data_2M58 # _entry.id 2M58 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2M58 pdb_00002m58 10.2210/pdb2m58/pdb RCSB RCSB103224 ? ? BMRB 19040 ? 10.13018/BMR19040 WWPDB D_1000103224 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2013-04-03 2 'Structure model' 1 1 2023-06-14 3 'Structure model' 1 2 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 2 'Structure model' 'Derived calculations' 4 2 'Structure model' Other 5 3 'Structure model' 'Data collection' 6 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' database_2 2 2 'Structure model' pdbx_database_status 3 2 'Structure model' pdbx_nmr_spectrometer 4 2 'Structure model' struct_conn 5 3 'Structure model' chem_comp_atom 6 3 'Structure model' chem_comp_bond 7 3 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' 3 2 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 2 'Structure model' '_pdbx_nmr_spectrometer.model' 5 2 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' 6 3 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2M58 _pdbx_database_status.process_site RCSB _pdbx_database_status.recvd_initial_deposition_date 2013-02-18 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # _pdbx_database_related.db_id 19040 _pdbx_database_related.db_name BMRB _pdbx_database_related.content_type unspecified _pdbx_database_related.details . # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Carlomagno, T.' 1 'Amata, I.' 2 'Codutti, L.' 3 'Falb, M.' 4 'Fohrer, J.' 5 'Simon, B.' 6 # _citation.id primary _citation.title ;Structural principles of RNA catalysis in a 2'-5' lariat-forming ribozyme. ; _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_volume 135 _citation.page_first 4403 _citation.page_last 4411 _citation.year 2013 _citation.journal_id_ASTM JACSAT _citation.country US _citation.journal_id_ISSN 0002-7863 _citation.journal_id_CSD 0004 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 23472843 _citation.pdbx_database_id_DOI 10.1021/ja311868t # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Carlomagno, T.' 1 ? primary 'Amata, I.' 2 ? primary 'Codutti, L.' 3 ? primary 'Falb, M.' 4 ? primary 'Fohrer, J.' 5 ? primary 'Masiewicz, P.' 6 ? primary 'Simon, B.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (59-MER)' _entity.formula_weight 19163.359 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GAAGAAAGGGCUUCGGCCACUCAAACUACAGAGACGCCAGUCACUCAGAUAUCCUGGU' _entity_poly.pdbx_seq_one_letter_code_can GGAAGAAAGGGCUUCGGCCACUCAAACUACAGAGACGCCAGUCACUCAGAUAUCCUGGU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 A n 1 4 A n 1 5 G n 1 6 A n 1 7 A n 1 8 A n 1 9 G n 1 10 G n 1 11 G n 1 12 C n 1 13 U n 1 14 U n 1 15 C n 1 16 G n 1 17 G n 1 18 C n 1 19 C n 1 20 A n 1 21 C n 1 22 U n 1 23 C n 1 24 A n 1 25 A n 1 26 A n 1 27 C n 1 28 U n 1 29 A n 1 30 C n 1 31 A n 1 32 G n 1 33 A n 1 34 G n 1 35 A n 1 36 C n 1 37 G n 1 38 C n 1 39 C n 1 40 A n 1 41 G n 1 42 U n 1 43 C n 1 44 A n 1 45 C n 1 46 U n 1 47 C n 1 48 A n 1 49 G n 1 50 A n 1 51 U n 1 52 A n 1 53 U n 1 54 C n 1 55 C n 1 56 U n 1 57 G n 1 58 G n 1 59 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific synthetic _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 A 4 4 4 A A A . n A 1 5 G 5 5 5 G G A . n A 1 6 A 6 6 6 A A A . n A 1 7 A 7 7 7 A A A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 C 21 21 21 C C A . n A 1 22 U 22 22 22 U U A . n A 1 23 C 23 23 23 C C A . n A 1 24 A 24 24 24 A A A . n A 1 25 A 25 25 25 A A A . n A 1 26 A 26 26 26 A A A . n A 1 27 C 27 27 27 C C A . n A 1 28 U 28 28 28 U U A . n A 1 29 A 29 29 29 A A A . n A 1 30 C 30 30 30 C C A . n A 1 31 A 31 31 31 A A A . n A 1 32 G 32 32 32 G G A . n A 1 33 A 33 33 33 A A A . n A 1 34 G 34 34 34 G G A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 C 38 38 38 C C A . n A 1 39 C 39 39 39 C C A . n A 1 40 A 40 40 40 A A A . n A 1 41 G 41 41 41 G G A . n A 1 42 U 42 42 42 U U A . n A 1 43 C 43 43 43 C C A . n A 1 44 A 44 44 44 A A A . n A 1 45 C 45 45 45 C C A . n A 1 46 U 46 46 46 U U A . n A 1 47 C 47 47 47 C C A . n A 1 48 A 48 48 48 A A A . n A 1 49 G 49 49 49 G G A . n A 1 50 A 50 50 50 A A A . n A 1 51 U 51 51 51 U U A . n A 1 52 A 52 52 52 A A A . n A 1 53 U 53 53 53 U U A . n A 1 54 C 54 54 54 C C A . n A 1 55 C 55 55 55 C C A . n A 1 56 U 56 56 56 U U A . n A 1 57 G 57 57 57 G G A . n A 1 58 G 58 58 58 G G A . n A 1 59 U 59 59 59 U U A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2M58 _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2M58 _struct.title ;Structure of 2'-5' AG1 lariat forming ribozyme in its inactive state ; _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2M58 _struct_keywords.pdbx_keywords RNA _struct_keywords.text ;RNA, lariat, 2'-5' branching ; # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2M58 _struct_ref.pdbx_db_accession 2M58 _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2M58 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 59 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2M58 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 59 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 59 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.605 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 27 N3 ? ? A GTP 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 27 O2 ? ? A GTP 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 27 N4 ? ? A GTP 1 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A A 26 N1 ? ? A G 2 A A 26 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A A 26 N6 ? ? A G 2 A A 26 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog6 hydrog ? ? A A 3 N6 ? ? ? 1_555 A A 25 N1 ? ? A A 3 A A 25 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog7 hydrog ? ? A A 4 N1 ? ? ? 1_555 A A 24 N6 ? ? A A 4 A A 24 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog8 hydrog ? ? A A 4 N6 ? ? ? 1_555 A A 25 N1 ? ? A A 4 A A 25 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog9 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 5 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 6 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 6 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 7 N6 ? ? ? 1_555 A C 21 N3 ? ? A A 7 A C 21 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A A 20 N6 ? ? A A 8 A A 20 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog16 hydrog ? ? A G 9 N2 ? ? ? 1_555 A G 10 O6 ? ? A G 9 A G 10 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog17 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 11 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 12 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 13 O2 ? ? ? 1_555 A G 16 N1 ? ? A U 13 A G 16 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog27 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 32 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 32 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 32 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 33 N1 ? ? ? 1_555 A U 46 N3 ? ? A A 33 A U 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 33 N6 ? ? ? 1_555 A U 46 O4 ? ? A A 33 A U 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 45 N3 ? ? A G 34 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 45 O2 ? ? A G 34 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 45 N4 ? ? A G 34 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 34 N2 ? ? ? 1_555 A A 52 N3 ? ? A G 34 A A 52 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog36 hydrog ? ? A A 35 N6 ? ? ? 1_555 A A 44 N1 ? ? A A 35 A A 44 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog37 hydrog ? ? A G 37 O6 ? ? ? 1_555 A A 40 N6 ? ? A G 37 A A 40 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog38 hydrog ? ? A C 38 N3 ? ? ? 1_555 A G 58 N1 ? ? A C 38 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 38 N4 ? ? ? 1_555 A G 58 O6 ? ? A C 38 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 38 O2 ? ? ? 1_555 A G 58 N2 ? ? A C 38 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 39 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 39 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 39 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 39 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 39 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 39 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 40 N1 ? ? ? 1_555 A U 56 N3 ? ? A A 40 A U 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A A 40 N6 ? ? ? 1_555 A U 56 O4 ? ? A A 40 A U 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 55 N3 ? ? A G 41 A C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 55 O2 ? ? A G 41 A C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 55 N4 ? ? A G 41 A C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 42 O4 ? ? ? 1_555 A A 44 N6 ? ? A U 42 A A 44 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog50 hydrog ? ? A A 44 N3 ? ? ? 1_555 A C 54 N4 ? ? A A 44 A C 54 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.50 2 2 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.47 3 2 "HO2'" A G 32 ? ? "O4'" A A 33 ? ? 1.49 4 3 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.49 5 3 "HO2'" A A 3 ? ? "O5'" A A 4 ? ? 1.53 6 3 "HO2'" A G 32 ? ? "O4'" A A 33 ? ? 1.57 7 4 "HO2'" A G 32 ? ? "O4'" A A 33 ? ? 1.48 8 4 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.51 9 4 "HO2'" A A 25 ? ? "O5'" A A 26 ? ? 1.57 10 5 "HO2'" A U 53 ? ? OP1 A C 54 ? ? 1.46 11 5 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.49 12 5 O6 A G 10 ? ? H41 A C 19 ? ? 1.56 13 5 "HO2'" A G 32 ? ? "O4'" A A 33 ? ? 1.57 14 6 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.47 15 7 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.49 16 7 "HO2'" A G 32 ? ? "O4'" A A 33 ? ? 1.55 17 7 "HO2'" A G 58 ? ? OP1 A U 59 ? ? 1.59 18 8 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.49 19 8 "HO2'" A U 53 ? ? OP1 A C 54 ? ? 1.52 20 8 "HO2'" A C 47 ? ? "O5'" A A 50 ? ? 1.58 21 9 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.48 22 9 "HO2'" A G 32 ? ? "O4'" A A 33 ? ? 1.50 23 9 "HO2'" A A 3 ? ? "O5'" A A 4 ? ? 1.54 24 10 "HO2'" A U 13 ? ? O6 A G 16 ? ? 1.50 25 10 "HO2'" A U 53 ? ? OP1 A C 54 ? ? 1.51 26 10 "HO2'" A G 32 ? ? "O4'" A A 33 ? ? 1.52 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 96.67 101.30 -4.63 0.70 N 2 1 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.62 108.50 5.12 0.70 N 3 1 "C1'" A A 52 ? ? "O4'" A A 52 ? ? "C4'" A A 52 ? ? 104.54 109.70 -5.16 0.70 N 4 2 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 96.58 101.30 -4.72 0.70 N 5 2 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.51 108.50 5.01 0.70 N 6 2 "C1'" A C 43 ? ? "O4'" A C 43 ? ? "C4'" A C 43 ? ? 104.35 109.70 -5.35 0.70 N 7 3 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 96.82 101.30 -4.48 0.70 N 8 3 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.31 108.50 4.81 0.70 N 9 4 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 97.02 101.30 -4.28 0.70 N 10 4 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.21 108.50 4.71 0.70 N 11 5 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.52 108.50 5.02 0.70 N 12 6 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 96.83 101.30 -4.47 0.70 N 13 6 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.42 108.50 4.92 0.70 N 14 7 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.18 108.50 4.68 0.70 N 15 8 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 96.79 101.30 -4.51 0.70 N 16 8 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 112.92 108.50 4.42 0.70 N 17 9 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 96.48 101.30 -4.82 0.70 N 18 9 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.41 108.50 4.91 0.70 N 19 10 "C3'" A C 15 ? ? "C2'" A C 15 ? ? "C1'" A C 15 ? ? 96.83 101.30 -4.47 0.70 N 20 10 "O4'" A G 16 ? ? "C1'" A G 16 ? ? N9 A G 16 ? ? 113.37 108.50 4.87 0.70 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 A A 8 ? ? 0.053 'SIDE CHAIN' 2 1 G A 16 ? ? 0.050 'SIDE CHAIN' 3 2 A A 8 ? ? 0.054 'SIDE CHAIN' 4 2 C A 15 ? ? 0.056 'SIDE CHAIN' 5 2 G A 16 ? ? 0.056 'SIDE CHAIN' 6 2 G A 41 ? ? 0.057 'SIDE CHAIN' 7 2 C A 45 ? ? 0.062 'SIDE CHAIN' 8 3 A A 8 ? ? 0.062 'SIDE CHAIN' 9 3 C A 15 ? ? 0.066 'SIDE CHAIN' 10 3 G A 16 ? ? 0.058 'SIDE CHAIN' 11 3 C A 47 ? ? 0.064 'SIDE CHAIN' 12 3 U A 56 ? ? 0.057 'SIDE CHAIN' 13 4 G A 16 ? ? 0.050 'SIDE CHAIN' 14 5 C A 15 ? ? 0.059 'SIDE CHAIN' 15 5 G A 16 ? ? 0.058 'SIDE CHAIN' 16 5 C A 45 ? ? 0.059 'SIDE CHAIN' 17 6 G A 16 ? ? 0.050 'SIDE CHAIN' 18 6 C A 45 ? ? 0.070 'SIDE CHAIN' 19 6 C A 47 ? ? 0.061 'SIDE CHAIN' 20 7 G A 16 ? ? 0.050 'SIDE CHAIN' 21 9 A A 8 ? ? 0.056 'SIDE CHAIN' 22 9 C A 15 ? ? 0.059 'SIDE CHAIN' 23 9 G A 16 ? ? 0.060 'SIDE CHAIN' 24 9 C A 45 ? ? 0.061 'SIDE CHAIN' 25 9 C A 47 ? ? 0.065 'SIDE CHAIN' 26 10 A A 8 ? ? 0.060 'SIDE CHAIN' 27 10 G A 16 ? ? 0.050 'SIDE CHAIN' # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id GTP _pdbx_struct_mod_residue.label_seq_id 1 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id GTP _pdbx_struct_mod_residue.auth_seq_id 1 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id G _pdbx_struct_mod_residue.details "GUANOSINE-5'-TRIPHOSPHATE" # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2M58 _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2M58 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system ;400 uM [U-100% 13C; U-100% 15N] ADENOSINE-5'-MONOPHOSPHATE, 100% D2O ; 1 '100% D2O' ;300 uM [U-100% 13C; U-100% 15N] GUANOSINE-5'-MONOPHOSPHATE, 300 uM [U-100% 13C; U-100% 15N] GUANOSINE-5'-TRIPHOSPHATE, 100% D2O ; 2 '100% D2O' ;500 uM [U-100% 13C; U-100% 15N] CYTIDINE-5'-MONOPHOSPHATE, 100% D2O ; 3 '100% D2O' ;300 uM [U-100% 13C; U-100% 15N] URIDINE-5'-MONOPHOSPHATE, 100% D2O ; 4 '100% D2O' ;500 uM [U-100% 13C; U-100% 15N] ADENOSINE-5'-MONOPHOSPHATE, 500 uM [U-100% 13C; U-100% 15N] URIDINE-5'-MONOPHOSPHATE, 100% D2O ; 5 '100% D2O' ;500 uM [U-100% 13C; U-100% 15N] ADENOSINE-5'-MONOPHOSPHATE, 500 uM [U-100% 13C; U-100% 15N] URIDINE-5'-MONOPHOSPHATE, 500 uM [U-100% 13C; U-100% 15N] GUANOSINE-5'-MONOPHOSPHATE, 500 uM [U-100% 13C; U-100% 15N] CYTIDINE-5'-MONOPHOSPHATE, 100% D2O ; 6 '100% D2O' ;500 uM ADENOSINE-5'-MONOPHOSPHATE, 500 uM URIDINE-5'-MONOPHOSPHATE, 500 uM GUANOSINE-5'-MONOPHOSPHATE, 500 uM CYTIDINE-5'-MONOPHOSPHATE, 100% D2O ; 7 '100% D2O' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id "ADENOSINE-5'-MONOPHOSPHATE-1" 400 ? uM '[U-100% 13C; U-100% 15N]' 1 "GUANOSINE-5'-MONOPHOSPHATE-2" 300 ? uM '[U-100% 13C; U-100% 15N]' 2 "GUANOSINE-5'-TRIPHOSPHATE-3" 300 ? uM '[U-100% 13C; U-100% 15N]' 2 "CYTIDINE-5'-MONOPHOSPHATE-4" 500 ? uM '[U-100% 13C; U-100% 15N]' 3 "URIDINE-5'-MONOPHOSPHATE-5" 300 ? uM '[U-100% 13C; U-100% 15N]' 4 "ADENOSINE-5'-MONOPHOSPHATE-6" 500 ? uM '[U-100% 13C; U-100% 15N]' 5 "URIDINE-5'-MONOPHOSPHATE-7" 500 ? uM '[U-100% 13C; U-100% 15N]' 5 "ADENOSINE-5'-MONOPHOSPHATE-8" 500 ? uM '[U-100% 13C; U-100% 15N]' 6 "URIDINE-5'-MONOPHOSPHATE-9" 500 ? uM '[U-100% 13C; U-100% 15N]' 6 "GUANOSINE-5'-MONOPHOSPHATE-10" 500 ? uM '[U-100% 13C; U-100% 15N]' 6 "CYTIDINE-5'-MONOPHOSPHATE-11" 500 ? uM '[U-100% 13C; U-100% 15N]' 6 "ADENOSINE-5'-MONOPHOSPHATE-12" 500 ? uM ? 7 "URIDINE-5'-MONOPHOSPHATE-13" 500 ? uM ? 7 "GUANOSINE-5'-MONOPHOSPHATE-14" 500 ? uM ? 7 "CYTIDINE-5'-MONOPHOSPHATE-15" 500 ? uM ? 7 # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.ionic_strength 0.020 _pdbx_nmr_exptl_sample_conditions.pH 6.6 _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pressure_units ? _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 1 '2D 1H-15N HSQC' 1 2 1 '2D 1H-13C HSQC ribose' 1 3 1 '2D 1H-13C HSQC base' 1 4 1 '2D HNN-COSY' 1 5 1 '2D imino NOESY' 1 6 1 '3D HsCNb/HbCNb' 1 7 1 '3D HCCH-COSY-TOCSY' 1 8 1 '3D 13C-edited/ 12C-filtered NOESY' 1 9 1 '3D 13C-edited/ 13C-filtered NOESY' 1 10 2 '2D 1H-15N HSQC' 1 11 2 '2D 1H-13C HSQC ribose' 1 12 2 '2D 1H-13C HSQC base' 1 13 2 '2D HNN-COSY' 1 14 2 '2D imino NOESY' 1 15 2 '3D HsCNb/HbCNb' 1 16 2 '3D HCCH-COSY-TOCSY' 1 17 2 '3D 13C-edited/ 12C-filtered NOESY' 1 18 2 '3D 13C-edited/ 13C-filtered NOESY' 1 19 4 '2D 1H-15N HSQC' 1 20 4 '2D 1H-13C HSQC ribose' 1 21 4 '2D 1H-13C HSQC base' 1 22 4 '2D HNN-COSY' 1 23 4 '2D imino NOESY' 1 24 4 '3D HsCNb/HbCNb' 1 25 4 '3D HCCH-COSY-TOCSY' 1 26 4 '3D 13C-edited/ 12C-filtered NOESY' 1 27 4 '3D 13C-edited/ 13C-filtered NOESY' 1 28 3 '2D 1H-15N HSQC' 1 29 3 '2D 1H-13C HSQC ribose' 1 30 3 '2D 1H-13C HSQC base' 1 31 3 '2D HNN-COSY' 1 32 3 '2D imino NOESY' 1 33 3 '3D HsCNb/HbCNb' 1 34 3 '3D HCCH-COSY-TOCSY' 1 35 3 '3D 13C-edited/ 12C-filtered NOESY' 1 36 3 '3D 13C-edited/ 13C-filtered NOESY' 1 37 5 '2D 1H-15N HSQC' 1 38 5 '2D 1H-13C HSQC ribose' 1 39 5 '2D 1H-13C HSQC base' 1 40 5 '2D HNN-COSY' 1 41 5 '2D imino NOESY' 1 42 5 '3D HsCNb/HbCNb' 1 43 5 '3D HCCH-COSY-TOCSY' 1 44 5 '3D 13C-edited/ 12C-filtered NOESY' 1 45 5 '3D 13C-edited/ 13C-filtered NOESY' 1 46 6 '3D HsCNb/HbCNb' 1 47 6 '2D HNN-COSY' 1 48 7 '2D imino NOESY' # _pdbx_nmr_constraints.disulfide_bond_constraints_total_count ? _pdbx_nmr_constraints.entry_id 2M58 _pdbx_nmr_constraints.hydrogen_bond_constraints_total_count ? _pdbx_nmr_constraints.NA_alpha-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_beta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_chi-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_delta-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_epsilon-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_gamma-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_other-angle_constraints_total_count ? _pdbx_nmr_constraints.NA_sugar_pucker_constraints_total_count ? _pdbx_nmr_constraints.NOE_constraints_total 1339 _pdbx_nmr_constraints.NOE_interentity_total_count ? _pdbx_nmr_constraints.NOE_interproton_distance_evaluation ? _pdbx_nmr_constraints.NOE_intraresidue_total_count 569 _pdbx_nmr_constraints.NOE_long_range_total_count ? _pdbx_nmr_constraints.NOE_medium_range_total_count ? _pdbx_nmr_constraints.NOE_motional_averaging_correction ? _pdbx_nmr_constraints.NOE_pseudoatom_corrections ? _pdbx_nmr_constraints.NOE_sequential_total_count 631 _pdbx_nmr_constraints.protein_chi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_other_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_phi_angle_constraints_total_count ? _pdbx_nmr_constraints.protein_psi_angle_constraints_total_count ? # _pdbx_nmr_refine.entry_id 2M58 _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details 'water refined' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.ordinal 'Accelrys Software Inc.' 'chemical shift assignment' Felix ? 1 ;Linge, O'Donoghue and Nilges ; 'structure solution' ARIA ? 2 ;Linge, O'Donoghue and Nilges ; refinement ARIA ? 3 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 U OP3 O N N 159 U P P N N 160 U OP1 O N N 161 U OP2 O N N 162 U "O5'" O N N 163 U "C5'" C N N 164 U "C4'" C N R 165 U "O4'" O N N 166 U "C3'" C N S 167 U "O3'" O N N 168 U "C2'" C N R 169 U "O2'" O N N 170 U "C1'" C N R 171 U N1 N N N 172 U C2 C N N 173 U O2 O N N 174 U N3 N N N 175 U C4 C N N 176 U O4 O N N 177 U C5 C N N 178 U C6 C N N 179 U HOP3 H N N 180 U HOP2 H N N 181 U "H5'" H N N 182 U "H5''" H N N 183 U "H4'" H N N 184 U "H3'" H N N 185 U "HO3'" H N N 186 U "H2'" H N N 187 U "HO2'" H N N 188 U "H1'" H N N 189 U H3 H N N 190 U H5 H N N 191 U H6 H N N 192 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 U OP3 P sing N N 166 U OP3 HOP3 sing N N 167 U P OP1 doub N N 168 U P OP2 sing N N 169 U P "O5'" sing N N 170 U OP2 HOP2 sing N N 171 U "O5'" "C5'" sing N N 172 U "C5'" "C4'" sing N N 173 U "C5'" "H5'" sing N N 174 U "C5'" "H5''" sing N N 175 U "C4'" "O4'" sing N N 176 U "C4'" "C3'" sing N N 177 U "C4'" "H4'" sing N N 178 U "O4'" "C1'" sing N N 179 U "C3'" "O3'" sing N N 180 U "C3'" "C2'" sing N N 181 U "C3'" "H3'" sing N N 182 U "O3'" "HO3'" sing N N 183 U "C2'" "O2'" sing N N 184 U "C2'" "C1'" sing N N 185 U "C2'" "H2'" sing N N 186 U "O2'" "HO2'" sing N N 187 U "C1'" N1 sing N N 188 U "C1'" "H1'" sing N N 189 U N1 C2 sing N N 190 U N1 C6 sing N N 191 U C2 O2 doub N N 192 U C2 N3 sing N N 193 U N3 C4 sing N N 194 U N3 H3 sing N N 195 U C4 O4 doub N N 196 U C4 C5 sing N N 197 U C5 C6 doub N N 198 U C5 H5 sing N N 199 U C6 H6 sing N N 200 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2M58 'double helix' 2M58 'a-form double helix' 2M58 'bulge loop' 2M58 'mismatched base pair' 2M58 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 27 1_555 -0.053 -0.144 0.202 7.417 5.885 -1.745 1 A_GTP1:C27_A A 1 ? A 27 ? 19 1 1 A G 2 1_555 A A 26 1_555 0.191 1.435 -0.218 8.006 -13.757 -16.055 2 A_G2:A26_A A 2 ? A 26 ? 8 1 1 A A 3 1_555 A A 25 1_555 -2.347 1.886 -0.515 1.291 -12.909 -35.984 3 A_A3:A25_A A 3 ? A 25 ? ? ? 1 A A 4 1_555 A A 24 1_555 2.357 2.087 -0.410 9.865 7.149 -64.831 4 A_A4:A24_A A 4 ? A 24 ? ? ? 1 A G 5 1_555 A C 23 1_555 0.185 0.117 0.102 8.883 -0.882 -5.048 5 A_G5:C23_A A 5 ? A 23 ? 19 1 1 A A 6 1_555 A U 22 1_555 -0.413 -0.210 0.321 -4.752 -5.960 2.086 6 A_A6:U22_A A 6 ? A 22 ? 20 1 1 A A 7 1_555 A C 21 1_555 -2.069 -0.113 0.597 -11.930 -18.416 -23.856 7 A_A7:C21_A A 7 ? A 21 ? ? ? 1 A A 8 1_555 A A 20 1_555 2.509 1.527 0.332 -24.756 0.700 -21.436 8 A_A8:A20_A A 8 ? A 20 ? ? ? 1 A G 10 1_555 A C 19 1_555 -0.319 -0.260 -0.011 -12.895 -10.644 -4.555 9 A_G10:C19_A A 10 ? A 19 ? 19 1 1 A G 11 1_555 A C 18 1_555 -0.999 -0.388 0.185 4.790 2.252 -8.668 10 A_G11:C18_A A 11 ? A 18 ? 19 1 1 A C 12 1_555 A G 17 1_555 1.148 -0.605 -0.205 0.186 -4.858 -10.782 11 A_C12:G17_A A 12 ? A 17 ? 19 1 1 A U 13 1_555 A G 16 1_555 1.366 -4.190 0.442 -16.456 -5.790 -95.055 12 A_U13:G16_A A 13 ? A 16 ? ? 6 1 A G 32 1_555 A C 47 1_555 -0.861 -0.328 0.251 6.083 8.135 -0.648 13 A_G32:C47_A A 32 ? A 47 ? 19 1 1 A A 33 1_555 A U 46 1_555 -0.026 0.094 0.326 -5.585 12.394 -8.931 14 A_A33:U46_A A 33 ? A 46 ? 20 1 1 A G 34 1_555 A C 45 1_555 -0.223 -0.266 0.216 -1.774 -8.624 -5.932 15 A_G34:C45_A A 34 ? A 45 ? 19 1 1 A A 35 1_555 A A 44 1_555 -4.478 1.254 -0.143 -0.130 -13.328 -94.617 16 A_A35:A44_A A 35 ? A 44 ? ? ? 1 A G 41 1_555 A C 55 1_555 0.580 -0.014 -0.195 -8.268 -9.407 -2.616 17 A_G41:C55_A A 41 ? A 55 ? 19 1 1 A A 40 1_555 A U 56 1_555 -0.040 -0.240 0.201 3.368 -4.091 -4.402 18 A_A40:U56_A A 40 ? A 56 ? 20 1 1 A C 39 1_555 A G 57 1_555 -0.593 -0.053 -0.093 8.671 -15.511 -1.121 19 A_C39:G57_A A 39 ? A 57 ? 19 1 1 A C 38 1_555 A G 58 1_555 0.352 -0.205 -0.215 -3.750 7.587 -2.248 20 A_C38:G58_A A 38 ? A 58 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 27 1_555 A G 2 1_555 A A 26 1_555 -0.034 -1.423 3.644 13.638 -3.953 34.582 -1.628 2.111 3.520 -6.329 -21.837 37.301 1 AA_GTP1G2:A26C27_AA A 1 ? A 27 ? A 2 ? A 26 ? 1 A G 2 1_555 A A 26 1_555 A A 3 1_555 A A 25 1_555 -0.256 -1.572 3.075 0.615 12.929 18.819 -7.653 0.822 1.653 34.715 -1.651 22.807 2 AA_G2A3:A25A26_AA A 2 ? A 26 ? A 3 ? A 25 ? 1 A A 3 1_555 A A 25 1_555 A A 4 1_555 A A 24 1_555 -2.252 -2.038 3.296 -5.247 5.201 53.875 -2.552 2.143 3.290 5.709 5.760 54.342 3 AA_A3A4:A24A25_AA A 3 ? A 25 ? A 4 ? A 24 ? 1 A A 4 1_555 A A 24 1_555 A G 5 1_555 A C 23 1_555 3.404 -2.466 3.188 -3.024 8.713 16.545 -10.696 -11.462 1.122 27.658 9.598 18.926 4 AA_A4G5:C23A24_AA A 4 ? A 24 ? A 5 ? A 23 ? 1 A G 5 1_555 A C 23 1_555 A A 6 1_555 A U 22 1_555 0.424 -2.134 3.331 -3.870 8.333 27.975 -5.842 -1.597 2.524 16.677 7.745 29.417 5 AA_G5A6:U22C23_AA A 5 ? A 23 ? A 6 ? A 22 ? 1 A A 6 1_555 A U 22 1_555 A A 7 1_555 A C 21 1_555 -1.238 -2.461 3.272 -0.608 -7.297 28.862 -3.117 2.271 3.791 -14.349 1.195 29.757 6 AA_A6A7:C21U22_AA A 6 ? A 22 ? A 7 ? A 21 ? 1 A A 7 1_555 A C 21 1_555 A A 8 1_555 A A 20 1_555 -0.288 -2.543 3.571 11.631 5.038 50.943 -3.228 1.130 3.191 5.755 -13.287 52.394 7 AA_A7A8:A20C21_AA A 7 ? A 21 ? A 8 ? A 20 ? 1 A A 8 1_555 A A 20 1_555 A G 10 1_555 A C 19 1_555 -2.404 -2.643 2.905 10.958 -1.052 37.574 -3.848 4.645 2.215 -1.592 -16.582 39.097 8 AA_A8G10:C19A20_AA A 8 ? A 20 ? A 10 ? A 19 ? 1 A G 10 1_555 A C 19 1_555 A G 11 1_555 A C 18 1_555 -0.937 -0.099 3.082 -6.042 14.596 35.392 -1.882 0.698 2.936 22.667 9.384 38.654 9 AA_G10G11:C18C19_AA A 10 ? A 19 ? A 11 ? A 18 ? 1 A G 11 1_555 A C 18 1_555 A C 12 1_555 A G 17 1_555 -0.284 -0.817 3.479 1.015 17.415 38.143 -3.003 0.506 2.852 25.109 -1.463 41.807 10 AA_G11C12:G17C18_AA A 11 ? A 18 ? A 12 ? A 17 ? 1 A C 12 1_555 A G 17 1_555 A U 13 1_555 A G 16 1_555 0.489 -1.469 3.382 10.451 14.851 94.184 -1.258 -0.143 3.213 10.066 -7.084 95.512 11 AA_C12U13:G16G17_AA A 12 ? A 17 ? A 13 ? A 16 ? 1 A G 32 1_555 A C 47 1_555 A A 33 1_555 A U 46 1_555 -0.642 -0.541 4.836 0.005 13.830 21.158 -7.040 1.472 3.772 33.447 -0.013 25.234 12 AA_G32A33:U46C47_AA A 32 ? A 47 ? A 33 ? A 46 ? 1 A A 33 1_555 A U 46 1_555 A G 34 1_555 A C 45 1_555 -0.615 -0.773 4.276 2.404 -3.167 25.344 -0.566 2.277 4.264 -7.162 -5.438 25.649 13 AA_A33G34:C45U46_AA A 33 ? A 46 ? A 34 ? A 45 ? 1 A G 34 1_555 A C 45 1_555 A A 35 1_555 A A 44 1_555 -4.648 -1.530 3.685 -9.786 17.938 14.979 -10.146 6.987 2.903 47.514 25.921 25.289 14 AA_G34A35:A44C45_AA A 34 ? A 45 ? A 35 ? A 44 ? 1 A A 35 1_555 A A 44 1_555 A G 41 1_555 A C 55 1_555 -3.674 2.417 3.440 53.511 159.252 51.485 -0.561 2.442 2.509 82.835 -27.834 169.196 15 AA_A35G41:C55A44_AA A 35 ? A 44 ? A 41 ? A 55 ? 1 A G 41 1_555 A C 55 1_555 A A 40 1_555 A U 56 1_555 -0.289 2.624 -3.862 -5.824 2.195 -35.669 -3.850 0.527 -4.008 -3.550 -9.420 -36.191 16 AA_G41A40:U56C55_AA A 41 ? A 55 ? A 40 ? A 56 ? 1 A A 40 1_555 A U 56 1_555 A C 39 1_555 A G 57 1_555 0.043 1.242 -3.332 6.240 -12.569 -32.581 -3.811 -0.807 -2.652 21.219 10.535 -35.399 17 AA_A40C39:G57U56_AA A 40 ? A 56 ? A 39 ? A 57 ? 1 A C 39 1_555 A G 57 1_555 A C 38 1_555 A G 58 1_555 -0.205 1.754 -3.374 -2.735 -6.341 -23.724 -5.970 0.328 -2.822 15.022 -6.480 -24.695 18 AA_C39C38:G58G57_AA A 39 ? A 57 ? A 38 ? A 58 ? # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 800 Bruker AVANCE 1 'Bruker Avance' 900 Bruker AVANCE 2 'Bruker Avance' # _atom_sites.entry_id 2M58 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_