data_2M8Z # _entry.id 2M8Z # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2M8Z pdb_00002m8z 10.2210/pdb2m8z/pdb RCSB RCSB103359 ? ? BMRB 19277 ? ? WWPDB D_1000103359 ? ? # loop_ _pdbx_database_related.db_id _pdbx_database_related.db_name _pdbx_database_related.content_type _pdbx_database_related.details 19277 BMRB unspecified . 2M8Y PDB unspecified 'STRUCTURE OF D[CGCGAAGCATTCGCG] HAIRPIN (REFERENCE DUPLEX HAIRPIN)' 2M90 PDB unspecified 'STRUCTURE OF D[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex HYBRID (CONSTRUCT II)' 2M91 PDB unspecified 'STRUCTURE OF D[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex HYBRID (CONSTRUCT III)' 2M92 PDB unspecified 'STRUCTURE OF D[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex HYBRID (CONSTRUCT IV)' 2M93 PDB unspecified 'STRUCTURE OF D[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex HYBRID (CONSTRUCT V)' # _pdbx_database_status.deposit_site BMRB _pdbx_database_status.entry_id 2M8Z _pdbx_database_status.methods_development_category ? _pdbx_database_status.process_site PDBJ _pdbx_database_status.recvd_initial_deposition_date 2013-05-30 _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code REL _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs REL _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lim, K.W.' 1 'Phan, A.T.' 2 # _citation.id primary _citation.title 'Structural basis of DNA quadruplex-duplex junction formation.' _citation.journal_abbrev Angew.Chem.Int.Ed.Engl. _citation.journal_volume 52 _citation.page_first 8566 _citation.page_last 8569 _citation.year 2013 _citation.journal_id_ASTM ACIEAY _citation.country GE _citation.journal_id_ISSN 1521-3773 _citation.journal_id_CSD 0179 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 23794476 _citation.pdbx_database_id_DOI 10.1002/anie.201302995 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lim, K.W.' 1 ? primary 'Phan, A.T.' 2 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description '27-MER DNA' _entity.formula_weight 8445.403 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DG)(DG)(DT)(DT)(DG)(DG)(DC)(DG)(DC)(DG)(DA)(DA)(DG)(DC)(DA)(DT)(DT)(DC)(DG)(DC) (DG)(DG)(DG)(DT)(DT)(DG)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can GGTTGGCGCGAAGCATTCGCGGGTTGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DT n 1 4 DT n 1 5 DG n 1 6 DG n 1 7 DC n 1 8 DG n 1 9 DC n 1 10 DG n 1 11 DA n 1 12 DA n 1 13 DG n 1 14 DC n 1 15 DA n 1 16 DT n 1 17 DT n 1 18 DC n 1 19 DG n 1 20 DC n 1 21 DG n 1 22 DG n 1 23 DG n 1 24 DT n 1 25 DT n 1 26 DG n 1 27 DG n # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2M8Z _struct_ref.pdbx_db_accession 2M8Z _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2M8Z _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2M8Z _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type 1 1 2 '2D 1H-1H NOESY' 1 2 1 '2D 1H-1H JR NOESY' 2 3 1 '2D 1H-1H JR NOESY' 1 4 2 '2D 1H-1H COSY' 1 5 2 '2D 1H-1H TOCSY' 1 6 2 '2D 1H-13C HSQC' 1 7 1 '2D 1H-13C JR HMBC' 1 8 2 '2D 1H-31P HSQC' 1 9 2 'H-D EXCHANGE' 1 10 3 15N-FILTERED 1 11 4 D-LABELED # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.temperature_units 1 '40 mM K+' 7 ambient ? 278 K 2 '40 mM K+' 7 ambient ? 298 K # loop_ _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.solvent_system '0.5-2.0 mM DNA-1, 90% H2O/10% D2O' 1 '90% H2O/10% D2O' '0.5-2.0 mM DNA-2, 100% D2O' 2 '100% D2O' '0.5-2.0 mM [U-2% 15N] DNA-3, 90% H2O/10% D2O' 3 '90% H2O/10% D2O' '0.2-1.0 mM [U-100% 2H] DNA-4, 100% D2O' 4 '100% D2O' # loop_ _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.type 400 Bruker AVANCE 1 'Bruker Avance' 600 Bruker AVANCE 2 'Bruker Avance' 700 Bruker AVANCE 3 'Bruker Avance' # _pdbx_nmr_refine.entry_id 2M8Z _pdbx_nmr_refine.method 'DGSA-distance geometry simulated annealing, Distance-restrained molecular dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.entry_id 2M8Z _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.representative_conformer 1 _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.entry_id 2M8Z _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.authors _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.ordinal _pdbx_nmr_software.version 'Bruker Biospin' processing TopSpin 1 2.1 'Felix NMR, Inc.' 'peak picking' Felix 2 2007 'Schwieters, Kuszewski, Tjandra and Clore' processing 'X-PLOR NIH' 3 2.29 'Schwieters, Kuszewski, Tjandra and Clore' refinement 'X-PLOR NIH' 4 2.29 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.crystals_number ? _exptl.details ? _exptl.entry_id 2M8Z _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 2M8Z _struct.title 'Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid' _struct.pdbx_model_details 'lowest energy, model1' _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2M8Z _struct_keywords.pdbx_keywords DNA _struct_keywords.text 'quadruplex-duplex hybrid, duplex, quadruplex, DNA' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DG 6 O6 ? ? A DG 1 A DG 6 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DG 6 N7 ? ? A DG 1 A DG 6 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 1 N7 ? ? ? 1_555 A DG 27 N2 ? ? A DG 1 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DG 27 N1 ? ? A DG 1 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 5 N2 ? ? A DG 2 A DG 5 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 5 N1 ? ? A DG 2 A DG 5 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DG 26 O6 ? ? A DG 2 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DG 26 N7 ? ? A DG 2 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 23 N2 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 23 N1 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 6 N1 ? ? ? 1_555 A DG 22 O6 ? ? A DG 6 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 6 N2 ? ? ? 1_555 A DG 22 N7 ? ? A DG 6 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DC 7 N3 ? ? ? 1_555 A DG 21 N1 ? ? A DC 7 A DG 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 7 N4 ? ? ? 1_555 A DG 21 O6 ? ? A DC 7 A DG 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 7 O2 ? ? ? 1_555 A DG 21 N2 ? ? A DC 7 A DG 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DG 8 N1 ? ? ? 1_555 A DC 20 N3 ? ? A DG 8 A DC 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DG 8 N2 ? ? ? 1_555 A DC 20 O2 ? ? A DG 8 A DC 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DG 8 O6 ? ? ? 1_555 A DC 20 N4 ? ? A DG 8 A DC 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 9 N3 ? ? ? 1_555 A DG 19 N1 ? ? A DC 9 A DG 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DC 9 N4 ? ? ? 1_555 A DG 19 O6 ? ? A DC 9 A DG 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DC 9 O2 ? ? ? 1_555 A DG 19 N2 ? ? A DC 9 A DG 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 10 N1 ? ? ? 1_555 A DC 18 N3 ? ? A DG 10 A DC 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 10 N2 ? ? ? 1_555 A DC 18 O2 ? ? A DG 10 A DC 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 10 O6 ? ? ? 1_555 A DC 18 N4 ? ? A DG 10 A DC 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DA 11 N1 ? ? ? 1_555 A DT 17 N3 ? ? A DA 11 A DT 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DA 11 N6 ? ? ? 1_555 A DT 17 O4 ? ? A DA 11 A DT 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DA 12 N1 ? ? ? 1_555 A DT 16 N3 ? ? A DA 12 A DT 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DA 12 N6 ? ? ? 1_555 A DT 16 O4 ? ? A DA 12 A DT 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 22 N1 ? ? ? 1_555 A DG 27 O6 ? ? A DG 22 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog30 hydrog ? ? A DG 22 N2 ? ? ? 1_555 A DG 27 N7 ? ? A DG 22 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog31 hydrog ? ? A DG 23 N7 ? ? ? 1_555 A DG 26 N2 ? ? A DG 23 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog32 hydrog ? ? A DG 23 O6 ? ? ? 1_555 A DG 26 N1 ? ? A DG 23 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 2M8Z _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DT 3 3 3 DT DT A . n A 1 4 DT 4 4 4 DT DT A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DA 11 11 11 DA DA A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DC 14 14 14 DC DC A . n A 1 15 DA 15 15 15 DA DA A . n A 1 16 DT 16 16 16 DT DT A . n A 1 17 DT 17 17 17 DT DT A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DG 22 22 22 DG DG A . n A 1 23 DG 23 23 23 DG DG A . n A 1 24 DT 24 24 24 DT DT A . n A 1 25 DT 25 25 25 DT DT A . n A 1 26 DG 26 26 26 DG DG A . n A 1 27 DG 27 27 27 DG DG A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2013-07-10 2 'Structure model' 1 1 2022-08-24 3 'Structure model' 1 2 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' database_2 3 2 'Structure model' pdbx_nmr_software 4 2 'Structure model' pdbx_nmr_spectrometer 5 3 'Structure model' pdbx_database_status # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.title' 5 2 'Structure model' '_database_2.pdbx_DOI' 6 2 'Structure model' '_database_2.pdbx_database_accession' 7 2 'Structure model' '_pdbx_nmr_software.name' 8 2 'Structure model' '_pdbx_nmr_spectrometer.model' 9 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' # loop_ _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling _pdbx_nmr_exptl_sample.solution_id DNA-1 ? 0.5-2.0 mM ? 1 DNA-2 ? 0.5-2.0 mM ? 2 DNA-3 ? 0.5-2.0 mM '[U-2% 15N]' 3 DNA-4 ? 0.2-1.0 mM '[U-100% 2H]' 4 # _ndb_struct_conf_na.entry_id 2M8Z _ndb_struct_conf_na.feature 'quadruple helix' #