data_2TOB # _entry.id 2TOB # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 2TOB pdb_00002tob 10.2210/pdb2tob/pdb WWPDB D_1000178692 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1999-06-22 2 'Structure model' 1 1 2008-03-25 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2020-06-24 5 'Structure model' 2 0 2020-07-29 6 'Structure model' 2 1 2024-05-01 # loop_ _pdbx_audit_revision_details.ordinal _pdbx_audit_revision_details.revision_ordinal _pdbx_audit_revision_details.data_content_type _pdbx_audit_revision_details.provider _pdbx_audit_revision_details.type _pdbx_audit_revision_details.description _pdbx_audit_revision_details.details 1 1 'Structure model' repository 'Initial release' ? ? 2 5 'Structure model' repository Remediation 'Carbohydrate remediation' ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Database references' 4 4 'Structure model' 'Derived calculations' 5 4 'Structure model' Other 6 4 'Structure model' 'Source and taxonomy' 7 5 'Structure model' 'Atomic model' 8 5 'Structure model' 'Data collection' 9 5 'Structure model' 'Derived calculations' 10 5 'Structure model' 'Structure summary' 11 6 'Structure model' 'Data collection' 12 6 'Structure model' 'Database references' 13 6 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' ndb_struct_na_base_pair 2 4 'Structure model' pdbx_database_status 3 4 'Structure model' pdbx_entity_src_syn 4 4 'Structure model' pdbx_struct_assembly 5 4 'Structure model' pdbx_struct_oper_list 6 4 'Structure model' struct_conn 7 4 'Structure model' struct_ref 8 4 'Structure model' struct_ref_seq 9 5 'Structure model' atom_site 10 5 'Structure model' chem_comp 11 5 'Structure model' entity 12 5 'Structure model' pdbx_chem_comp_identifier 13 5 'Structure model' pdbx_entity_nonpoly 14 5 'Structure model' struct_site 15 5 'Structure model' struct_site_gen 16 6 'Structure model' chem_comp 17 6 'Structure model' chem_comp_atom 18 6 'Structure model' chem_comp_bond 19 6 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_ndb_struct_na_base_pair.hbond_type_12' 2 4 'Structure model' '_pdbx_database_status.process_site' 3 5 'Structure model' '_atom_site.auth_atom_id' 4 5 'Structure model' '_atom_site.label_atom_id' 5 5 'Structure model' '_chem_comp.name' 6 5 'Structure model' '_chem_comp.type' 7 5 'Structure model' '_entity.pdbx_description' 8 5 'Structure model' '_pdbx_entity_nonpoly.name' 9 6 'Structure model' '_chem_comp.pdbx_synonyms' 10 6 'Structure model' '_database_2.pdbx_DOI' 11 6 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 2TOB _pdbx_database_status.recvd_initial_deposition_date 1998-06-17 _pdbx_database_status.deposit_site ? _pdbx_database_status.process_site BNL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Jiang, L.' 1 'Patel, D.J.' 2 # _citation.id primary _citation.title 'Solution structure of the tobramycin-RNA aptamer complex.' _citation.journal_abbrev Nat.Struct.Biol. _citation.journal_volume 5 _citation.page_first 769 _citation.page_last 774 _citation.year 1998 _citation.journal_id_ASTM NSBIEW _citation.country US _citation.journal_id_ISSN 1072-8368 _citation.journal_id_CSD 2024 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 9731769 _citation.pdbx_database_id_DOI 10.1038/1804 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Jiang, L.' 1 ? primary 'Patel, D.J.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*AP*CP*UP*UP*GP*GP*UP*UP*UP*AP*GP*GP*UP*AP*AP*UP*GP*AP*GP*U)-3') ; 6426.815 1 ? ? ? ? 2 non-polymer man 3-ammonio-3-deoxy-alpha-D-glucopyranose 180.179 1 ? ? ? ? 3 non-polymer man 2,6-diammonio-2,3,6-trideoxy-alpha-D-glucopyranose 164.203 1 ? ? ? ? 4 non-polymer syn 1,3-DIAMINO-4,5,6-TRIHYDROXY-CYCLOHEXANE 164.203 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ACUUGGUUUAGGUAAUGAGU _entity_poly.pdbx_seq_one_letter_code_can ACUUGGUUUAGGUAAUGAGU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 3-ammonio-3-deoxy-alpha-D-glucopyranose TOA 3 2,6-diammonio-2,3,6-trideoxy-alpha-D-glucopyranose TOC 4 1,3-DIAMINO-4,5,6-TRIHYDROXY-CYCLOHEXANE 2TB # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 A n 1 2 C n 1 3 U n 1 4 U n 1 5 G n 1 6 G n 1 7 U n 1 8 U n 1 9 U n 1 10 A n 1 11 G n 1 12 G n 1 13 U n 1 14 A n 1 15 A n 1 16 U n 1 17 G n 1 18 A n 1 19 G n 1 20 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 20 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 2TB non-polymer . 1,3-DIAMINO-4,5,6-TRIHYDROXY-CYCLOHEXANE ? 'C6 H16 N2 O3 2' 164.203 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 TOA 'D-saccharide, alpha linking' . 3-ammonio-3-deoxy-alpha-D-glucopyranose '3-DEOXY-3-AMINO GLUCOSE; 3-ammonio-3-deoxy-alpha-D-glucose; 3-ammonio-3-deoxy-D-glucose; 3-ammonio-3-deoxy-glucose' 'C6 H14 N O5 1' 180.179 TOC 'D-saccharide, alpha linking' . 2,6-diammonio-2,3,6-trideoxy-alpha-D-glucopyranose ;2,3,6-TRIDEOXY-2,6-DIAMINO GLUCOSE; 2,6-diammonio-2,3,6-trideoxy-alpha-D-glucose; 2,6-diammonio-2,3,6-trideoxy-D-glucose; 2,6-diammonio-2,3,6-trideoxy-glucose ; 'C6 H16 N2 O3 2' 164.203 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_chem_comp_identifier.comp_id _pdbx_chem_comp_identifier.type _pdbx_chem_comp_identifier.program _pdbx_chem_comp_identifier.program_version _pdbx_chem_comp_identifier.identifier TOA 'IUPAC CARBOHYDRATE SYMBOL' PDB-CARE 1.0 a-D-Glcp3N TOC 'IUPAC CARBOHYDRATE SYMBOL' PDB-CARE 1.0 a-D-3-deoxy-GlcpN6N # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 A 1 4 4 A A A . n A 1 2 C 2 5 5 C C A . n A 1 3 U 3 6 6 U U A . n A 1 4 U 4 7 7 U U A . n A 1 5 G 5 8 8 G G A . n A 1 6 G 6 9 9 G G A . n A 1 7 U 7 10 10 U U A . n A 1 8 U 8 11 11 U U A . n A 1 9 U 9 12 12 U U A . n A 1 10 A 10 13 13 A A A . n A 1 11 G 11 14 14 G G A . n A 1 12 G 12 15 15 G G A . n A 1 13 U 13 16 16 U U A . n A 1 14 A 14 17 17 A A A . n A 1 15 A 15 18 18 A A A . n A 1 16 U 16 19 19 U U A . n A 1 17 G 17 20 20 G G A . n A 1 18 A 18 21 21 A A A . n A 1 19 G 19 22 22 G G A . n A 1 20 U 20 23 23 U U A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 TOA 1 100 100 TOA TOA A . C 3 TOC 1 102 102 TOC TOC A . D 4 2TB 1 101 101 2TB 2TB A . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' 3.1 ? 1 X-PLOR refinement 3.1 ? 2 X-PLOR phasing 3.1 ? 3 # _cell.entry_id 2TOB _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 2TOB _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 2TOB _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 2TOB _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 2TOB _struct.title 'SOLUTION STRUCTURE OF THE TOBRAMYCIN-RNA APTAMER COMPLEX, NMR, 13 STRUCTURES' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 2TOB _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'AMINOGLYCOSIDE-RNA RECOGNITION, TOBRAMYCIN, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 2TOB _struct_ref.pdbx_db_accession 2TOB _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 2TOB _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 20 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2TOB _struct_ref_seq.db_align_beg 4 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 23 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 4 _struct_ref_seq.pdbx_auth_seq_align_end 23 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale one ? B TOA . C1 ? ? ? 1_555 D 2TB . O6 ? ? A TOA 100 A 2TB 101 1_555 ? ? ? ? ? ? ? 1.402 ? ? covale2 covale one ? D 2TB . O4 ? ? ? 1_555 C TOC . C1 ? ? A 2TB 101 A TOC 102 1_555 ? ? ? ? ? ? ? 1.401 ? ? hydrog1 hydrog ? ? A A 1 N1 ? ? ? 1_555 A U 20 N3 ? ? A A 4 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A A 1 N6 ? ? ? 1_555 A U 20 O4 ? ? A A 4 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 5 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 5 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 5 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 18 N1 ? ? A U 6 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 18 N6 ? ? A U 6 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 4 N3 ? ? ? 1_555 A G 17 O6 ? ? A U 7 A G 20 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog9 hydrog ? ? A U 4 O2 ? ? ? 1_555 A G 17 N1 ? ? A U 7 A G 20 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog10 hydrog ? ? A G 5 O6 ? ? ? 1_555 A U 16 N3 ? ? A G 8 A U 19 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A G 6 N1 ? ? ? 1_555 A A 15 N1 ? ? A G 9 A A 18 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog12 hydrog ? ? A G 6 O6 ? ? ? 1_555 A A 15 N6 ? ? A G 9 A A 18 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A G 6 N1 ? ? ? 1_555 A U 16 O2 ? ? A G 9 A U 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A G 6 O6 ? ? ? 1_555 A U 16 N3 ? ? A G 9 A U 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 14 N1 ? ? A U 10 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 14 N6 ? ? A U 10 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 8 N3 ? ? ? 1_555 A U 13 O4 ? ? A U 11 A U 16 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog18 hydrog ? ? A U 8 O2 ? ? ? 1_555 A U 13 N3 ? ? A U 11 A U 16 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H3 A U 7 ? ? O6 A G 20 ? ? 1.51 2 1 OP2 A G 15 ? ? HN21 A TOC 102 ? ? 1.56 3 1 O6 A G 9 ? ? H61 A A 18 ? ? 1.58 4 1 "HO2'" A A 17 ? ? "O4'" A A 18 ? ? 1.59 5 2 "HO2'" A G 14 ? ? OP1 A U 16 ? ? 1.52 6 2 H3 A U 7 ? ? O6 A G 20 ? ? 1.53 7 2 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.55 8 2 O4 A U 7 ? ? HN32 A TOA 100 ? ? 1.56 9 3 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.50 10 3 "HO2'" A G 14 ? ? OP1 A U 16 ? ? 1.52 11 3 H3 A U 7 ? ? O6 A G 20 ? ? 1.53 12 3 O6 A G 9 ? ? H61 A A 18 ? ? 1.56 13 3 H3 A U 11 ? ? O4 A U 16 ? ? 1.59 14 4 H3 A U 7 ? ? O6 A G 20 ? ? 1.50 15 4 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.53 16 4 "HO2'" A G 14 ? ? OP1 A U 16 ? ? 1.56 17 4 HN23 A TOC 102 ? ? O5 A 2TB 101 ? ? 1.58 18 4 O6 A G 9 ? ? H61 A A 18 ? ? 1.59 19 4 O6 A G 8 ? ? H3 A U 19 ? ? 1.60 20 5 OP2 A G 15 ? ? HN21 A TOC 102 ? ? 1.53 21 5 OP2 A U 10 ? ? HN31 A 2TB 101 ? ? 1.57 22 5 HN23 A TOC 102 ? ? O5 A 2TB 101 ? ? 1.59 23 6 H3 A U 7 ? ? O6 A G 20 ? ? 1.49 24 6 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.57 25 7 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.50 26 7 "HO2'" A G 14 ? ? OP1 A U 16 ? ? 1.51 27 7 H3 A U 7 ? ? O6 A G 20 ? ? 1.55 28 7 OP2 A G 8 ? ? HN13 A 2TB 101 ? ? 1.57 29 8 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.50 30 8 H3 A U 7 ? ? O6 A G 20 ? ? 1.55 31 9 O6 A G 9 ? ? H61 A A 18 ? ? 1.50 32 9 OP2 A G 15 ? ? HN22 A TOC 102 ? ? 1.51 33 9 O4 A U 7 ? ? HN31 A TOA 100 ? ? 1.55 34 9 H3 A U 7 ? ? O6 A G 20 ? ? 1.56 35 9 "HO2'" A A 17 ? ? "O4'" A A 18 ? ? 1.59 36 10 HN22 A TOC 102 ? ? O5 A 2TB 101 ? ? 1.47 37 10 H3 A U 7 ? ? O6 A G 20 ? ? 1.58 38 11 H3 A U 7 ? ? O6 A G 20 ? ? 1.48 39 11 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.57 40 11 OP2 A G 8 ? ? HN12 A 2TB 101 ? ? 1.59 41 12 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.50 42 12 "HO2'" A G 14 ? ? OP1 A U 16 ? ? 1.52 43 12 O6 A G 9 ? ? H61 A A 18 ? ? 1.52 44 12 H3 A U 7 ? ? O6 A G 20 ? ? 1.53 45 12 OP2 A G 15 ? ? HN21 A TOC 102 ? ? 1.53 46 12 O4 A U 7 ? ? HN33 A TOA 100 ? ? 1.58 47 12 HN23 A TOC 102 ? ? O5 A 2TB 101 ? ? 1.59 48 13 O4 A U 7 ? ? HN32 A TOA 100 ? ? 1.51 49 13 "HO2'" A G 15 ? ? OP2 A U 16 ? ? 1.54 50 13 HN22 A TOC 102 ? ? O5 A 2TB 101 ? ? 1.56 51 13 OP2 A G 8 ? ? HN11 A 2TB 101 ? ? 1.56 52 13 OP2 A G 15 ? ? HN23 A TOC 102 ? ? 1.59 53 13 O6 A G 8 ? ? H3 A U 19 ? ? 1.59 # _pdbx_nmr_ensemble.entry_id 2TOB _pdbx_nmr_ensemble.conformers_calculated_total_number 40 _pdbx_nmr_ensemble.conformers_submitted_total_number 13 _pdbx_nmr_ensemble.conformer_selection_criteria 'LOWEST NOE AND TOTAL ENERGY' # _pdbx_nmr_representative.entry_id 2TOB _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria ? # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents 'D(2)O/H(2)O' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure ? _pdbx_nmr_exptl_sample_conditions.pH 6.1 _pdbx_nmr_exptl_sample_conditions.ionic_strength '10mM NA(2)HPO(4)' _pdbx_nmr_exptl_sample_conditions.pressure_units . _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 NOESY 1 2 1 COSY 1 3 1 HMQCNULL 1 # _pdbx_nmr_details.entry_id 2TOB _pdbx_nmr_details.text ;D2O: 2D NOESY (50MS,120MS,200MS,300MS MIXING TIMES), PHASE-SENSITIVE COSY, TOCSY, 1H-13C HSQC, 3D NOESY-HMQC (120MS, 300MS MIXING TIMES), 3D HCCH-COSY, 3D HCCH-TOCSY (65MS), 2D HP CORRELATION, C13 FILTERED NOESY ; # _pdbx_nmr_refine.entry_id 2TOB _pdbx_nmr_refine.method 'DISTANCE-RESTRAINED MOLECULAR DYNAMICS' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement X-PLOR 3.1 BRUNGER 1 'structure solution' 'VARIAN VNMR' VNMR ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 2TB C1 C N R 1 2TB C2 C N N 2 2TB C3 C N S 3 2TB C4 C N R 4 2TB C5 C N S 5 2TB C6 C N S 6 2TB N1 N N N 7 2TB N3 N N N 8 2TB O5 O N N 9 2TB O4 O N N 10 2TB O6 O N N 11 2TB H1 H N N 12 2TB H21 H N N 13 2TB H22 H N N 14 2TB H3 H N N 15 2TB H4 H N N 16 2TB H5 H N N 17 2TB H6 H N N 18 2TB HN11 H N N 19 2TB HN12 H N N 20 2TB HN13 H N N 21 2TB HN31 H N N 22 2TB HN32 H N N 23 2TB HN33 H N N 24 2TB HO5 H N N 25 2TB HO4 H N N 26 2TB HO6 H N N 27 A OP3 O N N 28 A P P N N 29 A OP1 O N N 30 A OP2 O N N 31 A "O5'" O N N 32 A "C5'" C N N 33 A "C4'" C N R 34 A "O4'" O N N 35 A "C3'" C N S 36 A "O3'" O N N 37 A "C2'" C N R 38 A "O2'" O N N 39 A "C1'" C N R 40 A N9 N Y N 41 A C8 C Y N 42 A N7 N Y N 43 A C5 C Y N 44 A C6 C Y N 45 A N6 N N N 46 A N1 N Y N 47 A C2 C Y N 48 A N3 N Y N 49 A C4 C Y N 50 A HOP3 H N N 51 A HOP2 H N N 52 A "H5'" H N N 53 A "H5''" H N N 54 A "H4'" H N N 55 A "H3'" H N N 56 A "HO3'" H N N 57 A "H2'" H N N 58 A "HO2'" H N N 59 A "H1'" H N N 60 A H8 H N N 61 A H61 H N N 62 A H62 H N N 63 A H2 H N N 64 C OP3 O N N 65 C P P N N 66 C OP1 O N N 67 C OP2 O N N 68 C "O5'" O N N 69 C "C5'" C N N 70 C "C4'" C N R 71 C "O4'" O N N 72 C "C3'" C N S 73 C "O3'" O N N 74 C "C2'" C N R 75 C "O2'" O N N 76 C "C1'" C N R 77 C N1 N N N 78 C C2 C N N 79 C O2 O N N 80 C N3 N N N 81 C C4 C N N 82 C N4 N N N 83 C C5 C N N 84 C C6 C N N 85 C HOP3 H N N 86 C HOP2 H N N 87 C "H5'" H N N 88 C "H5''" H N N 89 C "H4'" H N N 90 C "H3'" H N N 91 C "HO3'" H N N 92 C "H2'" H N N 93 C "HO2'" H N N 94 C "H1'" H N N 95 C H41 H N N 96 C H42 H N N 97 C H5 H N N 98 C H6 H N N 99 G OP3 O N N 100 G P P N N 101 G OP1 O N N 102 G OP2 O N N 103 G "O5'" O N N 104 G "C5'" C N N 105 G "C4'" C N R 106 G "O4'" O N N 107 G "C3'" C N S 108 G "O3'" O N N 109 G "C2'" C N R 110 G "O2'" O N N 111 G "C1'" C N R 112 G N9 N Y N 113 G C8 C Y N 114 G N7 N Y N 115 G C5 C Y N 116 G C6 C N N 117 G O6 O N N 118 G N1 N N N 119 G C2 C N N 120 G N2 N N N 121 G N3 N N N 122 G C4 C Y N 123 G HOP3 H N N 124 G HOP2 H N N 125 G "H5'" H N N 126 G "H5''" H N N 127 G "H4'" H N N 128 G "H3'" H N N 129 G "HO3'" H N N 130 G "H2'" H N N 131 G "HO2'" H N N 132 G "H1'" H N N 133 G H8 H N N 134 G H1 H N N 135 G H21 H N N 136 G H22 H N N 137 TOA C1 C N S 138 TOA C2 C N R 139 TOA C3 C N S 140 TOA C4 C N S 141 TOA C5 C N R 142 TOA C6 C N N 143 TOA O1 O N N 144 TOA O2 O N N 145 TOA N3 N N N 146 TOA O4 O N N 147 TOA O5 O N N 148 TOA O6 O N N 149 TOA H1 H N N 150 TOA H2 H N N 151 TOA H3 H N N 152 TOA H4 H N N 153 TOA H5 H N N 154 TOA H61 H N N 155 TOA H62 H N N 156 TOA HO1 H N N 157 TOA HO2 H N N 158 TOA HN31 H N N 159 TOA HN32 H N N 160 TOA HN33 H N N 161 TOA HO4 H N N 162 TOA HO6 H N N 163 TOC C1 C N S 164 TOC C2 C N R 165 TOC C3 C N N 166 TOC C4 C N S 167 TOC C5 C N R 168 TOC C6 C N N 169 TOC N2 N N N 170 TOC N6 N N N 171 TOC O1 O N N 172 TOC O4 O N N 173 TOC O5 O N N 174 TOC H1 H N N 175 TOC H2 H N N 176 TOC H3 H N N 177 TOC H32 H N N 178 TOC H4 H N N 179 TOC H5 H N N 180 TOC H61 H N N 181 TOC H62 H N N 182 TOC HN21 H N N 183 TOC HN22 H N N 184 TOC HN23 H N N 185 TOC HN61 H N N 186 TOC HN62 H N N 187 TOC HN63 H N N 188 TOC HO1 H N N 189 TOC HO4 H N N 190 U OP3 O N N 191 U P P N N 192 U OP1 O N N 193 U OP2 O N N 194 U "O5'" O N N 195 U "C5'" C N N 196 U "C4'" C N R 197 U "O4'" O N N 198 U "C3'" C N S 199 U "O3'" O N N 200 U "C2'" C N R 201 U "O2'" O N N 202 U "C1'" C N R 203 U N1 N N N 204 U C2 C N N 205 U O2 O N N 206 U N3 N N N 207 U C4 C N N 208 U O4 O N N 209 U C5 C N N 210 U C6 C N N 211 U HOP3 H N N 212 U HOP2 H N N 213 U "H5'" H N N 214 U "H5''" H N N 215 U "H4'" H N N 216 U "H3'" H N N 217 U "HO3'" H N N 218 U "H2'" H N N 219 U "HO2'" H N N 220 U "H1'" H N N 221 U H3 H N N 222 U H5 H N N 223 U H6 H N N 224 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 2TB C1 C2 sing N N 1 2TB C1 C6 sing N N 2 2TB C1 N1 sing N N 3 2TB C1 H1 sing N N 4 2TB C2 C3 sing N N 5 2TB C2 H21 sing N N 6 2TB C2 H22 sing N N 7 2TB C3 C4 sing N N 8 2TB C3 N3 sing N N 9 2TB C3 H3 sing N N 10 2TB C4 C5 sing N N 11 2TB C4 O4 sing N N 12 2TB C4 H4 sing N N 13 2TB C5 C6 sing N N 14 2TB C5 O5 sing N N 15 2TB C5 H5 sing N N 16 2TB C6 O6 sing N N 17 2TB C6 H6 sing N N 18 2TB N1 HN11 sing N N 19 2TB N1 HN12 sing N N 20 2TB N1 HN13 sing N N 21 2TB N3 HN31 sing N N 22 2TB N3 HN32 sing N N 23 2TB N3 HN33 sing N N 24 2TB O5 HO5 sing N N 25 2TB O4 HO4 sing N N 26 2TB O6 HO6 sing N N 27 A OP3 P sing N N 28 A OP3 HOP3 sing N N 29 A P OP1 doub N N 30 A P OP2 sing N N 31 A P "O5'" sing N N 32 A OP2 HOP2 sing N N 33 A "O5'" "C5'" sing N N 34 A "C5'" "C4'" sing N N 35 A "C5'" "H5'" sing N N 36 A "C5'" "H5''" sing N N 37 A "C4'" "O4'" sing N N 38 A "C4'" "C3'" sing N N 39 A "C4'" "H4'" sing N N 40 A "O4'" "C1'" sing N N 41 A "C3'" "O3'" sing N N 42 A "C3'" "C2'" sing N N 43 A "C3'" "H3'" sing N N 44 A "O3'" "HO3'" sing N N 45 A "C2'" "O2'" sing N N 46 A "C2'" "C1'" sing N N 47 A "C2'" "H2'" sing N N 48 A "O2'" "HO2'" sing N N 49 A "C1'" N9 sing N N 50 A "C1'" "H1'" sing N N 51 A N9 C8 sing Y N 52 A N9 C4 sing Y N 53 A C8 N7 doub Y N 54 A C8 H8 sing N N 55 A N7 C5 sing Y N 56 A C5 C6 sing Y N 57 A C5 C4 doub Y N 58 A C6 N6 sing N N 59 A C6 N1 doub Y N 60 A N6 H61 sing N N 61 A N6 H62 sing N N 62 A N1 C2 sing Y N 63 A C2 N3 doub Y N 64 A C2 H2 sing N N 65 A N3 C4 sing Y N 66 C OP3 P sing N N 67 C OP3 HOP3 sing N N 68 C P OP1 doub N N 69 C P OP2 sing N N 70 C P "O5'" sing N N 71 C OP2 HOP2 sing N N 72 C "O5'" "C5'" sing N N 73 C "C5'" "C4'" sing N N 74 C "C5'" "H5'" sing N N 75 C "C5'" "H5''" sing N N 76 C "C4'" "O4'" sing N N 77 C "C4'" "C3'" sing N N 78 C "C4'" "H4'" sing N N 79 C "O4'" "C1'" sing N N 80 C "C3'" "O3'" sing N N 81 C "C3'" "C2'" sing N N 82 C "C3'" "H3'" sing N N 83 C "O3'" "HO3'" sing N N 84 C "C2'" "O2'" sing N N 85 C "C2'" "C1'" sing N N 86 C "C2'" "H2'" sing N N 87 C "O2'" "HO2'" sing N N 88 C "C1'" N1 sing N N 89 C "C1'" "H1'" sing N N 90 C N1 C2 sing N N 91 C N1 C6 sing N N 92 C C2 O2 doub N N 93 C C2 N3 sing N N 94 C N3 C4 doub N N 95 C C4 N4 sing N N 96 C C4 C5 sing N N 97 C N4 H41 sing N N 98 C N4 H42 sing N N 99 C C5 C6 doub N N 100 C C5 H5 sing N N 101 C C6 H6 sing N N 102 G OP3 P sing N N 103 G OP3 HOP3 sing N N 104 G P OP1 doub N N 105 G P OP2 sing N N 106 G P "O5'" sing N N 107 G OP2 HOP2 sing N N 108 G "O5'" "C5'" sing N N 109 G "C5'" "C4'" sing N N 110 G "C5'" "H5'" sing N N 111 G "C5'" "H5''" sing N N 112 G "C4'" "O4'" sing N N 113 G "C4'" "C3'" sing N N 114 G "C4'" "H4'" sing N N 115 G "O4'" "C1'" sing N N 116 G "C3'" "O3'" sing N N 117 G "C3'" "C2'" sing N N 118 G "C3'" "H3'" sing N N 119 G "O3'" "HO3'" sing N N 120 G "C2'" "O2'" sing N N 121 G "C2'" "C1'" sing N N 122 G "C2'" "H2'" sing N N 123 G "O2'" "HO2'" sing N N 124 G "C1'" N9 sing N N 125 G "C1'" "H1'" sing N N 126 G N9 C8 sing Y N 127 G N9 C4 sing Y N 128 G C8 N7 doub Y N 129 G C8 H8 sing N N 130 G N7 C5 sing Y N 131 G C5 C6 sing N N 132 G C5 C4 doub Y N 133 G C6 O6 doub N N 134 G C6 N1 sing N N 135 G N1 C2 sing N N 136 G N1 H1 sing N N 137 G C2 N2 sing N N 138 G C2 N3 doub N N 139 G N2 H21 sing N N 140 G N2 H22 sing N N 141 G N3 C4 sing N N 142 TOA C1 C2 sing N N 143 TOA C1 O1 sing N N 144 TOA C1 O5 sing N N 145 TOA C1 H1 sing N N 146 TOA C2 C3 sing N N 147 TOA C2 O2 sing N N 148 TOA C2 H2 sing N N 149 TOA C3 C4 sing N N 150 TOA C3 N3 sing N N 151 TOA C3 H3 sing N N 152 TOA C4 C5 sing N N 153 TOA C4 O4 sing N N 154 TOA C4 H4 sing N N 155 TOA C5 C6 sing N N 156 TOA C5 O5 sing N N 157 TOA C5 H5 sing N N 158 TOA C6 O6 sing N N 159 TOA C6 H61 sing N N 160 TOA C6 H62 sing N N 161 TOA O1 HO1 sing N N 162 TOA O2 HO2 sing N N 163 TOA N3 HN31 sing N N 164 TOA N3 HN32 sing N N 165 TOA N3 HN33 sing N N 166 TOA O4 HO4 sing N N 167 TOA O6 HO6 sing N N 168 TOC C1 C2 sing N N 169 TOC C1 O1 sing N N 170 TOC C1 O5 sing N N 171 TOC C1 H1 sing N N 172 TOC C2 C3 sing N N 173 TOC C2 N2 sing N N 174 TOC C2 H2 sing N N 175 TOC C3 C4 sing N N 176 TOC C3 H3 sing N N 177 TOC C3 H32 sing N N 178 TOC C4 C5 sing N N 179 TOC C4 O4 sing N N 180 TOC C4 H4 sing N N 181 TOC C5 C6 sing N N 182 TOC C5 O5 sing N N 183 TOC C5 H5 sing N N 184 TOC C6 N6 sing N N 185 TOC C6 H61 sing N N 186 TOC C6 H62 sing N N 187 TOC N2 HN21 sing N N 188 TOC N2 HN22 sing N N 189 TOC N2 HN23 sing N N 190 TOC N6 HN61 sing N N 191 TOC N6 HN62 sing N N 192 TOC N6 HN63 sing N N 193 TOC O1 HO1 sing N N 194 TOC O4 HO4 sing N N 195 U OP3 P sing N N 196 U OP3 HOP3 sing N N 197 U P OP1 doub N N 198 U P OP2 sing N N 199 U P "O5'" sing N N 200 U OP2 HOP2 sing N N 201 U "O5'" "C5'" sing N N 202 U "C5'" "C4'" sing N N 203 U "C5'" "H5'" sing N N 204 U "C5'" "H5''" sing N N 205 U "C4'" "O4'" sing N N 206 U "C4'" "C3'" sing N N 207 U "C4'" "H4'" sing N N 208 U "O4'" "C1'" sing N N 209 U "C3'" "O3'" sing N N 210 U "C3'" "C2'" sing N N 211 U "C3'" "H3'" sing N N 212 U "O3'" "HO3'" sing N N 213 U "C2'" "O2'" sing N N 214 U "C2'" "C1'" sing N N 215 U "C2'" "H2'" sing N N 216 U "O2'" "HO2'" sing N N 217 U "C1'" N1 sing N N 218 U "C1'" "H1'" sing N N 219 U N1 C2 sing N N 220 U N1 C6 sing N N 221 U C2 O2 doub N N 222 U C2 N3 sing N N 223 U N3 C4 sing N N 224 U N3 H3 sing N N 225 U C4 O4 doub N N 226 U C4 C5 sing N N 227 U C5 C6 doub N N 228 U C5 H5 sing N N 229 U C6 H6 sing N N 230 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 2TOB 'double helix' 2TOB 'a-form double helix' 2TOB 'hairpin loop' 2TOB 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 1 1_555 A U 20 1_555 0.131 -0.115 0.394 2.987 -7.322 5.314 1 A_A4:U23_A A 4 ? A 23 ? 20 1 1 A C 2 1_555 A G 19 1_555 0.501 -0.215 -0.076 15.780 -18.968 -6.275 2 A_C5:G22_A A 5 ? A 22 ? 19 1 1 A U 3 1_555 A A 18 1_555 -0.327 -0.166 -0.084 6.120 -6.299 -1.711 3 A_U6:A21_A A 6 ? A 21 ? 20 1 1 A U 4 1_555 A G 17 1_555 2.405 -0.809 0.114 5.881 -9.369 -12.004 4 A_U7:G20_A A 7 ? A 20 ? 28 1 1 A G 5 1_555 A U 16 1_555 -2.430 -0.126 -0.629 -1.092 -6.653 -73.920 5 A_G8:U19_A A 8 ? A 19 ? ? ? 1 A G 6 1_555 A A 15 1_555 -0.017 1.327 -0.149 7.006 14.962 -24.398 6 A_G9:A18_A A 9 ? A 18 ? 8 1 1 A U 7 1_555 A A 14 1_555 0.246 -0.045 -0.176 8.646 2.450 3.279 7 A_U10:A17_A A 10 ? A 17 ? 20 1 1 A U 8 1_555 A U 13 1_555 2.926 -1.884 0.033 15.979 -11.237 4.325 8 A_U11:U16_A A 11 ? A 16 ? 16 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 1 1_555 A U 20 1_555 A C 2 1_555 A G 19 1_555 -0.148 -1.176 2.817 4.015 -1.379 32.762 -1.867 0.850 2.825 -2.432 -7.081 33.028 1 AA_A4C5:G22U23_AA A 4 ? A 23 ? A 5 ? A 22 ? 1 A C 2 1_555 A G 19 1_555 A U 3 1_555 A A 18 1_555 -0.842 -1.725 3.093 -5.244 12.040 36.427 -3.917 0.701 2.512 18.536 8.072 38.646 2 AA_C5U6:A21G22_AA A 5 ? A 22 ? A 6 ? A 21 ? 1 A U 3 1_555 A A 18 1_555 A U 4 1_555 A G 17 1_555 1.171 -1.929 2.994 -1.219 2.861 41.928 -2.953 -1.745 2.829 3.991 1.701 42.038 3 AA_U6U7:G20A21_AA A 6 ? A 21 ? A 7 ? A 20 ? 1 A U 4 1_555 A G 17 1_555 A G 5 1_555 A U 16 1_555 -3.204 -1.980 2.935 0.132 16.042 20.947 -7.340 7.059 1.134 37.782 -0.312 26.330 4 AA_U7G8:U19G20_AA A 7 ? A 20 ? A 8 ? A 19 ? 1 A G 5 1_555 A U 16 1_555 A G 6 1_555 A A 15 1_555 0.899 -2.367 2.948 -5.681 3.178 40.620 -3.666 -1.808 2.620 4.543 8.121 41.117 5 AA_G8G9:A18U19_AA A 8 ? A 19 ? A 9 ? A 18 ? 1 A G 6 1_555 A A 15 1_555 A U 7 1_555 A A 14 1_555 0.911 -1.933 3.123 -3.496 7.278 25.356 -5.841 -2.767 2.342 16.069 7.719 26.590 6 AA_G9U10:A17A18_AA A 9 ? A 18 ? A 10 ? A 17 ? 1 A U 7 1_555 A A 14 1_555 A U 8 1_555 A U 13 1_555 0.194 -1.615 2.698 -2.721 2.636 43.662 -2.367 -0.470 2.585 3.537 3.651 43.818 7 AA_U10U11:U16A17_AA A 10 ? A 17 ? A 11 ? A 16 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength 1 UNITYPLUS Varian 500 2 UNITYPLUS Varian 600 # _atom_sites.entry_id 2TOB _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_