data_2LUN # _entry.id 2LUN # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2LUN pdb_00002lun 10.2210/pdb2lun/pdb RCSB RCSB102854 ? ? BMRB 18532 ? 10.13018/BMR18532 WWPDB D_1000102854 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2013-12-18 2 'Structure model' 1 1 2014-08-27 3 'Structure model' 1 2 2018-04-18 4 'Structure model' 1 3 2023-06-14 5 'Structure model' 1 4 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 4 'Structure model' 'Data collection' 5 4 'Structure model' 'Database references' 6 4 'Structure model' Other 7 5 'Structure model' 'Data collection' 8 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' citation 2 3 'Structure model' citation_author 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_database_status 5 4 'Structure model' pdbx_nmr_software 6 5 'Structure model' chem_comp_atom 7 5 'Structure model' chem_comp_bond 8 5 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_citation.journal_volume' 2 3 'Structure model' '_citation.page_first' 3 3 'Structure model' '_citation.page_last' 4 3 'Structure model' '_citation.pdbx_database_id_PubMed' 5 3 'Structure model' '_citation_author.name' 6 4 'Structure model' '_database_2.pdbx_DOI' 7 4 'Structure model' '_database_2.pdbx_database_accession' 8 4 'Structure model' '_pdbx_database_status.status_code_nmr_data' 9 4 'Structure model' '_pdbx_nmr_software.name' 10 5 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2LUN _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2012-06-18 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # _pdbx_database_related.db_id 18532 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Nikonowicz, E.P.' 1 'Wang, J.' 2 # _citation.id primary _citation.title 'Structure and function of TatD exonuclease in DNA repair.' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 42 _citation.page_first 10776 _citation.page_last 10785 _citation.year 2014 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 1362-4962 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 25114049 _citation.pdbx_database_id_DOI 10.1093/nar/gku732 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Chen, Y.C.' 1 ? primary 'Li, C.L.' 2 ? primary 'Hsiao, Y.Y.' 3 ? primary 'Duh, Y.' 4 ? primary 'Yuan, H.S.' 5 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (28-MER)' _entity.formula_weight 8986.374 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGCAGUGAUGCUUCGGCAUAUCAGCCC _entity_poly.pdbx_seq_one_letter_code_can GGGCAGUGAUGCUUCGGCAUAUCAGCCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 C n 1 5 A n 1 6 G n 1 7 U n 1 8 G n 1 9 A n 1 10 U n 1 11 G n 1 12 C n 1 13 U n 1 14 U n 1 15 C n 1 16 G n 1 17 G n 1 18 C n 1 19 A n 1 20 U n 1 21 A n 1 22 U n 1 23 C n 1 24 A n 1 25 G n 1 26 C n 1 27 C n 1 28 C n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 A 5 5 5 A A A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 A 9 9 9 A A A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 A 19 19 19 A A A . n A 1 20 U 20 20 20 U U A . n A 1 21 A 21 21 21 A A A . n A 1 22 U 22 22 22 U U A . n A 1 23 C 23 23 23 C C A . n A 1 24 A 24 24 24 A A A . n A 1 25 G 25 25 25 G G A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n A 1 28 C 28 28 28 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2LUN _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2LUN _struct.title 'RNA Aptamer for B. anthracis Ribosomal Protein S8' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2LUN _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'Aptamer, Protein S8, Ribosome, Selex, Non-canonical base pairs, RNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2LUN _struct_ref.pdbx_db_accession 2LUN _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2LUN _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2LUN _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 28 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 28 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 3 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 3 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 3 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 O2 ? ? ? 1_555 A A 5 N6 ? ? A C 4 A A 5 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog11 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 5 N6 ? ? ? 1_555 A A 24 N1 ? ? A A 5 A A 24 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 6 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 6 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 6 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 N3 ? ? ? 1_555 A U 22 O4 ? ? A U 7 A U 22 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog19 hydrog ? ? A U 7 O2 ? ? ? 1_555 A U 22 N3 ? ? A U 7 A U 22 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog20 hydrog ? ? A G 8 N2 ? ? ? 1_555 A A 21 N7 ? ? A G 8 A A 21 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 20 N3 ? ? A A 9 A U 20 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog22 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 19 N1 ? ? A U 10 A A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 10 O4 ? ? ? 1_555 A A 19 N6 ? ? A U 10 A A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 3 "HO2'" A A 9 ? ? "O4'" A U 10 ? ? 1.44 2 7 "HO2'" A A 9 ? ? "O5'" A U 10 ? ? 1.43 3 7 OP2 A U 14 ? ? H42 A C 15 ? ? 1.57 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 8 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2LUN _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2LUN _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '1.5 mM [U-98% 13C; U-98% 15N] RNA, 90% H2O/10% D2O' 1 '90% H2O/10% D2O' '1.6 mM [U-98% 13C; U-98% 15N] RNA, 100% D2O' 2 '100% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id RNA-1 1.5 ? mM '[U-98% 13C; U-98% 15N]' 1 RNA-2 1.6 ? mM '[U-98% 13C; U-98% 15N]' 2 # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 50 6.8 ambient ? 287 K 2 50 ? ambient ? 299 K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 2 1 2 '2D 1H-13C HSQC' 2 2 2 '3D 1H-13C NOESY' 1 3 1 '2D 1H-15N HSQC' 1 4 1 '2D 1H-1H NOESY' 2 5 2 '2D 1H-1H NOESY' 2 6 2 '3D HCCH-COSY' 2 7 2 '3D 1H-13C NOESY' 2 8 2 '3D HCCH-TOCSY' 2 9 2 '2D 1H-31P HetCor' 2 10 1 '2D 1H-15N HNC-TOCSY-CH' 1 11 1 '2D 1H-13C H(N)CO' 2 12 2 '2D 1H-13C CCH-COSY' 2 13 2 '2D 1H-13C HCNC' 2 14 2 '2D 1H-15N HSQC' 2 15 2 '2D 1H-15N HCN' # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2LUN _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count ? _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_other-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count ? _pdbx_nmr_constraints.NOE_constraints_total 361 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count ? _pdbx_nmr_constraints.NOE_long_range_total_count ? _pdbx_nmr_constraints.NOE_medium_range_total_count ? _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count ? _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # _pdbx_nmr_refine.entry_id 2LUN _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Schwieters, Kuszewski, Tjandra and Clore' 'structure solution' 'X-PLOR NIH' ? 1 'Accelrys Software Inc.' 'data analysis' Felix ? 2 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' ? 3 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2LUN 'double helix' 2LUN 'a-form double helix' 2LUN 'hairpin loop' 2LUN 'mismatched base pair' 2LUN 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 28 1_555 -0.873 0.080 1.112 20.735 9.870 -1.534 1 A_G1:C28_A A 1 ? A 28 ? 19 1 1 A G 2 1_555 A C 27 1_555 -1.258 -0.319 0.628 9.806 7.790 -5.474 2 A_G2:C27_A A 2 ? A 27 ? 19 1 1 A G 3 1_555 A C 26 1_555 -1.000 -0.071 0.092 7.290 0.324 3.429 3 A_G3:C26_A A 3 ? A 26 ? 19 1 1 A C 4 1_555 A G 25 1_555 0.695 -0.311 1.206 -26.570 10.827 -10.739 4 A_C4:G25_A A 4 ? A 25 ? 19 1 1 A A 5 1_555 A A 24 1_555 -1.942 1.398 -1.709 0.571 24.135 -48.221 5 A_A5:A24_A A 5 ? A 24 ? ? ? 1 A G 6 1_555 A C 23 1_555 0.608 0.114 0.993 24.297 11.975 0.057 6 A_G6:C23_A A 6 ? A 23 ? 19 1 1 A U 7 1_555 A U 22 1_555 1.938 -1.351 -0.060 -1.854 10.040 8.978 7 A_U7:U22_A A 7 ? A 22 ? 16 1 1 A G 8 1_555 A A 21 1_555 7.211 -3.149 -0.475 7.772 -8.320 -17.717 8 A_G8:A21_A A 8 ? A 21 ? ? ? 1 A A 9 1_555 A U 20 1_555 -1.434 -0.086 1.209 23.342 13.174 16.765 9 A_A9:U20_A A 9 ? A 20 ? ? 1 1 A U 10 1_555 A A 19 1_555 0.024 -0.170 -0.820 23.249 -1.859 6.445 10 A_U10:A19_A A 10 ? A 19 ? 20 1 1 A G 11 1_555 A C 18 1_555 -1.299 -0.162 -0.238 2.619 -12.138 3.024 11 A_G11:C18_A A 11 ? A 18 ? 19 1 1 A C 12 1_555 A G 17 1_555 1.084 -0.266 0.970 -27.493 5.242 -9.204 12 A_C12:G17_A A 12 ? A 17 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 28 1_555 A G 2 1_555 A C 27 1_555 -0.528 -0.567 4.749 0.871 19.923 30.959 -4.754 1.007 3.714 33.341 -1.458 36.693 1 AA_G1G2:C27C28_AA A 1 ? A 28 ? A 2 ? A 27 ? 1 A G 2 1_555 A C 27 1_555 A G 3 1_555 A C 26 1_555 0.931 -0.210 4.497 1.993 10.600 31.047 -2.875 -1.177 4.249 19.094 -3.590 32.823 2 AA_G2G3:C26C27_AA A 2 ? A 27 ? A 3 ? A 26 ? 1 A G 3 1_555 A C 26 1_555 A C 4 1_555 A G 25 1_555 -1.310 -0.821 5.558 -5.864 21.449 40.665 -4.145 0.826 4.724 28.447 7.777 46.121 3 AA_G3C4:G25C26_AA A 3 ? A 26 ? A 4 ? A 25 ? 1 A C 4 1_555 A G 25 1_555 A A 5 1_555 A A 24 1_555 -3.545 -0.363 2.858 10.480 8.504 22.111 -2.285 9.738 0.913 19.959 -24.596 25.861 4 AA_C4A5:A24G25_AA A 4 ? A 25 ? A 5 ? A 24 ? 1 A A 5 1_555 A A 24 1_555 A G 6 1_555 A C 23 1_555 3.355 -1.528 3.077 -19.070 18.590 42.872 -2.692 -4.871 0.899 22.985 23.579 50.137 5 AA_A5G6:C23A24_AA A 5 ? A 24 ? A 6 ? A 23 ? 1 A G 6 1_555 A C 23 1_555 A U 7 1_555 A U 22 1_555 1.265 -0.887 5.692 5.394 -2.865 36.810 -0.714 -0.708 5.862 -4.499 -8.471 37.295 6 AA_G6U7:U22C23_AA A 6 ? A 23 ? A 7 ? A 22 ? 1 A U 7 1_555 A U 22 1_555 A G 8 1_555 A A 21 1_555 -2.197 -0.464 3.913 18.921 10.895 55.054 -1.085 3.298 2.948 11.303 -19.630 58.909 7 AA_U7G8:A21U22_AA A 7 ? A 22 ? A 8 ? A 21 ? 1 A G 8 1_555 A A 21 1_555 A A 9 1_555 A U 20 1_555 1.247 -3.063 2.221 -15.510 -0.531 2.119 -11.087 -9.027 -0.829 -2.815 82.225 15.662 8 AA_G8A9:U20A21_AA A 8 ? A 21 ? A 9 ? A 20 ? 1 A A 9 1_555 A U 20 1_555 A U 10 1_555 A A 19 1_555 -2.355 -0.620 4.299 13.865 -2.315 18.049 -0.666 11.331 2.050 -6.286 -37.646 22.842 9 AA_A9U10:A19U20_AA A 9 ? A 20 ? A 10 ? A 19 ? 1 A U 10 1_555 A A 19 1_555 A G 11 1_555 A C 18 1_555 0.597 -0.903 5.205 -1.133 -2.885 27.715 -0.772 -1.673 5.241 -5.999 2.357 27.885 10 AA_U10G11:C18A19_AA A 10 ? A 19 ? A 11 ? A 18 ? 1 A G 11 1_555 A C 18 1_555 A C 12 1_555 A G 17 1_555 -1.978 -0.025 4.663 -8.107 33.940 41.394 -3.254 1.422 3.923 40.507 9.675 53.641 11 AA_G11C12:G17C18_AA A 11 ? A 18 ? A 12 ? A 17 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 600 Varian INOVA 1 'Varian INOVA' 800 Varian INOVA 2 'Varian INOVA' 500 Varian INOVA 3 'Varian INOVA' # _atom_sites.entry_id 2LUN _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_