data_387D # _entry.id 387D # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 387D pdb_0000387d 10.2210/pdb387d/pdb NDB URX072 ? ? RCSB RCSB001353 ? ? WWPDB D_1000001353 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2003-08-26 2 'Structure model' 1 1 2008-04-26 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2018-04-04 5 'Structure model' 1 4 2023-12-27 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 5 'Structure model' 'Data collection' 5 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' diffrn_source 2 5 'Structure model' chem_comp_atom 3 5 'Structure model' chem_comp_bond 4 5 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_diffrn_source.type' 2 5 'Structure model' '_database_2.pdbx_DOI' 3 5 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 387D _pdbx_database_status.recvd_initial_deposition_date 1998-04-14 _pdbx_database_status.deposit_site NDB _pdbx_database_status.process_site NDB _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Lietzke, S.E.' 1 'Kundrot, C.E.' 2 'Barnes, C.L.' 3 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'The Structure of an RNA Pseudoknot Shows 3D Domain Swapping' ;Structure, Motion, Interaction and Expression of Biological Macromolecules, The Proceedings of the Tenth Conversation held at The University-SUNY, Albany NY, June 17-21, 1997 ; 10 91 101 1998 ? US 0-940030-75-6 ? ? -1 ? 1 'Preliminary X-ray Diffraction Studies of an RNA Pseudoknot that Inhibits HIV-1 Reverse Transcriptase' 'Acta Crystallogr.,Sect.D' 52 1018 1020 1996 ABCRE6 DK 0907-4449 0766 ? ? 10.1107/S0907444996004234 2 ;Comprehensive chemical modification interference and nucleotide substitution analysis of an RNA pseudoknot inhibitor to HIV-1 reverse transcriptase ; J.Mol.Biol. 247 60 68 1995 JMOBAK UK 0022-2836 0070 ? ? 10.1006/jmbi.1994.0122 3 'RNA pseudoknots that inhibit human immunodeficiency' Proc.Natl.Acad.Sci.USA 89 6988 6992 1992 PNASA6 US 0027-8424 0040 ? ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lietzke, S.E.' 1 ? primary 'Barnes, C.L.' 2 ? primary 'Malone, V.F.' 3 ? primary 'Jones, J.T.' 4 ? primary 'Kundrot, C.E.' 5 ? 1 'Jones, J.T.' 6 ? 1 'Barnes, C.L.' 7 ? 1 'Lietzke, S.E.' 8 ? 1 'Wieichenrieder, O.' 9 ? 1 'Doudna, J.A.' 10 ? 1 'Kundrot, C.E.' 11 ? 2 'Green, L.' 12 ? 2 'Waugh, S.' 13 ? 2 'Brinkley, J.P.' 14 ? 2 'Hostomska, Z.' 15 ? 2 'Tuerk, C.' 16 ? 3 'Tuerk, C.' 17 ? 3 'MacDougal, S.' 18 ? 3 'Gould, L.' 19 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA Pseudoknot' 8390.091 1 ? ? ? 26-mer 2 water nat water 18.015 6 ? ? ? ? # _entity_keywords.entity_id 1 _entity_keywords.text RNA # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UCCGAAGUGCAACGGGAAAAUGCACU _entity_poly.pdbx_seq_one_letter_code_can UCCGAAGUGCAACGGGAAAAUGCACU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name water _pdbx_entity_nonpoly.comp_id HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 C n 1 3 C n 1 4 G n 1 5 A n 1 6 A n 1 7 G n 1 8 U n 1 9 G n 1 10 C n 1 11 A n 1 12 A n 1 13 C n 1 14 G n 1 15 G n 1 16 G n 1 17 A n 1 18 A n 1 19 A n 1 20 A n 1 21 U n 1 22 G n 1 23 C n 1 24 A n 1 25 C n 1 26 U n # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 1 1 U U A . n A 1 2 C 2 2 2 C C A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 A 6 6 6 A A A . n A 1 7 G 7 7 7 G G A . n A 1 8 U 8 8 8 U U A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 C 13 13 13 C C A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 A 24 24 24 A A A . n A 1 25 C 25 25 25 C C A . n A 1 26 U 26 26 26 U U A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 HOH 1 27 1 HOH HOH A . B 2 HOH 2 28 2 HOH HOH A . B 2 HOH 3 29 3 HOH HOH A . B 2 HOH 4 30 4 HOH HOH A . B 2 HOH 5 31 5 HOH HOH A . B 2 HOH 6 32 6 HOH HOH A . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal XDS 'data scaling' . ? 1 XSCALE 'data scaling' . ? 2 X-PLOR refinement 3.1 ? 3 XDS 'data reduction' . ? 4 # _cell.entry_id 387D _cell.length_a 61.600 _cell.length_b 61.600 _cell.length_c 98.900 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 8 _cell.pdbx_unique_axis ? # _symmetry.entry_id 387D _symmetry.space_group_name_H-M 'P 43 2 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting tetragonal _symmetry.Int_Tables_number 95 # _exptl.entry_id 387D _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_percent_sol 78.00 _exptl_crystal.density_Matthews 5.59 _exptl_crystal.description ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 293.00 _exptl_crystal_grow.pH 6.50 _exptl_crystal_grow.pdbx_details 'pH 6.50, VAPOR DIFFUSION, HANGING DROP, temperature 293.00K' _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pdbx_pH_range . # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.details 1 1 1 MGCL2 1 2 3 1 2 1 'SODIUM CACODYLATE' 4 5 6 1 3 1 'SODIUM ACETATE' 7 8 9 1 4 2 'SODIUM CACODYLATE' 10 11 12 1 5 2 'SODIUM ACETATE' 13 14 15 # _diffrn.id 1 _diffrn.ambient_temp 100.00 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector 'AREA DETECTOR' _diffrn_detector.type SIEMENS _diffrn_detector.pdbx_collection_date 1995-10-26 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength . _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source 'ROTATING ANODE' _diffrn_source.type 'RIGAKU RU200' _diffrn_source.pdbx_synchrotron_site ? _diffrn_source.pdbx_synchrotron_beamline ? _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list ? # _reflns.entry_id 387D _reflns.observed_criterion_sigma_I 0.000 _reflns.observed_criterion_sigma_F 0.000 _reflns.d_resolution_low 50.000 _reflns.d_resolution_high 3.100 _reflns.number_obs 3615 _reflns.number_all 3615 _reflns.percent_possible_obs 95.200 _reflns.pdbx_Rmerge_I_obs 0.051 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 2.700 _reflns.R_free_details ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _refine.entry_id 387D _refine.ls_number_reflns_obs 3467 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.000 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 10.000 _refine.ls_d_res_high 3.100 _refine.ls_percent_reflns_obs ? _refine.ls_R_factor_obs 0.1811 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.181 _refine.ls_R_factor_R_free 0.234 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 7.3 _refine.ls_number_reflns_R_free 254 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.overall_SU_B ? _refine.ls_redundancy_reflns_obs ? _refine.correlation_coeff_Fo_to_Fc ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 639 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.number_atoms_solvent 18 _refine_hist.number_atoms_total 657 _refine_hist.d_res_high 3.100 _refine_hist.d_res_low 10.000 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function x_bond_d 0.013 ? ? ? 'X-RAY DIFFRACTION' ? x_bond_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_bond_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg 1.61 ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_mcbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_mcangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_scbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_scangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? # _database_PDB_matrix.entry_id 387D _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 387D _struct.title 'RNA Pseudoknot with 3D Domain Swapping' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 387D _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA PSEUDOKNOT, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 387D _struct_ref.pdbx_db_accession 387D _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 387D _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 26 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 387D _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 26 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 26 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.pdbx_parent_biol_id ? _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A U 1 N3 ? ? ? 1_555 A A 18 N1 ? ? A U 1 A A 18 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog2 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 15 N1 ? ? A C 2 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 15 O6 ? ? A C 2 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 15 N2 ? ? A C 2 A G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 14 N1 ? ? A C 3 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 14 O6 ? ? A C 3 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 3 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 13 N3 ? ? A G 4 A C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 13 O2 ? ? A G 4 A C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 13 N4 ? ? A G 4 A C 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 5 N1 ? ? ? 1_555 A A 12 N6 ? ? A A 5 A A 12 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 O6 _pdbx_validate_symm_contact.auth_asym_id_1 A _pdbx_validate_symm_contact.auth_comp_id_1 G _pdbx_validate_symm_contact.auth_seq_id_1 16 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 O6 _pdbx_validate_symm_contact.auth_asym_id_2 A _pdbx_validate_symm_contact.auth_comp_id_2 G _pdbx_validate_symm_contact.auth_seq_id_2 16 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 6_566 _pdbx_validate_symm_contact.dist 2.14 # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 1 _pdbx_validate_rmsd_bond.auth_atom_id_1 C5 _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 A _pdbx_validate_rmsd_bond.auth_seq_id_1 20 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 C6 _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 A _pdbx_validate_rmsd_bond.auth_seq_id_2 20 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.347 _pdbx_validate_rmsd_bond.bond_target_value 1.406 _pdbx_validate_rmsd_bond.bond_deviation -0.059 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.009 _pdbx_validate_rmsd_bond.linker_flag N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 G A 4 ? ? 0.061 'SIDE CHAIN' 2 1 A A 5 ? ? 0.075 'SIDE CHAIN' 3 1 C A 10 ? ? 0.085 'SIDE CHAIN' 4 1 A A 11 ? ? 0.056 'SIDE CHAIN' 5 1 G A 14 ? ? 0.081 'SIDE CHAIN' 6 1 G A 16 ? ? 0.069 'SIDE CHAIN' 7 1 C A 25 ? ? 0.093 'SIDE CHAIN' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 U OP3 O N N 114 U P P N N 115 U OP1 O N N 116 U OP2 O N N 117 U "O5'" O N N 118 U "C5'" C N N 119 U "C4'" C N R 120 U "O4'" O N N 121 U "C3'" C N S 122 U "O3'" O N N 123 U "C2'" C N R 124 U "O2'" O N N 125 U "C1'" C N R 126 U N1 N N N 127 U C2 C N N 128 U O2 O N N 129 U N3 N N N 130 U C4 C N N 131 U O4 O N N 132 U C5 C N N 133 U C6 C N N 134 U HOP3 H N N 135 U HOP2 H N N 136 U "H5'" H N N 137 U "H5''" H N N 138 U "H4'" H N N 139 U "H3'" H N N 140 U "HO3'" H N N 141 U "H2'" H N N 142 U "HO2'" H N N 143 U "H1'" H N N 144 U H3 H N N 145 U H5 H N N 146 U H6 H N N 147 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 387D 'double helix' 387D 'hairpin loop' 387D 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A U 1 1_555 A A 18 1_555 -0.481 0.090 1.105 -0.358 -5.449 14.074 1 A_U1:A18_A A 1 ? A 18 ? ? ? 1 A C 2 1_555 A G 15 1_555 0.361 -0.492 0.607 -7.221 -25.282 -1.335 2 A_C2:G15_A A 2 ? A 15 ? 19 1 1 A C 3 1_555 A G 14 1_555 -0.074 -0.276 0.848 -34.730 1.885 -3.427 3 A_C3:G14_A A 3 ? A 14 ? 19 1 1 A G 4 1_555 A C 13 1_555 0.088 -0.206 0.656 18.089 -4.598 -3.478 4 A_G4:C13_A A 4 ? A 13 ? 19 1 1 A A 5 1_555 A A 12 1_555 1.976 0.901 0.338 -15.670 29.727 -173.849 5 A_A5:A12_A A 5 ? A 12 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A U 1 1_555 A A 18 1_555 A C 2 1_555 A G 15 1_555 0.952 -1.509 2.947 4.803 3.993 55.940 -1.803 -0.765 2.908 4.242 -5.102 56.260 1 AA_U1C2:G15A18_AA A 1 ? A 18 ? A 2 ? A 15 ? 1 A C 2 1_555 A G 15 1_555 A C 3 1_555 A G 14 1_555 0.769 -0.765 3.865 1.490 8.774 41.308 -2.111 -0.890 3.660 12.266 -2.083 42.214 2 AA_C2C3:G14G15_AA A 2 ? A 15 ? A 3 ? A 14 ? 1 A C 3 1_555 A G 14 1_555 A G 4 1_555 A C 13 1_555 -1.316 -1.218 1.786 -0.369 0.341 23.813 -3.012 3.123 1.789 0.826 0.895 23.818 3 AA_C3G4:C13G14_AA A 3 ? A 14 ? A 4 ? A 13 ? 1 A G 4 1_555 A C 13 1_555 A A 5 1_555 A A 12 1_555 3.343 -0.926 0.351 -88.931 -144.899 -133.633 0.555 1.616 0.699 72.792 -44.675 -176.073 4 AA_G4A5:A12C13_AA A 4 ? A 13 ? A 5 ? A 12 ? # _atom_sites.entry_id 387D _atom_sites.fract_transf_matrix[1][1] 0.016234 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016234 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010111 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_