_refine.entry_id                                 2ET3 
_refine.ls_number_reflns_obs                     2974 
_refine.ls_number_reflns_all                     3796 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          1.5 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             20 
_refine.ls_d_res_high                            2.8 
_refine.ls_percent_reflns_obs                    78.3 
_refine.ls_R_factor_obs                          0.2095 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.2095 
_refine.ls_R_factor_R_free                       0.251 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_number_reflns_R_free                  298 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.details                                  ? 
_refine.pdbx_starting_model                      'PDB Entry: 1J7T' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       
;G. PARKINSON, J. VOJTECHOVSKY, L. CLOWNEY,A.T. BRUNGER, H.M. BERMAN, NEW PARAMETERSFOR THE REFINEMENT OF NUCLEIC ACID CONTAINING STRUCTURES, ACTA CRYST. D, 52,57-64 (1996)
;
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_analyze.entry_id                        2ET3 
_refine_analyze.Luzzati_coordinate_error_obs    0.35 
_refine_analyze.Luzzati_sigma_a_obs             0.21 
_refine_analyze.Luzzati_d_res_low_obs           5.0 
_refine_analyze.Luzzati_coordinate_error_free   0.46 
_refine_analyze.Luzzati_sigma_a_free            0.40 
_refine_analyze.Luzzati_d_res_low_free          ? 
_refine_analyze.number_disordered_residues      ? 
_refine_analyze.occupancy_sum_hydrogen          ? 
_refine_analyze.occupancy_sum_non_hydrogen      ? 
_refine_analyze.pdbx_refine_id                  'X-RAY DIFFRACTION' 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   900 
_refine_hist.pdbx_number_atoms_ligand         62 
_refine_hist.number_atoms_solvent             8 
_refine_hist.number_atoms_total               970 
_refine_hist.d_res_high                       2.8 
_refine_hist.d_res_low                        20 
# 
loop_
_refine_ls_restr.type 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.weight 
_refine_ls_restr.number 
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.pdbx_restraint_function 
c_bond_d           0.0073 ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d          1.1268 ? ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d 10.922 ? ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d 1.406  ? ? ? 'X-RAY DIFFRACTION' ? 
# 
_struct.entry_id                  2ET3 
_struct.title                     'Complex Between Gentamicin C1A and the 16S-RRNA A-Site' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        2ET3 
_struct_keywords.pdbx_keywords   RNA 
_struct_keywords.text            'RNA-AMINOGLYCOSIDE INTERACTIONS, A SITE, UOU PAIRS, AA BULGES, RNA' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 1 ? 
C N N 2 ? 
D N N 2 ? 
E N N 3 ? 
F N N 3 ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
_struct_conn.pdbx_role 
hydrog1  hydrog ? ? A G 2  N1 ? ? ? 1_555 B C 22 N3 ? ? A G 2  B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog2  hydrog ? ? A G 2  N2 ? ? ? 1_555 B C 22 O2 ? ? A G 2  B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog3  hydrog ? ? A G 2  O6 ? ? ? 1_555 B C 22 N4 ? ? A G 2  B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog4  hydrog ? ? A C 3  N3 ? ? ? 1_555 B G 21 N1 ? ? A C 3  B G 44 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog5  hydrog ? ? A C 3  N4 ? ? ? 1_555 B G 21 O6 ? ? A C 3  B G 44 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog6  hydrog ? ? A C 3  O2 ? ? ? 1_555 B G 21 N2 ? ? A C 3  B G 44 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog7  hydrog ? ? A G 4  N1 ? ? ? 1_555 B C 20 N3 ? ? A G 4  B C 43 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog8  hydrog ? ? A G 4  N2 ? ? ? 1_555 B C 20 O2 ? ? A G 4  B C 43 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog9  hydrog ? ? A G 4  O6 ? ? ? 1_555 B C 20 N4 ? ? A G 4  B C 43 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog10 hydrog ? ? A U 5  O4 ? ? ? 1_555 B U 19 N3 ? ? A U 5  B U 42 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? 
hydrog11 hydrog ? ? A U 5  N3 ? ? ? 1_555 B C 20 N3 ? ? A U 5  B C 43 1_555 ? ? ? ? ? ? TYPE_18_PAIR  ? ? ? 
hydrog12 hydrog ? ? A U 5  O4 ? ? ? 1_555 B C 20 N4 ? ? A U 5  B C 43 1_555 ? ? ? ? ? ? TYPE_18_PAIR  ? ? ? 
hydrog13 hydrog ? ? A C 6  N3 ? ? ? 1_555 B G 18 N1 ? ? A C 6  B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog14 hydrog ? ? A C 6  N4 ? ? ? 1_555 B G 18 O6 ? ? A C 6  B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog15 hydrog ? ? A C 6  O2 ? ? ? 1_555 B G 18 N2 ? ? A C 6  B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog16 hydrog ? ? A C 8  N3 ? ? ? 1_555 B G 15 N1 ? ? A C 8  B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog17 hydrog ? ? A C 8  N4 ? ? ? 1_555 B G 15 O6 ? ? A C 8  B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog18 hydrog ? ? A C 8  O2 ? ? ? 1_555 B G 15 N2 ? ? A C 8  B G 38 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog19 hydrog ? ? A A 9  N1 ? ? ? 1_555 B U 14 N3 ? ? A A 9  B U 37 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog20 hydrog ? ? A A 9  N6 ? ? ? 1_555 B U 14 O4 ? ? A A 9  B U 37 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog21 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 10 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog22 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 10 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog23 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 10 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog24 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 11 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog25 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 11 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog26 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 11 B G 35 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog27 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 12 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog28 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 12 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog29 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 12 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog30 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 13 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 13 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog32 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 13 B C 33 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog33 hydrog ? ? A U 14 N3 ? ? ? 1_555 B A 9  N1 ? ? A U 14 B A 32 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog34 hydrog ? ? A U 14 O4 ? ? ? 1_555 B A 9  N6 ? ? A U 14 B A 32 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog35 hydrog ? ? A G 15 N1 ? ? ? 1_555 B C 8  N3 ? ? A G 15 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog36 hydrog ? ? A G 15 N2 ? ? ? 1_555 B C 8  O2 ? ? A G 15 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog37 hydrog ? ? A G 15 O6 ? ? ? 1_555 B C 8  N4 ? ? A G 15 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog38 hydrog ? ? A G 18 N1 ? ? ? 1_555 B C 6  N3 ? ? A G 18 B C 29 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog39 hydrog ? ? A G 18 N2 ? ? ? 1_555 B C 6  O2 ? ? A G 18 B C 29 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog40 hydrog ? ? A G 18 O6 ? ? ? 1_555 B C 6  N4 ? ? A G 18 B C 29 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog41 hydrog ? ? A U 19 N3 ? ? ? 1_555 B U 5  O4 ? ? A U 19 B U 28 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? 
hydrog42 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4  N1 ? ? A C 20 B G 27 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog43 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4  O6 ? ? A C 20 B G 27 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog44 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4  N2 ? ? A C 20 B G 27 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog45 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 3  N3 ? ? A G 21 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog46 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 3  O2 ? ? A G 21 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog47 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 3  N4 ? ? A G 21 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog48 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 2  N1 ? ? A C 22 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog49 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 2  O6 ? ? A C 22 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
hydrog50 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 2  N2 ? ? A C 22 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? ? 
# 
_struct_conn_type.id          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software A LLL 50 ? 10 'BINDING SITE FOR RESIDUE LLL A 50' 
AC2 Software B LLL 51 ? 11 'BINDING SITE FOR RESIDUE LLL B 51' 
1   ?        ? ?   ?  ? ?  ?                                   
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1  AC1 10 G A 15 ? G A 15 . ? 1_555 ? 
2  AC1 10 A A 17 ? A A 17 . ? 1_555 ? 
3  AC1 10 G A 18 ? G A 18 . ? 1_555 ? 
4  AC1 10 U A 19 ? U A 19 . ? 1_555 ? 
5  AC1 10 C B 3  ? C B 26 . ? 1_555 ? 
6  AC1 10 G B 4  ? G B 27 . ? 1_555 ? 
7  AC1 10 U B 5  ? U B 28 . ? 1_555 ? 
8  AC1 10 C B 6  ? C B 29 . ? 1_555 ? 
9  AC1 10 A B 7  ? A B 30 . ? 1_555 ? 
10 AC1 10 C B 8  ? C B 31 . ? 1_555 ? 
11 AC2 11 C A 3  ? C A 3  . ? 1_555 ? 
12 AC2 11 G A 4  ? G A 4  . ? 1_555 ? 
13 AC2 11 U A 5  ? U A 5  . ? 1_555 ? 
14 AC2 11 C A 6  ? C A 6  . ? 1_555 ? 
15 AC2 11 A A 7  ? A A 7  . ? 1_555 ? 
16 AC2 11 C A 8  ? C A 8  . ? 1_555 ? 
17 AC2 11 G B 15 ? G B 38 . ? 1_555 ? 
18 AC2 11 A B 16 ? A B 39 . ? 1_555 ? 
19 AC2 11 A B 17 ? A B 40 . ? 1_555 ? 
20 AC2 11 G B 18 ? G B 41 . ? 1_555 ? 
21 AC2 11 U B 19 ? U B 42 . ? 1_555 ? 
# 
_database_PDB_matrix.entry_id          2ET3 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
# 
_atom_sites.entry_id                    2ET3 
_atom_sites.fract_transf_matrix[1][1]   0.031095 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.022022 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.010320 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
C 
N 
O 
P 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  C 1  1  ?  ? ? A . n 
A 1 2  G 2  2  2  G G A . n 
A 1 3  C 3  3  3  C C A . n 
A 1 4  G 4  4  4  G G A . n 
A 1 5  U 5  5  5  U U A . n 
A 1 6  C 6  6  6  C C A . n 
A 1 7  A 7  7  7  A A A . n 
A 1 8  C 8  8  8  C C A . n 
A 1 9  A 9  9  9  A A A . n 
A 1 10 C 10 10 10 C C A . n 
A 1 11 C 11 11 11 C C A . n 
A 1 12 G 12 12 12 G G A . n 
A 1 13 G 13 13 13 G G A . n 
A 1 14 U 14 14 14 U U A . n 
A 1 15 G 15 15 15 G G A . n 
A 1 16 A 16 16 16 A A A . n 
A 1 17 A 17 17 17 A A A . n 
A 1 18 G 18 18 18 G G A . n 
A 1 19 U 19 19 19 U U A . n 
A 1 20 C 20 20 20 C C A . n 
A 1 21 G 21 21 21 G G A . n 
A 1 22 C 22 22 22 C C A . n 
B 1 1  C 1  24 ?  ? ? B . n 
B 1 2  G 2  25 25 G G B . n 
B 1 3  C 3  26 26 C C B . n 
B 1 4  G 4  27 27 G G B . n 
B 1 5  U 5  28 28 U U B . n 
B 1 6  C 6  29 29 C C B . n 
B 1 7  A 7  30 30 A A B . n 
B 1 8  C 8  31 31 C C B . n 
B 1 9  A 9  32 32 A A B . n 
B 1 10 C 10 33 33 C C B . n 
B 1 11 C 11 34 34 C C B . n 
B 1 12 G 12 35 35 G G B . n 
B 1 13 G 13 36 36 G G B . n 
B 1 14 U 14 37 37 U U B . n 
B 1 15 G 15 38 38 G G B . n 
B 1 16 A 16 39 39 A A B . n 
B 1 17 A 17 40 40 A A B . n 
B 1 18 G 18 41 41 G G B . n 
B 1 19 U 19 42 42 U U B . n 
B 1 20 C 20 43 43 C C B . n 
B 1 21 G 21 44 44 G G B . n 
B 1 22 C 22 45 45 C C B . n 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
C 2 LLL 1 50  50  LLL LLL A . 
D 2 LLL 1 51  51  LLL LLL B . 
E 3 HOH 1 102 102 HOH HOH A . 
E 3 HOH 2 105 105 HOH HOH A . 
E 3 HOH 3 106 106 HOH HOH A . 
E 3 HOH 4 107 107 HOH HOH A . 
E 3 HOH 5 108 108 HOH HOH A . 
F 3 HOH 1 101 101 HOH HOH B . 
F 3 HOH 2 104 104 HOH HOH B . 
F 3 HOH 3 109 109 HOH HOH B . 
# 
_struct_site_keywords.site_id   1 
_struct_site_keywords.text      BIS-INTERCALATION 
# 
_pdbx_struct_assembly.id                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   dimeric 
_pdbx_struct_assembly.oligomeric_count     2 
# 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2005-12-13 
2 'Structure model' 1 1 2008-05-01 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2023-08-23 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
_pdbx_audit_revision_details.details             ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
3 4 'Structure model' 'Data collection'           
4 4 'Structure model' 'Database references'       
5 4 'Structure model' 'Derived calculations'      
6 4 'Structure model' 'Refinement description'    
7 4 'Structure model' 'Structure summary'         
# 
loop_
_pdbx_audit_revision_category.ordinal 
_pdbx_audit_revision_category.revision_ordinal 
_pdbx_audit_revision_category.data_content_type 
_pdbx_audit_revision_category.category 
1 4 'Structure model' chem_comp                     
2 4 'Structure model' chem_comp_atom                
3 4 'Structure model' chem_comp_bond                
4 4 'Structure model' database_2                    
5 4 'Structure model' entity                        
6 4 'Structure model' pdbx_entity_nonpoly           
7 4 'Structure model' pdbx_initial_refinement_model 
8 4 'Structure model' struct_site                   
# 
loop_
_pdbx_audit_revision_item.ordinal 
_pdbx_audit_revision_item.revision_ordinal 
_pdbx_audit_revision_item.data_content_type 
_pdbx_audit_revision_item.item 
1 4 'Structure model' '_chem_comp.name'                     
2 4 'Structure model' '_database_2.pdbx_DOI'                
3 4 'Structure model' '_database_2.pdbx_database_accession' 
4 4 'Structure model' '_entity.pdbx_description'            
5 4 'Structure model' '_pdbx_entity_nonpoly.name'           
6 4 'Structure model' '_struct_site.pdbx_auth_asym_id'      
7 4 'Structure model' '_struct_site.pdbx_auth_comp_id'      
8 4 'Structure model' '_struct_site.pdbx_auth_seq_id'       
# 
loop_
_software.name 
_software.classification 
_software.version 
_software.citation_id 
_software.pdbx_ordinal 
HKL-2000  'data collection' .   ? 1 
SCALEPACK 'data scaling'    .   ? 2 
AMoRE     phasing           .   ? 3 
CNS       refinement        1.1 ? 4 
HKL-2000  'data reduction'  .   ? 5 
# 
loop_
_pdbx_unobs_or_zero_occ_residues.id 
_pdbx_unobs_or_zero_occ_residues.PDB_model_num 
_pdbx_unobs_or_zero_occ_residues.polymer_flag 
_pdbx_unobs_or_zero_occ_residues.occupancy_flag 
_pdbx_unobs_or_zero_occ_residues.auth_asym_id 
_pdbx_unobs_or_zero_occ_residues.auth_comp_id 
_pdbx_unobs_or_zero_occ_residues.auth_seq_id 
_pdbx_unobs_or_zero_occ_residues.PDB_ins_code 
_pdbx_unobs_or_zero_occ_residues.label_asym_id 
_pdbx_unobs_or_zero_occ_residues.label_comp_id 
_pdbx_unobs_or_zero_occ_residues.label_seq_id 
1 1 Y 1 A C 1  ? A C 1 
2 1 Y 1 B C 24 ? B C 1 
# 
loop_
_chem_comp_atom.comp_id 
_chem_comp_atom.atom_id 
_chem_comp_atom.type_symbol 
_chem_comp_atom.pdbx_aromatic_flag 
_chem_comp_atom.pdbx_stereo_config 
_chem_comp_atom.pdbx_ordinal 
A   OP3    O N N 1   
A   P      P N N 2   
A   OP1    O N N 3   
A   OP2    O N N 4   
A   "O5'"  O N N 5   
A   "C5'"  C N N 6   
A   "C4'"  C N R 7   
A   "O4'"  O N N 8   
A   "C3'"  C N S 9   
A   "O3'"  O N N 10  
A   "C2'"  C N R 11  
A   "O2'"  O N N 12  
A   "C1'"  C N R 13  
A   N9     N Y N 14  
A   C8     C Y N 15  
A   N7     N Y N 16  
A   C5     C Y N 17  
A   C6     C Y N 18  
A   N6     N N N 19  
A   N1     N Y N 20  
A   C2     C Y N 21  
A   N3     N Y N 22  
A   C4     C Y N 23  
A   HOP3   H N N 24  
A   HOP2   H N N 25  
A   "H5'"  H N N 26  
A   "H5''" H N N 27  
A   "H4'"  H N N 28  
A   "H3'"  H N N 29  
A   "HO3'" H N N 30  
A   "H2'"  H N N 31  
A   "HO2'" H N N 32  
A   "H1'"  H N N 33  
A   H8     H N N 34  
A   H61    H N N 35  
A   H62    H N N 36  
A   H2     H N N 37  
C   OP3    O N N 38  
C   P      P N N 39  
C   OP1    O N N 40  
C   OP2    O N N 41  
C   "O5'"  O N N 42  
C   "C5'"  C N N 43  
C   "C4'"  C N R 44  
C   "O4'"  O N N 45  
C   "C3'"  C N S 46  
C   "O3'"  O N N 47  
C   "C2'"  C N R 48  
C   "O2'"  O N N 49  
C   "C1'"  C N R 50  
C   N1     N N N 51  
C   C2     C N N 52  
C   O2     O N N 53  
C   N3     N N N 54  
C   C4     C N N 55  
C   N4     N N N 56  
C   C5     C N N 57  
C   C6     C N N 58  
C   HOP3   H N N 59  
C   HOP2   H N N 60  
C   "H5'"  H N N 61  
C   "H5''" H N N 62  
C   "H4'"  H N N 63  
C   "H3'"  H N N 64  
C   "HO3'" H N N 65  
C   "H2'"  H N N 66  
C   "HO2'" H N N 67  
C   "H1'"  H N N 68  
C   H41    H N N 69  
C   H42    H N N 70  
C   H5     H N N 71  
C   H6     H N N 72  
G   OP3    O N N 73  
G   P      P N N 74  
G   OP1    O N N 75  
G   OP2    O N N 76  
G   "O5'"  O N N 77  
G   "C5'"  C N N 78  
G   "C4'"  C N R 79  
G   "O4'"  O N N 80  
G   "C3'"  C N S 81  
G   "O3'"  O N N 82  
G   "C2'"  C N R 83  
G   "O2'"  O N N 84  
G   "C1'"  C N R 85  
G   N9     N Y N 86  
G   C8     C Y N 87  
G   N7     N Y N 88  
G   C5     C Y N 89  
G   C6     C N N 90  
G   O6     O N N 91  
G   N1     N N N 92  
G   C2     C N N 93  
G   N2     N N N 94  
G   N3     N N N 95  
G   C4     C Y N 96  
G   HOP3   H N N 97  
G   HOP2   H N N 98  
G   "H5'"  H N N 99  
G   "H5''" H N N 100 
G   "H4'"  H N N 101 
G   "H3'"  H N N 102 
G   "HO3'" H N N 103 
G   "H2'"  H N N 104 
G   "HO2'" H N N 105 
G   "H1'"  H N N 106 
G   H8     H N N 107 
G   H1     H N N 108 
G   H21    H N N 109 
G   H22    H N N 110 
HOH O      O N N 111 
HOH H1     H N N 112 
HOH H2     H N N 113 
LLL C11    C N R 114 
LLL O11    O N N 115 
LLL C21    C N R 116 
LLL N21    N N N 117 
LLL C31    C N N 118 
LLL C41    C N N 119 
LLL C51    C N S 120 
LLL O51    O N N 121 
LLL C61    C N N 122 
LLL N61    N N N 123 
LLL C12    C N R 124 
LLL N12    N N N 125 
LLL C22    C N N 126 
LLL C32    C N S 127 
LLL N32    N N N 128 
LLL C42    C N R 129 
LLL C52    C N S 130 
LLL O52    O N N 131 
LLL C62    C N S 132 
LLL O62    O N N 133 
LLL C13    C N R 134 
LLL C23    C N R 135 
LLL O23    O N N 136 
LLL C33    C N R 137 
LLL N33    N N N 138 
LLL C43    C N R 139 
LLL O43    O N N 140 
LLL C53    C N N 141 
LLL O53    O N N 142 
LLL C83    C N N 143 
LLL C93    C N N 144 
LLL H11    H N N 145 
LLL H21    H N N 146 
LLL H211   H N N 147 
LLL H212   H N N 148 
LLL H311   H N N 149 
LLL H312   H N N 150 
LLL H411   H N N 151 
LLL H412   H N N 152 
LLL H51    H N N 153 
LLL H611   H N N 154 
LLL H612   H N N 155 
LLL H11A   H N N 156 
LLL H12A   H N N 157 
LLL H12    H N N 158 
LLL H121   H N N 159 
LLL H122   H N N 160 
LLL H221   H N N 161 
LLL H222   H N N 162 
LLL H32    H N N 163 
LLL H321   H N N 164 
LLL H322   H N N 165 
LLL H42    H N N 166 
LLL H52    H N N 167 
LLL H3     H N N 168 
LLL H62    H N N 169 
LLL H13    H N N 170 
LLL H23    H N N 171 
LLL H2     H N N 172 
LLL H1     H N N 173 
LLL H33    H N N 174 
LLL H43    H N N 175 
LLL H531   H N N 176 
LLL H532   H N N 177 
LLL H831   H N N 178 
LLL H832   H N N 179 
LLL H833   H N N 180 
LLL H931   H N N 181 
LLL H932   H N N 182 
LLL H933   H N N 183 
U   OP3    O N N 184 
U   P      P N N 185 
U   OP1    O N N 186 
U   OP2    O N N 187 
U   "O5'"  O N N 188 
U   "C5'"  C N N 189 
U   "C4'"  C N R 190 
U   "O4'"  O N N 191 
U   "C3'"  C N S 192 
U   "O3'"  O N N 193 
U   "C2'"  C N R 194 
U   "O2'"  O N N 195 
U   "C1'"  C N R 196 
U   N1     N N N 197 
U   C2     C N N 198 
U   O2     O N N 199 
U   N3     N N N 200 
U   C4     C N N 201 
U   O4     O N N 202 
U   C5     C N N 203 
U   C6     C N N 204 
U   HOP3   H N N 205 
U   HOP2   H N N 206 
U   "H5'"  H N N 207 
U   "H5''" H N N 208 
U   "H4'"  H N N 209 
U   "H3'"  H N N 210 
U   "HO3'" H N N 211 
U   "H2'"  H N N 212 
U   "HO2'" H N N 213 
U   "H1'"  H N N 214 
U   H3     H N N 215 
U   H5     H N N 216 
U   H6     H N N 217 
# 
loop_
_chem_comp_bond.comp_id 
_chem_comp_bond.atom_id_1 
_chem_comp_bond.atom_id_2 
_chem_comp_bond.value_order 
_chem_comp_bond.pdbx_aromatic_flag 
_chem_comp_bond.pdbx_stereo_config 
_chem_comp_bond.pdbx_ordinal 
A   OP3   P      sing N N 1   
A   OP3   HOP3   sing N N 2   
A   P     OP1    doub N N 3   
A   P     OP2    sing N N 4   
A   P     "O5'"  sing N N 5   
A   OP2   HOP2   sing N N 6   
A   "O5'" "C5'"  sing N N 7   
A   "C5'" "C4'"  sing N N 8   
A   "C5'" "H5'"  sing N N 9   
A   "C5'" "H5''" sing N N 10  
A   "C4'" "O4'"  sing N N 11  
A   "C4'" "C3'"  sing N N 12  
A   "C4'" "H4'"  sing N N 13  
A   "O4'" "C1'"  sing N N 14  
A   "C3'" "O3'"  sing N N 15  
A   "C3'" "C2'"  sing N N 16  
A   "C3'" "H3'"  sing N N 17  
A   "O3'" "HO3'" sing N N 18  
A   "C2'" "O2'"  sing N N 19  
A   "C2'" "C1'"  sing N N 20  
A   "C2'" "H2'"  sing N N 21  
A   "O2'" "HO2'" sing N N 22  
A   "C1'" N9     sing N N 23  
A   "C1'" "H1'"  sing N N 24  
A   N9    C8     sing Y N 25  
A   N9    C4     sing Y N 26  
A   C8    N7     doub Y N 27  
A   C8    H8     sing N N 28  
A   N7    C5     sing Y N 29  
A   C5    C6     sing Y N 30  
A   C5    C4     doub Y N 31  
A   C6    N6     sing N N 32  
A   C6    N1     doub Y N 33  
A   N6    H61    sing N N 34  
A   N6    H62    sing N N 35  
A   N1    C2     sing Y N 36  
A   C2    N3     doub Y N 37  
A   C2    H2     sing N N 38  
A   N3    C4     sing Y N 39  
C   OP3   P      sing N N 40  
C   OP3   HOP3   sing N N 41  
C   P     OP1    doub N N 42  
C   P     OP2    sing N N 43  
C   P     "O5'"  sing N N 44  
C   OP2   HOP2   sing N N 45  
C   "O5'" "C5'"  sing N N 46  
C   "C5'" "C4'"  sing N N 47  
C   "C5'" "H5'"  sing N N 48  
C   "C5'" "H5''" sing N N 49  
C   "C4'" "O4'"  sing N N 50  
C   "C4'" "C3'"  sing N N 51  
C   "C4'" "H4'"  sing N N 52  
C   "O4'" "C1'"  sing N N 53  
C   "C3'" "O3'"  sing N N 54  
C   "C3'" "C2'"  sing N N 55  
C   "C3'" "H3'"  sing N N 56  
C   "O3'" "HO3'" sing N N 57  
C   "C2'" "O2'"  sing N N 58  
C   "C2'" "C1'"  sing N N 59  
C   "C2'" "H2'"  sing N N 60  
C   "O2'" "HO2'" sing N N 61  
C   "C1'" N1     sing N N 62  
C   "C1'" "H1'"  sing N N 63  
C   N1    C2     sing N N 64  
C   N1    C6     sing N N 65  
C   C2    O2     doub N N 66  
C   C2    N3     sing N N 67  
C   N3    C4     doub N N 68  
C   C4    N4     sing N N 69  
C   C4    C5     sing N N 70  
C   N4    H41    sing N N 71  
C   N4    H42    sing N N 72  
C   C5    C6     doub N N 73  
C   C5    H5     sing N N 74  
C   C6    H6     sing N N 75  
G   OP3   P      sing N N 76  
G   OP3   HOP3   sing N N 77  
G   P     OP1    doub N N 78  
G   P     OP2    sing N N 79  
G   P     "O5'"  sing N N 80  
G   OP2   HOP2   sing N N 81  
G   "O5'" "C5'"  sing N N 82  
G   "C5'" "C4'"  sing N N 83  
G   "C5'" "H5'"  sing N N 84  
G   "C5'" "H5''" sing N N 85  
G   "C4'" "O4'"  sing N N 86  
G   "C4'" "C3'"  sing N N 87  
G   "C4'" "H4'"  sing N N 88  
G   "O4'" "C1'"  sing N N 89  
G   "C3'" "O3'"  sing N N 90  
G   "C3'" "C2'"  sing N N 91  
G   "C3'" "H3'"  sing N N 92  
G   "O3'" "HO3'" sing N N 93  
G   "C2'" "O2'"  sing N N 94  
G   "C2'" "C1'"  sing N N 95  
G   "C2'" "H2'"  sing N N 96  
G   "O2'" "HO2'" sing N N 97  
G   "C1'" N9     sing N N 98  
G   "C1'" "H1'"  sing N N 99  
G   N9    C8     sing Y N 100 
G   N9    C4     sing Y N 101 
G   C8    N7     doub Y N 102 
G   C8    H8     sing N N 103 
G   N7    C5     sing Y N 104 
G   C5    C6     sing N N 105 
G   C5    C4     doub Y N 106 
G   C6    O6     doub N N 107 
G   C6    N1     sing N N 108 
G   N1    C2     sing N N 109 
G   N1    H1     sing N N 110 
G   C2    N2     sing N N 111 
G   C2    N3     doub N N 112 
G   N2    H21    sing N N 113 
G   N2    H22    sing N N 114 
G   N3    C4     sing N N 115 
HOH O     H1     sing N N 116 
HOH O     H2     sing N N 117 
LLL C11   O11    sing N N 118 
LLL C11   C21    sing N N 119 
LLL C11   O51    sing N N 120 
LLL C11   H11    sing N N 121 
LLL O11   C42    sing N N 122 
LLL C21   N21    sing N N 123 
LLL C21   C31    sing N N 124 
LLL C21   H21    sing N N 125 
LLL N21   H211   sing N N 126 
LLL N21   H212   sing N N 127 
LLL C31   C41    sing N N 128 
LLL C31   H311   sing N N 129 
LLL C31   H312   sing N N 130 
LLL C41   C51    sing N N 131 
LLL C41   H411   sing N N 132 
LLL C41   H412   sing N N 133 
LLL C51   O51    sing N N 134 
LLL C51   C61    sing N N 135 
LLL C51   H51    sing N N 136 
LLL C61   N61    sing N N 137 
LLL C61   H611   sing N N 138 
LLL C61   H612   sing N N 139 
LLL N61   H11A   sing N N 140 
LLL N61   H12A   sing N N 141 
LLL C12   N12    sing N N 142 
LLL C12   C22    sing N N 143 
LLL C12   C62    sing N N 144 
LLL C12   H12    sing N N 145 
LLL N12   H121   sing N N 146 
LLL N12   H122   sing N N 147 
LLL C22   C32    sing N N 148 
LLL C22   H221   sing N N 149 
LLL C22   H222   sing N N 150 
LLL C32   N32    sing N N 151 
LLL C32   C42    sing N N 152 
LLL C32   H32    sing N N 153 
LLL N32   H321   sing N N 154 
LLL N32   H322   sing N N 155 
LLL C42   C52    sing N N 156 
LLL C42   H42    sing N N 157 
LLL C52   O52    sing N N 158 
LLL C52   C62    sing N N 159 
LLL C52   H52    sing N N 160 
LLL O52   H3     sing N N 161 
LLL C62   O62    sing N N 162 
LLL C62   H62    sing N N 163 
LLL O62   C13    sing N N 164 
LLL C13   C23    sing N N 165 
LLL C13   O53    sing N N 166 
LLL C13   H13    sing N N 167 
LLL C23   O23    sing N N 168 
LLL C23   C33    sing N N 169 
LLL C23   H23    sing N N 170 
LLL O23   H2     sing N N 171 
LLL C33   N33    sing N N 172 
LLL C33   C43    sing N N 173 
LLL C33   H1     sing N N 174 
LLL N33   C93    sing N N 175 
LLL N33   H33    sing N N 176 
LLL C43   O43    sing N N 177 
LLL C43   C53    sing N N 178 
LLL C43   C83    sing N N 179 
LLL O43   H43    sing N N 180 
LLL C53   O53    sing N N 181 
LLL C53   H531   sing N N 182 
LLL C53   H532   sing N N 183 
LLL C83   H831   sing N N 184 
LLL C83   H832   sing N N 185 
LLL C83   H833   sing N N 186 
LLL C93   H931   sing N N 187 
LLL C93   H932   sing N N 188 
LLL C93   H933   sing N N 189 
U   OP3   P      sing N N 190 
U   OP3   HOP3   sing N N 191 
U   P     OP1    doub N N 192 
U   P     OP2    sing N N 193 
U   P     "O5'"  sing N N 194 
U   OP2   HOP2   sing N N 195 
U   "O5'" "C5'"  sing N N 196 
U   "C5'" "C4'"  sing N N 197 
U   "C5'" "H5'"  sing N N 198 
U   "C5'" "H5''" sing N N 199 
U   "C4'" "O4'"  sing N N 200 
U   "C4'" "C3'"  sing N N 201 
U   "C4'" "H4'"  sing N N 202 
U   "O4'" "C1'"  sing N N 203 
U   "C3'" "O3'"  sing N N 204 
U   "C3'" "C2'"  sing N N 205 
U   "C3'" "H3'"  sing N N 206 
U   "O3'" "HO3'" sing N N 207 
U   "C2'" "O2'"  sing N N 208 
U   "C2'" "C1'"  sing N N 209 
U   "C2'" "H2'"  sing N N 210 
U   "O2'" "HO2'" sing N N 211 
U   "C1'" N1     sing N N 212 
U   "C1'" "H1'"  sing N N 213 
U   N1    C2     sing N N 214 
U   N1    C6     sing N N 215 
U   C2    O2     doub N N 216 
U   C2    N3     sing N N 217 
U   N3    C4     sing N N 218 
U   N3    H3     sing N N 219 
U   C4    O4     doub N N 220 
U   C4    C5     sing N N 221 
U   C5    C6     doub N N 222 
U   C5    H5     sing N N 223 
U   C6    H6     sing N N 224 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
2ET3 'double helix'         
2ET3 'a-form double helix'  
2ET3 'mismatched base pair' 
2ET3 'internal loop'        
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A G 2  1_555 B C 22 1_555 -0.439 -0.182 -0.024 2.713   2.162   4.807   1  A_G2:C45_B  A 2  ? B 45 ? 19 1 
1 A C 3  1_555 B G 21 1_555 0.290  -0.264 -0.221 19.612  -8.973  -4.807  2  A_C3:G44_B  A 3  ? B 44 ? 19 1 
1 A G 4  1_555 B C 20 1_555 -0.137 -0.200 -0.772 -3.233  -4.593  0.654   3  A_G4:C43_B  A 4  ? B 43 ? 19 1 
1 A U 5  1_555 B U 19 1_555 -1.845 -1.366 -0.836 6.885   -3.509  -14.995 4  A_U5:U42_B  A 5  ? B 42 ? ?  ? 
1 A C 6  1_555 B G 18 1_555 0.128  -0.118 -0.337 -1.612  6.233   -2.524  5  A_C6:G41_B  A 6  ? B 41 ? 19 1 
1 A C 8  1_555 B G 15 1_555 0.222  -0.318 -0.474 6.811   -17.407 3.999   6  A_C8:G38_B  A 8  ? B 38 ? 19 1 
1 A A 9  1_555 B U 14 1_555 0.115  -0.351 0.809  2.124   -7.619  1.883   7  A_A9:U37_B  A 9  ? B 37 ? 20 1 
1 A C 10 1_555 B G 13 1_555 0.196  -0.048 0.100  10.013  -15.002 5.441   8  A_C10:G36_B A 10 ? B 36 ? 19 1 
1 A C 11 1_555 B G 12 1_555 -0.113 -0.211 0.236  -6.374  -1.996  -2.869  9  A_C11:G35_B A 11 ? B 35 ? 19 1 
1 A G 12 1_555 B C 11 1_555 0.142  -0.212 0.184  -0.825  -5.773  -1.378  10 A_G12:C34_B A 12 ? B 34 ? 19 1 
1 A G 13 1_555 B C 10 1_555 -0.323 -0.177 -0.182 -5.394  -15.190 0.779   11 A_G13:C33_B A 13 ? B 33 ? 19 1 
1 A U 14 1_555 B A 9  1_555 0.157  -0.142 0.186  0.256   -10.861 6.097   12 A_U14:A32_B A 14 ? B 32 ? 20 1 
1 A G 15 1_555 B C 8  1_555 -0.284 -0.178 -0.857 -15.047 -14.662 4.672   13 A_G15:C31_B A 15 ? B 31 ? 19 1 
1 A G 18 1_555 B C 6  1_555 0.021  -0.100 0.167  -3.161  -5.223  -3.051  14 A_G18:C29_B A 18 ? B 29 ? 19 1 
1 A U 19 1_555 B U 5  1_555 1.838  -1.763 -0.915 -0.607  -1.745  -15.653 15 A_U19:U28_B A 19 ? B 28 ? ?  ? 
1 A C 20 1_555 B G 4  1_555 0.279  -0.216 0.373  -5.057  3.488   -0.433  16 A_C20:G27_B A 20 ? B 27 ? 19 1 
1 A G 21 1_555 B C 3  1_555 -0.208 -0.078 -0.079 -10.473 -8.110  3.407   17 A_G21:C26_B A 21 ? B 26 ? 19 1 
1 A C 22 1_555 B G 2  1_555 0.196  -0.084 -0.237 9.232   -5.596  0.111   18 A_C22:G25_B A 22 ? B 25 ? 19 1 
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A G 2  1_555 B C 22 1_555 A C 3  1_555 B G 21 1_555 -0.989 -2.086 2.789 -1.080 -1.423 35.208 -3.261 1.494  2.897 -2.350 1.784   
35.252 1  AA_G2C3:G44C45_BB   A 2  ? B 45 ? A 3  ? B 44 ? 
1 A C 3  1_555 B G 21 1_555 A G 4  1_555 B C 20 1_555 -0.104 -1.764 3.774 1.990  12.444 28.601 -5.757 0.590  2.771 23.785 -3.803  
31.201 2  AA_C3G4:C43G44_BB   A 3  ? B 44 ? A 4  ? B 43 ? 
1 A G 4  1_555 B C 20 1_555 A U 5  1_555 B U 19 1_555 -0.827 -1.605 2.918 -2.149 0.950  27.871 -3.521 1.256  2.917 1.967  4.453   
27.968 3  AA_G4U5:U42C43_BB   A 4  ? B 43 ? A 5  ? B 42 ? 
1 A U 5  1_555 B U 19 1_555 A C 6  1_555 B G 18 1_555 1.215  -2.361 3.697 -4.512 -0.566 37.978 -3.526 -2.487 3.568 -0.866 6.903   
38.239 4  AA_U5C6:G41U42_BB   A 5  ? B 42 ? A 6  ? B 41 ? 
1 A C 6  1_555 B G 18 1_555 A C 8  1_555 B G 15 1_555 1.111  -3.092 6.377 -8.551 14.927 77.828 -3.172 -1.300 5.681 11.748 6.730   
79.411 5  AA_C6C8:G38G41_BB   A 6  ? B 41 ? A 8  ? B 38 ? 
1 A C 8  1_555 B G 15 1_555 A A 9  1_555 B U 14 1_555 0.061  -1.546 3.125 -8.705 11.714 35.884 -3.613 -1.042 2.443 18.117 13.464  
38.647 6  AA_C8A9:U37G38_BB   A 8  ? B 38 ? A 9  ? B 37 ? 
1 A A 9  1_555 B U 14 1_555 A C 10 1_555 B G 13 1_555 0.790  -2.201 2.925 7.425  -1.526 28.725 -3.994 -0.070 3.137 -3.010 -14.647 
29.688 7  AA_A9C10:G36U37_BB  A 9  ? B 37 ? A 10 ? B 36 ? 
1 A C 10 1_555 B G 13 1_555 A C 11 1_555 B G 12 1_555 -0.766 -2.343 3.319 -4.057 8.949  30.336 -5.788 0.708  2.617 16.564 7.510   
31.852 8  AA_C10C11:G35G36_BB A 10 ? B 36 ? A 11 ? B 35 ? 
1 A C 11 1_555 B G 12 1_555 A G 12 1_555 B C 11 1_555 -0.544 -2.077 2.874 -1.148 5.348  28.602 -5.098 0.875  2.472 10.702 2.297   
29.109 9  AA_C11G12:C34G35_BB A 11 ? B 35 ? A 12 ? B 34 ? 
1 A G 12 1_555 B C 11 1_555 A G 13 1_555 B C 10 1_555 0.086  -1.601 3.223 1.178  6.152  29.318 -4.285 0.062  2.837 11.984 -2.294  
29.965 10 AA_G12G13:C33C34_BB A 12 ? B 34 ? A 13 ? B 33 ? 
1 A G 13 1_555 B C 10 1_555 A U 14 1_555 B A 9  1_555 0.529  -1.228 3.066 -1.026 2.186  33.711 -2.439 -1.063 2.966 3.764  1.766   
33.794 11 AA_G13U14:A32C33_BB A 13 ? B 33 ? A 14 ? B 32 ? 
1 A U 14 1_555 B A 9  1_555 A G 15 1_555 B C 8  1_555 -0.079 -1.272 3.365 7.236  20.263 34.009 -4.019 0.888  2.235 31.089 -11.102 
40.073 12 AA_U14G15:C31A32_BB A 14 ? B 32 ? A 15 ? B 31 ? 
1 A G 15 1_555 B C 8  1_555 A G 18 1_555 B C 6  1_555 -1.343 -3.771 6.159 2.742  16.204 80.235 -3.620 1.152  5.413 12.455 -2.107  
81.621 13 AA_G15G18:C29C31_BB A 15 ? B 31 ? A 18 ? B 29 ? 
1 A G 18 1_555 B C 6  1_555 A U 19 1_555 B U 5  1_555 -1.700 -2.319 3.324 6.838  -2.298 33.904 -3.545 3.896  3.079 -3.886 -11.564 
34.641 14 AA_G18U19:U28C29_BB A 18 ? B 29 ? A 19 ? B 28 ? 
1 A U 19 1_555 B U 5  1_555 A C 20 1_555 B G 4  1_555 1.049  -2.129 3.449 -8.133 7.200  29.867 -5.137 -3.324 2.515 13.424 15.162  
31.738 15 AA_U19C20:G27U28_BB A 19 ? B 28 ? A 20 ? B 27 ? 
1 A C 20 1_555 B G 4  1_555 A G 21 1_555 B C 3  1_555 0.384  -2.045 3.027 6.206  9.362  26.332 -5.918 0.401  2.217 19.462 -12.903 
28.589 16 AA_C20G21:C26G27_BB A 20 ? B 27 ? A 21 ? B 26 ? 
1 A G 21 1_555 B C 3  1_555 A C 22 1_555 B G 2  1_555 -0.111 -1.838 2.838 2.129  -0.159 33.761 -3.136 0.489  2.834 -0.273 -3.661  
33.826 17 AA_G21C22:G25C26_BB A 21 ? B 26 ? A 22 ? B 25 ? 
# 
loop_
_pdbx_entity_nonpoly.entity_id 
_pdbx_entity_nonpoly.name 
_pdbx_entity_nonpoly.comp_id 
2 
;(2R,3R,4R,5R)-2-((1S,2S,3R,4S,6R)-4,6-DIAMINO-3-((2R,3R,6S)-3-AMINO-6-(AMINOMETHYL)-TETRAHYDRO-2H-PYRAN-2-YLOXY)-2-HYDR OXYCYCLOHEXYLOXY)-5-METHYL-4-(METHYLAMINO)-TETRAHYDRO-2H-PYRAN-3,5-DIOL
;
LLL 
3 water HOH 
# 
_pdbx_initial_refinement_model.id               1 
_pdbx_initial_refinement_model.entity_id_list   ? 
_pdbx_initial_refinement_model.type             'experimental model' 
_pdbx_initial_refinement_model.source_name      PDB 
_pdbx_initial_refinement_model.accession_code   1J7T 
_pdbx_initial_refinement_model.details          'PDB Entry: 1J7T' 
#