data_2KF0 # _entry.id 2KF0 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2KF0 pdb_00002kf0 10.2210/pdb2kf0/pdb RCSB RCSB101039 ? ? WWPDB D_1000101039 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2009-07-21 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2022-03-16 4 'Structure model' 1 3 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' 5 4 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' database_2 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_struct_assembly 4 3 'Structure model' pdbx_struct_oper_list 5 4 'Structure model' chem_comp_atom 6 4 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2KF0 _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2009-02-08 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _pdbx_database_related.content_type _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.details unspecified 1SY4 PDB 'U6 ISL structure at pH 7.0' unspecified 1SYZ PDB 'U6 ISL structure at pH 5.7' unspecified 2KEZ PDB . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Venditti, V.' 1 'Butcher, S.E.' 2 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'Minimum-energy path for a u6 RNA conformational change involving protonation, base-pair rearrangement and base flipping.' J.Mol.Biol. 391 894 905 2009 JMOBAK UK 0022-2836 0070 ? 19591840 10.1016/j.jmb.2009.07.003 1 'Structure of the U6 RNA intramolecular stem-loop harboring an S(P)-phosphorothioate modification.' Rna 9 533 542 2003 RNARFU UK 1355-8382 2122 ? 12702812 ? 2 'Dynamics in the U6 RNA intramolecular stem-loop: a base flipping conformational change.' Biochemistry 43 13739 13747 2004 BICHAW US 0006-2960 0033 ? 15504036 10.1021/bi048815y # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Venditti, V.' 1 ? primary 'Clos, L.' 2 ? primary 'Niccolai, N.' 3 ? primary 'Butcher, S.E.' 4 ? 1 'Reiter, N.J.' 5 ? 1 'Nikstad, L.J.' 6 ? 1 'Allmann, A.M.' 7 ? 1 'Johnson, R.J.' 8 ? 1 'Butcher, S.E.' 9 ? 2 'Reiter, N.J.' 10 ? 2 'Blad, H.' 11 ? 2 'Abildgaard, F.' 12 ? 2 'Butcher, S.E.' 13 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP*CP*AP*UP*AP*AP*GP*GP*AP*UP*GP*AP*AP*CP*C)-3') ; _entity.formula_weight 7668.615 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation A62G _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGUUCCCCUGCAUAAGGAUGAACC _entity_poly.pdbx_seq_one_letter_code_can GGUUCCCCUGCAUAAGGAUGAACC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 U n 1 5 C n 1 6 C n 1 7 C n 1 8 C n 1 9 U n 1 10 G n 1 11 C n 1 12 A n 1 13 U n 1 14 A n 1 15 A n 1 16 G n 1 17 G n 1 18 A n 1 19 U n 1 20 G n 1 21 A n 1 22 A n 1 23 C n 1 24 C n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 U 4 4 4 U U A . n A 1 5 C 5 5 5 C C A . n A 1 6 C 6 6 6 C C A . n A 1 7 C 7 7 7 C C A . n A 1 8 C 8 8 8 C C A . n A 1 9 U 9 9 9 U U A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 A 12 12 12 A A A . n A 1 13 U 13 13 13 U U A . n A 1 14 A 14 14 14 A A A . n A 1 15 A 15 15 15 A A A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 U 19 19 19 U U A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2KF0 _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2KF0 _struct.title 'NMR structure of U6 ISL at pH 7.0' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2KF0 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'U6 RNA, stem loop, bulge, internal loop, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2KF0 _struct_ref.pdbx_db_accession 2KF0 _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2KF0 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 24 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2KF0 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 24 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 24 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 1 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 2 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 22 N1 ? ? A U 3 A A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 22 N6 ? ? A U 3 A A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 21 N1 ? ? A U 4 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 21 N6 ? ? A U 4 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 5 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 5 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 5 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N4 ? ? ? 1_555 A A 18 N1 ? ? A C 6 A A 18 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 7 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 7 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 7 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 8 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 8 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 8 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 15 N1 ? ? A U 9 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 15 N6 ? ? A U 9 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N2 ? ? ? 1_555 A A 14 N7 ? ? A G 10 A A 14 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog24 hydrog ? ? A G 10 N3 ? ? ? 1_555 A A 14 N6 ? ? A G 10 A A 14 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A A 14 ? ? "C1'" A A 14 ? ? N9 A A 14 ? ? 112.77 108.50 4.27 0.70 N 2 2 "C5'" A G 1 ? ? "C4'" A G 1 ? ? "C3'" A G 1 ? ? 105.91 115.20 -9.29 1.40 N 3 8 "O4'" A A 12 ? ? "C1'" A A 12 ? ? N9 A A 12 ? ? 113.13 108.50 4.63 0.70 N 4 9 "C5'" A G 1 ? ? "C4'" A G 1 ? ? "C3'" A G 1 ? ? 105.78 115.20 -9.42 1.40 N 5 9 "O4'" A G 2 ? ? "C1'" A G 2 ? ? N9 A G 2 ? ? 112.82 108.50 4.32 0.70 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 2 G A 16 ? ? 0.070 'SIDE CHAIN' 2 3 G A 16 ? ? 0.065 'SIDE CHAIN' 3 4 G A 16 ? ? 0.066 'SIDE CHAIN' 4 5 G A 16 ? ? 0.067 'SIDE CHAIN' 5 6 G A 16 ? ? 0.063 'SIDE CHAIN' 6 7 G A 16 ? ? 0.067 'SIDE CHAIN' 7 8 G A 16 ? ? 0.065 'SIDE CHAIN' 8 10 G A 16 ? ? 0.062 'SIDE CHAIN' # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 12 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2KF0 _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2KF0 _pdbx_nmr_representative.selection_criteria 'closest to the average' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '2 mM RNA, 100% D2O' 1 '100% D2O' '2 mM RNA, 90% H2O/10% D2O' 2 '90% H2O/10% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id ;RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP*CP*AP*UP*AP*AP*GP*GP*AP*UP*GP*AP*AP*CP*C)-3')-1 ; 2 ? mM ? 1 ;RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP*CP*AP*UP*AP*AP*GP*GP*AP*UP*GP*AP*AP*CP*C)-3')-2 ; 2 ? mM ? 2 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 50 7.0 ambient ? 303 K 2 50 7.0 ambient ? 283 K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-1H NOESY' 2 2 2 '2D 1H-1H NOESY' 1 3 1 '2D 1H-1H TOCSY' # _pdbx_nmr_refine.entry_id 2KF0 _pdbx_nmr_refine.method 'molecular dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Case, D. et al.' refinement Amber 9.0 1 'Goddard, T. et al.' 'chemical shift assignment' Sparky ? 2 'Bruker Biospin' processing XwinNMR ? 3 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2KF0 'double helix' 2KF0 'a-form double helix' 2KF0 'hairpin loop' 2KF0 'bulge loop' 2KF0 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 24 1_555 -0.425 -0.192 -0.551 -15.481 8.256 -3.899 1 A_G1:C24_A A 1 ? A 24 ? 19 1 1 A G 2 1_555 A C 23 1_555 0.010 -0.050 -0.356 -11.081 -14.020 0.524 2 A_G2:C23_A A 2 ? A 23 ? 19 1 1 A U 3 1_555 A A 22 1_555 -0.016 -0.055 -0.282 -7.164 -14.135 0.112 3 A_U3:A22_A A 3 ? A 22 ? 20 1 1 A U 4 1_555 A A 21 1_555 -0.039 -0.029 -0.443 8.368 -12.166 -2.146 4 A_U4:A21_A A 4 ? A 21 ? 20 1 1 A C 5 1_555 A G 20 1_555 0.526 -0.182 -0.247 8.897 -16.333 0.171 5 A_C5:G20_A A 5 ? A 20 ? 19 1 1 A C 6 1_555 A A 18 1_555 -2.110 0.364 -0.805 14.714 -24.551 2.997 6 A_C6:A18_A A 6 ? A 18 ? ? ? 1 A C 7 1_555 A G 17 1_555 0.055 -0.047 -0.463 23.319 -27.910 1.416 7 A_C7:G17_A A 7 ? A 17 ? 19 1 1 A C 8 1_555 A G 16 1_555 0.037 -0.150 -0.452 2.187 -24.733 3.987 8 A_C8:G16_A A 8 ? A 16 ? 19 1 1 A U 9 1_555 A A 15 1_555 -0.537 -0.117 -0.704 5.479 -15.593 10.381 9 A_U9:A15_A A 9 ? A 15 ? 20 1 1 A G 10 1_555 A A 14 1_555 5.864 -4.109 -1.989 -4.543 5.993 7.898 10 A_G10:A14_A A 10 ? A 14 ? 11 5 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 24 1_555 A G 2 1_555 A C 23 1_555 0.028 -1.825 3.536 1.290 0.936 33.652 -3.312 0.178 3.484 1.615 -2.226 33.689 1 AA_G1G2:C23C24_AA A 1 ? A 24 ? A 2 ? A 23 ? 1 A G 2 1_555 A C 23 1_555 A U 3 1_555 A A 22 1_555 -0.170 -1.853 3.269 0.997 6.053 30.154 -4.613 0.505 2.845 11.486 -1.891 30.758 2 AA_G2U3:A22C23_AA A 2 ? A 23 ? A 3 ? A 22 ? 1 A U 3 1_555 A A 22 1_555 A U 4 1_555 A A 21 1_555 0.080 -1.501 3.103 4.012 8.543 27.276 -4.699 0.631 2.513 17.466 -8.202 28.834 3 AA_U3U4:A21A22_AA A 3 ? A 22 ? A 4 ? A 21 ? 1 A U 4 1_555 A A 21 1_555 A C 5 1_555 A G 20 1_555 0.408 -1.124 3.510 1.632 13.401 28.061 -4.678 -0.447 2.723 25.830 -3.146 31.081 4 AA_U4C5:G20A21_AA A 4 ? A 21 ? A 5 ? A 20 ? 1 A C 5 1_555 A G 20 1_555 A C 6 1_555 A A 18 1_555 2.954 -1.698 4.727 -11.729 10.785 36.949 -4.012 -5.976 3.093 16.129 17.541 40.128 5 AA_C5C6:A18G20_AA A 5 ? A 20 ? A 6 ? A 18 ? 1 A C 6 1_555 A A 18 1_555 A C 7 1_555 A G 17 1_555 0.003 -1.012 3.525 -1.262 2.715 38.004 -1.915 -0.176 3.445 4.162 1.935 38.117 6 AA_C6C7:G17A18_AA A 6 ? A 18 ? A 7 ? A 17 ? 1 A C 7 1_555 A G 17 1_555 A C 8 1_555 A G 16 1_555 -0.903 -1.373 3.906 0.330 29.028 26.474 -5.655 1.391 1.665 48.506 -0.551 39.096 7 AA_C7C8:G16G17_AA A 7 ? A 17 ? A 8 ? A 16 ? 1 A C 8 1_555 A G 16 1_555 A U 9 1_555 A A 15 1_555 0.367 -0.917 3.563 -3.664 15.425 23.106 -5.574 -1.632 2.408 33.867 8.043 27.961 8 AA_C8U9:A15G16_AA A 8 ? A 16 ? A 9 ? A 15 ? 1 A U 9 1_555 A A 15 1_555 A G 10 1_555 A A 14 1_555 -0.003 1.195 4.641 6.483 17.135 60.398 0.013 0.432 4.771 16.624 -6.290 62.863 9 AA_U9G10:A14A15_AA A 9 ? A 15 ? A 10 ? A 14 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 750 Bruker DMX 1 'Bruker DMX' 600 Bruker DMX 2 'Bruker DMX' # _atom_sites.entry_id 2KF0 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_