data_2KF7 # _entry.id 2KF7 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2KF7 pdb_00002kf7 10.2210/pdb2kf7/pdb RCSB RCSB101046 ? ? WWPDB D_1000101046 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2009-03-24 2 'Structure model' 1 1 2011-07-13 3 'Structure model' 1 2 2024-05-01 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' chem_comp_atom 2 3 'Structure model' chem_comp_bond 3 3 'Structure model' database_2 4 3 'Structure model' pdbx_nmr_software 5 3 'Structure model' pdbx_nmr_spectrometer 6 3 'Structure model' struct_conn # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_nmr_software.name' 4 3 'Structure model' '_pdbx_nmr_spectrometer.model' 5 3 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2KF7 _pdbx_database_status.process_site PDBJ _pdbx_database_status.recvd_initial_deposition_date 2009-02-12 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _pdbx_database_related.content_type _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.details unspecified 143D PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF NA' unspecified 1K8P PDB 'HUMAN TELOMERE DNA CRYSTAL STRUCTURE IN THE PRESENCE OF K' unspecified 2GKU PDB 'END-MODIFIED HUMAN TELOMERE DNA CRYSTAL STRUCTURE IN THE PRESENCE OF K' unspecified 2AQY PDB '3 REPEATS OF HUMAN TELOMERE DNA SOLUTION STRUCTURE' unspecified 2JSK PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS 16BRG FORM 1' unspecified 2JSL PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS NATURAL FORM 2' unspecified 2JSM PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS NATURAL FORM 1' unspecified 2JSQ PDB 'HUMAN TELOMERE DNA SOLUTION STRUCTURE IN THE PRESENCE OF K CATIONS FORM 2 15BRG' unspecified 2KF8 PDB 'STRUCTURE OF A TWO-G-TETRAD BASKET-TYPE INTRAMOLECULAR G-QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN K+ SOLUTION' # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lim, K.W.' 1 'Amrane, S.' 2 'Bouaziz, S.' 3 'Xu, W.' 4 'Mu, Y.' 5 'Patel, D.J.' 6 'Luu, K.N.' 7 'Phan, A.T.' 8 # _citation.id primary _citation.title 'Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers' _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_volume 131 _citation.page_first 4301 _citation.page_last 4309 _citation.year 2009 _citation.journal_id_ASTM JACSAT _citation.country US _citation.journal_id_ISSN 0002-7863 _citation.journal_id_CSD 0004 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 19271707 _citation.pdbx_database_id_DOI 10.1021/ja807503g # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lim, K.W.' 1 ? primary 'Amrane, S.' 2 ? primary 'Bouaziz, S.' 3 ? primary 'Xu, W.' 4 ? primary 'Mu, Y.' 5 ? primary 'Patel, D.J.' 6 ? primary 'Luu, K.N.' 7 ? primary 'Phan, A.T.' 8 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'HUMAN TELOMERE DNA' _entity.formula_weight 7053.379 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(DG)(DG)(DG)(DT)(DT)(DA)(BGM)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG) (DG)(DG)(DT) ; _entity_poly.pdbx_seq_one_letter_code_can GGGTTAGGGTTAGGGTTAGGGT _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DG n 1 4 DT n 1 5 DT n 1 6 DA n 1 7 BGM n 1 8 DG n 1 9 DG n 1 10 DT n 1 11 DT n 1 12 DA n 1 13 DG n 1 14 DG n 1 15 DG n 1 16 DT n 1 17 DT n 1 18 DA n 1 19 DG n 1 20 DG n 1 21 DG n 1 22 DT n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'Nucleotide synthesis' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight BGM 'DNA linking' n "8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H13 Br N5 O7 P' 426.117 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DT 4 4 4 DT DT A . n A 1 5 DT 5 5 5 DT DT A . n A 1 6 DA 6 6 6 DA DA A . n A 1 7 BGM 7 7 7 BGM BGM A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DT 16 16 16 DT DT A . n A 1 17 DT 17 17 17 DT DT A . n A 1 18 DA 18 18 18 DA DA A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DT 22 22 22 DT DT A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2KF7 _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2KF7 _struct.title ;Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by human telomeric repeats in K+ solution (with G7-to-BRG substitution) ; _struct.pdbx_model_details 'lowest energy, model 1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2KF7 _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'anticancer targets, human telomere, intramolecular G-quadruplexes, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_code 2KF7 _struct_ref.db_name PDB _struct_ref.entity_id 1 _struct_ref.pdbx_db_accession 2KF7 _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_seq_one_letter_code GGGTTAGGGTTAGGGTTAGGGT _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2KF7 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 22 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2KF7 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 22 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 22 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A DA 6 "O3'" ? ? ? 1_555 A BGM 7 P ? ? A DA 6 A BGM 7 1_555 ? ? ? ? ? ? ? 1.616 ? ? covale2 covale both ? A BGM 7 "O3'" ? ? ? 1_555 A DG 8 P ? ? A BGM 7 A DG 8 1_555 ? ? ? ? ? ? ? 1.624 ? ? hydrog1 hydrog ? ? A DG 1 N7 ? ? ? 1_555 A DG 8 N2 ? ? A DG 1 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DG 8 N1 ? ? A DG 1 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DG 14 O6 ? ? A DG 1 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DG 14 N7 ? ? A DG 1 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A BGM 7 O6 ? ? A DG 2 A BGM 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A BGM 7 N7 ? ? A DG 2 A BGM 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 15 N2 ? ? A DG 2 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 15 N1 ? ? A DG 2 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DA 6 N7 ? ? A DG 3 A DA 6 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog10 hydrog ? ? A DG 3 N3 ? ? ? 1_555 A DA 6 N6 ? ? A DG 3 A DA 6 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog11 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DA 18 N1 ? ? A DG 3 A DA 18 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog12 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DA 18 N6 ? ? A DG 3 A DA 18 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A DT 5 N3 ? ? ? 1_555 A DA 18 N1 ? ? A DT 5 A DA 18 1_555 ? ? ? ? ? ? 'DT-DA PAIR' ? ? ? hydrog14 hydrog ? ? A BGM 7 N1 ? ? ? 1_555 A DG 19 O6 ? ? A BGM 7 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A BGM 7 N2 ? ? ? 1_555 A DG 19 N7 ? ? A BGM 7 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 8 N7 ? ? ? 1_555 A DG 20 N2 ? ? A DG 8 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 8 O6 ? ? ? 1_555 A DG 20 N1 ? ? A DG 8 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 13 O6 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? hydrog19 hydrog ? ? A DG 9 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 9 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 9 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 9 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DT 11 N3 ? ? ? 1_555 A DT 22 O2 ? ? A DT 11 A DT 22 1_555 ? ? ? ? ? ? 'DT-DT MISPAIR' ? ? ? hydrog22 hydrog ? ? A DG 14 N1 ? ? ? 1_555 A DG 20 O6 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 14 N2 ? ? ? 1_555 A DG 20 N7 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 15 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 2 _pdbx_validate_rmsd_bond.auth_atom_id_1 "C5'" _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 DA _pdbx_validate_rmsd_bond.auth_seq_id_1 12 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 "C4'" _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 DA _pdbx_validate_rmsd_bond.auth_seq_id_2 12 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.556 _pdbx_validate_rmsd_bond.bond_target_value 1.512 _pdbx_validate_rmsd_bond.bond_deviation 0.044 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.007 _pdbx_validate_rmsd_bond.linker_flag N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 C6 A DT 4 ? ? C5 A DT 4 ? ? C7 A DT 4 ? ? 119.26 122.90 -3.64 0.60 N 2 2 C6 A DT 4 ? ? C5 A DT 4 ? ? C7 A DT 4 ? ? 119.20 122.90 -3.70 0.60 N 3 8 C6 A DT 4 ? ? C5 A DT 4 ? ? C7 A DT 4 ? ? 119.14 122.90 -3.76 0.60 N 4 9 C6 A DT 16 ? ? C5 A DT 16 ? ? C7 A DT 16 ? ? 119.26 122.90 -3.64 0.60 N # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id BGM _pdbx_struct_mod_residue.label_seq_id 7 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id BGM _pdbx_struct_mod_residue.auth_seq_id 7 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id DG _pdbx_struct_mod_residue.details ? # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'back calculated data agree with experimental NOESY spectrum' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2KF7 _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation 0.193 _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation 0.239 _pdbx_nmr_ensemble.representative_conformer 1 _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_ensemble_rms.atom_type ? _pdbx_nmr_ensemble_rms.bond_angle_rms_dev ? _pdbx_nmr_ensemble_rms.bond_angle_rms_dev_error ? _pdbx_nmr_ensemble_rms.chain_range_begin ? _pdbx_nmr_ensemble_rms.chain_range_end ? _pdbx_nmr_ensemble_rms.coord_average_rmsd_method ? _pdbx_nmr_ensemble_rms.covalent_bond_rms_dev ? _pdbx_nmr_ensemble_rms.covalent_bond_rms_dev_error ? _pdbx_nmr_ensemble_rms.dihedral_angles_rms_dev ? _pdbx_nmr_ensemble_rms.dihedral_angles_rms_dev_error ? _pdbx_nmr_ensemble_rms.distance_rms_dev 0.018 _pdbx_nmr_ensemble_rms.distance_rms_dev_error 0.002 _pdbx_nmr_ensemble_rms.entry_id 2KF7 _pdbx_nmr_ensemble_rms.improper_torsion_angle_rms_dev ? _pdbx_nmr_ensemble_rms.improper_torsion_angle_rms_dev_error ? _pdbx_nmr_ensemble_rms.peptide_planarity_rms_dev ? _pdbx_nmr_ensemble_rms.peptide_planarity_rms_dev_error ? _pdbx_nmr_ensemble_rms.residue_range_begin ? _pdbx_nmr_ensemble_rms.residue_range_end ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2KF7 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system ;0.5-2.5mM DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*(BGM)P*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-1, 70mM potassium chloride-2, 20mM potassium phosphate-3, 90% H2O/10% D2O ; 1 '90% H2O/10% D2O' ;0.5-2.5mM DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*(BGM)P*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-4, 70mM potassium chloride-5, 20mM potassium phosphate-6, 100% D2O ; 2 '100% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id ;DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*(BGM)P*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-1 ; 0.5 ? mM ? 1 'potassium chloride-2' 70 ? mM ? 1 'potassium phosphate-3' 20 ? mM ? 1 ;DNA (5'-D(*DGP*DGP*DGP*DTP*DTP*DAP*(BGM)P*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3')-4 ; 0.5 ? mM ? 2 'potassium chloride-5' 70 ? mM ? 2 'potassium phosphate-6' 20 ? mM ? 2 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 ? 7 ? ? 298 K 2 ? 5 ? ? 283 K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 2 '2D 1H-13C HSQC' 1 2 2 '2D 1H-1H TOCSY' 1 3 2 '2D 1H-1H COSY' 1 4 1 '2D 1H-1H NOESY' 1 5 2 '2D 1H-1H NOESY' 2 6 2 '2D 1H-1H NOESY' 1 7 1 '2D 1H-15N HSQC' # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2KF7 _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count 42 _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count 8 _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count 4 _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count 0 _pdbx_nmr_constraints.NA_other-angle_constraints_total_count 8 _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count 0 _pdbx_nmr_constraints.NOE_constraints_total 580 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count 272 _pdbx_nmr_constraints.NOE_long_range_total_count 40 _pdbx_nmr_constraints.NOE_medium_range_total_count 49 _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count 219 _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # _pdbx_nmr_refine.entry_id 2KF7 _pdbx_nmr_refine.method 'matrix relaxation, molecular dynamics, DGSA-distance geometry simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Felix NMR, Inc.' 'peak picking' Felix 2007 1 'Bruker Biospin' processing TopSpin . 2 'Schwieters, Kuszewski, Tjandra, Clore' 'structure solution' 'X-PLOR NIH' 2.21 3 'Schwieters, Kuszewski, Tjandra, Clore' refinement 'X-PLOR NIH' 2.21 4 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal BGM P P N N 1 BGM OP1 O N N 2 BGM OP2 O N N 3 BGM "O5'" O N N 4 BGM "C5'" C N N 5 BGM "C4'" C N R 6 BGM "O4'" O N N 7 BGM "C1'" C N R 8 BGM N9 N Y N 9 BGM C8 C Y N 10 BGM N7 N Y N 11 BGM C5 C Y N 12 BGM C4 C Y N 13 BGM N3 N N N 14 BGM C2 C N N 15 BGM N2 N N N 16 BGM N1 N N N 17 BGM C6 C N N 18 BGM O6 O N N 19 BGM "C2'" C N N 20 BGM "C3'" C N S 21 BGM "O3'" O N N 22 BGM OP3 O N N 23 BGM BR BR N N 24 BGM HOP2 H N N 25 BGM "H5'" H N N 26 BGM "H5''" H N N 27 BGM "H4'" H N N 28 BGM "H1'" H N N 29 BGM H21 H N N 30 BGM H22 H N N 31 BGM H1 H N N 32 BGM "H2'" H N N 33 BGM "H2''" H N N 34 BGM "H3'" H N N 35 BGM "HO3'" H N N 36 BGM HOP3 H N N 37 DA OP3 O N N 38 DA P P N N 39 DA OP1 O N N 40 DA OP2 O N N 41 DA "O5'" O N N 42 DA "C5'" C N N 43 DA "C4'" C N R 44 DA "O4'" O N N 45 DA "C3'" C N S 46 DA "O3'" O N N 47 DA "C2'" C N N 48 DA "C1'" C N R 49 DA N9 N Y N 50 DA C8 C Y N 51 DA N7 N Y N 52 DA C5 C Y N 53 DA C6 C Y N 54 DA N6 N N N 55 DA N1 N Y N 56 DA C2 C Y N 57 DA N3 N Y N 58 DA C4 C Y N 59 DA HOP3 H N N 60 DA HOP2 H N N 61 DA "H5'" H N N 62 DA "H5''" H N N 63 DA "H4'" H N N 64 DA "H3'" H N N 65 DA "HO3'" H N N 66 DA "H2'" H N N 67 DA "H2''" H N N 68 DA "H1'" H N N 69 DA H8 H N N 70 DA H61 H N N 71 DA H62 H N N 72 DA H2 H N N 73 DG OP3 O N N 74 DG P P N N 75 DG OP1 O N N 76 DG OP2 O N N 77 DG "O5'" O N N 78 DG "C5'" C N N 79 DG "C4'" C N R 80 DG "O4'" O N N 81 DG "C3'" C N S 82 DG "O3'" O N N 83 DG "C2'" C N N 84 DG "C1'" C N R 85 DG N9 N Y N 86 DG C8 C Y N 87 DG N7 N Y N 88 DG C5 C Y N 89 DG C6 C N N 90 DG O6 O N N 91 DG N1 N N N 92 DG C2 C N N 93 DG N2 N N N 94 DG N3 N N N 95 DG C4 C Y N 96 DG HOP3 H N N 97 DG HOP2 H N N 98 DG "H5'" H N N 99 DG "H5''" H N N 100 DG "H4'" H N N 101 DG "H3'" H N N 102 DG "HO3'" H N N 103 DG "H2'" H N N 104 DG "H2''" H N N 105 DG "H1'" H N N 106 DG H8 H N N 107 DG H1 H N N 108 DG H21 H N N 109 DG H22 H N N 110 DT OP3 O N N 111 DT P P N N 112 DT OP1 O N N 113 DT OP2 O N N 114 DT "O5'" O N N 115 DT "C5'" C N N 116 DT "C4'" C N R 117 DT "O4'" O N N 118 DT "C3'" C N S 119 DT "O3'" O N N 120 DT "C2'" C N N 121 DT "C1'" C N R 122 DT N1 N N N 123 DT C2 C N N 124 DT O2 O N N 125 DT N3 N N N 126 DT C4 C N N 127 DT O4 O N N 128 DT C5 C N N 129 DT C7 C N N 130 DT C6 C N N 131 DT HOP3 H N N 132 DT HOP2 H N N 133 DT "H5'" H N N 134 DT "H5''" H N N 135 DT "H4'" H N N 136 DT "H3'" H N N 137 DT "HO3'" H N N 138 DT "H2'" H N N 139 DT "H2''" H N N 140 DT "H1'" H N N 141 DT H3 H N N 142 DT H71 H N N 143 DT H72 H N N 144 DT H73 H N N 145 DT H6 H N N 146 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal BGM P OP1 doub N N 1 BGM P OP2 sing N N 2 BGM P "O5'" sing N N 3 BGM P OP3 sing N N 4 BGM OP2 HOP2 sing N N 5 BGM "O5'" "C5'" sing N N 6 BGM "C5'" "C4'" sing N N 7 BGM "C5'" "H5'" sing N N 8 BGM "C5'" "H5''" sing N N 9 BGM "C4'" "O4'" sing N N 10 BGM "C4'" "C3'" sing N N 11 BGM "C4'" "H4'" sing N N 12 BGM "O4'" "C1'" sing N N 13 BGM "C1'" N9 sing N N 14 BGM "C1'" "C2'" sing N N 15 BGM "C1'" "H1'" sing N N 16 BGM N9 C8 sing Y N 17 BGM N9 C4 sing Y N 18 BGM C8 N7 doub Y N 19 BGM C8 BR sing N N 20 BGM N7 C5 sing Y N 21 BGM C5 C4 doub Y N 22 BGM C5 C6 sing N N 23 BGM C4 N3 sing N N 24 BGM N3 C2 doub N N 25 BGM C2 N2 sing N N 26 BGM C2 N1 sing N N 27 BGM N2 H21 sing N N 28 BGM N2 H22 sing N N 29 BGM N1 C6 sing N N 30 BGM N1 H1 sing N N 31 BGM C6 O6 doub N N 32 BGM "C2'" "C3'" sing N N 33 BGM "C2'" "H2'" sing N N 34 BGM "C2'" "H2''" sing N N 35 BGM "C3'" "O3'" sing N N 36 BGM "C3'" "H3'" sing N N 37 BGM "O3'" "HO3'" sing N N 38 BGM OP3 HOP3 sing N N 39 DA OP3 P sing N N 40 DA OP3 HOP3 sing N N 41 DA P OP1 doub N N 42 DA P OP2 sing N N 43 DA P "O5'" sing N N 44 DA OP2 HOP2 sing N N 45 DA "O5'" "C5'" sing N N 46 DA "C5'" "C4'" sing N N 47 DA "C5'" "H5'" sing N N 48 DA "C5'" "H5''" sing N N 49 DA "C4'" "O4'" sing N N 50 DA "C4'" "C3'" sing N N 51 DA "C4'" "H4'" sing N N 52 DA "O4'" "C1'" sing N N 53 DA "C3'" "O3'" sing N N 54 DA "C3'" "C2'" sing N N 55 DA "C3'" "H3'" sing N N 56 DA "O3'" "HO3'" sing N N 57 DA "C2'" "C1'" sing N N 58 DA "C2'" "H2'" sing N N 59 DA "C2'" "H2''" sing N N 60 DA "C1'" N9 sing N N 61 DA "C1'" "H1'" sing N N 62 DA N9 C8 sing Y N 63 DA N9 C4 sing Y N 64 DA C8 N7 doub Y N 65 DA C8 H8 sing N N 66 DA N7 C5 sing Y N 67 DA C5 C6 sing Y N 68 DA C5 C4 doub Y N 69 DA C6 N6 sing N N 70 DA C6 N1 doub Y N 71 DA N6 H61 sing N N 72 DA N6 H62 sing N N 73 DA N1 C2 sing Y N 74 DA C2 N3 doub Y N 75 DA C2 H2 sing N N 76 DA N3 C4 sing Y N 77 DG OP3 P sing N N 78 DG OP3 HOP3 sing N N 79 DG P OP1 doub N N 80 DG P OP2 sing N N 81 DG P "O5'" sing N N 82 DG OP2 HOP2 sing N N 83 DG "O5'" "C5'" sing N N 84 DG "C5'" "C4'" sing N N 85 DG "C5'" "H5'" sing N N 86 DG "C5'" "H5''" sing N N 87 DG "C4'" "O4'" sing N N 88 DG "C4'" "C3'" sing N N 89 DG "C4'" "H4'" sing N N 90 DG "O4'" "C1'" sing N N 91 DG "C3'" "O3'" sing N N 92 DG "C3'" "C2'" sing N N 93 DG "C3'" "H3'" sing N N 94 DG "O3'" "HO3'" sing N N 95 DG "C2'" "C1'" sing N N 96 DG "C2'" "H2'" sing N N 97 DG "C2'" "H2''" sing N N 98 DG "C1'" N9 sing N N 99 DG "C1'" "H1'" sing N N 100 DG N9 C8 sing Y N 101 DG N9 C4 sing Y N 102 DG C8 N7 doub Y N 103 DG C8 H8 sing N N 104 DG N7 C5 sing Y N 105 DG C5 C6 sing N N 106 DG C5 C4 doub Y N 107 DG C6 O6 doub N N 108 DG C6 N1 sing N N 109 DG N1 C2 sing N N 110 DG N1 H1 sing N N 111 DG C2 N2 sing N N 112 DG C2 N3 doub N N 113 DG N2 H21 sing N N 114 DG N2 H22 sing N N 115 DG N3 C4 sing N N 116 DT OP3 P sing N N 117 DT OP3 HOP3 sing N N 118 DT P OP1 doub N N 119 DT P OP2 sing N N 120 DT P "O5'" sing N N 121 DT OP2 HOP2 sing N N 122 DT "O5'" "C5'" sing N N 123 DT "C5'" "C4'" sing N N 124 DT "C5'" "H5'" sing N N 125 DT "C5'" "H5''" sing N N 126 DT "C4'" "O4'" sing N N 127 DT "C4'" "C3'" sing N N 128 DT "C4'" "H4'" sing N N 129 DT "O4'" "C1'" sing N N 130 DT "C3'" "O3'" sing N N 131 DT "C3'" "C2'" sing N N 132 DT "C3'" "H3'" sing N N 133 DT "O3'" "HO3'" sing N N 134 DT "C2'" "C1'" sing N N 135 DT "C2'" "H2'" sing N N 136 DT "C2'" "H2''" sing N N 137 DT "C1'" N1 sing N N 138 DT "C1'" "H1'" sing N N 139 DT N1 C2 sing N N 140 DT N1 C6 sing N N 141 DT C2 O2 doub N N 142 DT C2 N3 sing N N 143 DT N3 C4 sing N N 144 DT N3 H3 sing N N 145 DT C4 O4 doub N N 146 DT C4 C5 sing N N 147 DT C5 C7 sing N N 148 DT C5 C6 doub N N 149 DT C7 H71 sing N N 150 DT C7 H72 sing N N 151 DT C7 H73 sing N N 152 DT C6 H6 sing N N 153 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2KF7 'double helix' 2KF7 'z-form double helix' 2KF7 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 A DA 18 1_555 0.136 1.532 -0.321 -17.842 16.459 24.820 1 A_DG3:DA18_A A 3 ? A 18 ? 8 ? 1 A DG 15 1_555 A DG 19 1_555 1.444 -3.484 0.262 -5.717 10.385 -90.162 2 A_DG15:DG19_A A 15 ? A 19 ? 6 ? 1 A BGM 7 1_555 A DG 2 1_555 -2.057 -3.131 -0.473 3.585 6.394 87.823 3 A_BGM7:DG2_A A 7 ? A 2 ? 6 ? 1 A DG 8 1_555 A DG 1 1_555 1.580 3.432 0.176 6.858 -19.173 -89.966 4 A_DG8:DG1_A A 8 ? A 1 ? 6 ? 1 A DG 20 1_555 A DG 14 1_555 -1.657 -3.330 0.485 6.027 -7.705 90.013 5 A_DG20:DG14_A A 20 ? A 14 ? 6 ? 1 A DG 21 1_555 A DG 9 1_555 2.171 2.711 -0.642 -10.950 6.535 -91.213 6 A_DG21:DG9_A A 21 ? A 9 ? 6 ? 1 A DT 22 1_555 A DT 11 1_555 -1.714 -2.748 -0.650 -18.820 -10.741 -160.421 7 A_DT22:DT11_A A 22 ? A 11 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 A DA 18 1_555 A DG 15 1_555 A DG 19 1_555 3.093 1.245 3.146 -5.009 2.401 -155.985 -0.644 1.566 3.169 -1.227 -2.560 -156.014 1 AA_DG3DG15:DG19DA18_AA A 3 ? A 18 ? A 15 ? A 19 ? 1 A BGM 7 1_555 A DG 2 1_555 A DG 8 1_555 A DG 1 1_555 3.502 0.051 0.079 -77.134 159.255 178.807 0.025 -1.751 0.064 79.628 38.567 179.968 2 AA_BGM7DG8:DG1DG2_AA A 7 ? A 2 ? A 8 ? A 1 ? 1 A DG 8 1_555 A DG 1 1_555 A DG 20 1_555 A DG 14 1_555 1.457 3.486 0.410 4.408 -6.953 -178.819 -1.743 0.729 0.412 3.477 2.204 -178.822 3 AA_DG8DG20:DG14DG1_AA A 8 ? A 1 ? A 20 ? A 14 ? 1 A DG 20 1_555 A DG 14 1_555 A DG 21 1_555 A DG 9 1_555 -1.735 -3.227 3.651 1.263 5.506 121.861 -1.901 1.005 3.552 3.149 -0.722 121.938 4 AA_DG20DG21:DG9DG14_AA A 20 ? A 14 ? A 21 ? A 9 ? 1 A DG 21 1_555 A DG 9 1_555 A DT 22 1_555 A DT 11 1_555 1.087 1.528 2.831 4.780 0.845 66.435 1.363 -0.824 2.912 0.770 -4.357 66.592 5 AA_DG21DT22:DT11DG9_AA A 21 ? A 9 ? A 22 ? A 11 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Bruker AVANCE 1 'Bruker Avance' 700 Bruker AVANCE 2 'Bruker Avance' 600 Varian INOVA 3 'Varian INOVA' # _atom_sites.entry_id 2KF7 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol BR C H N O P # loop_