data_3TD1 # _entry.id 3TD1 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 3TD1 pdb_00003td1 10.2210/pdb3td1/pdb NDB NA1271 ? ? RCSB RCSB067331 ? ? WWPDB D_1000067331 ? ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 1MWL 'Crystal structure of the bacterial wild-type ribosomal decoding site in complex with geneticin' unspecified PDB 3TD0 'Crystal structure of the bacterial A1408G-mutant and the protozoa cytoplasmic ribosomal decoding site' unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 3TD1 _pdbx_database_status.recvd_initial_deposition_date 2011-08-10 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # _audit_author.name 'Kondo, J.' _audit_author.pdbx_ordinal 1 # _citation.id primary _citation.title ;A structural basis for the antibiotic resistance conferred by an A1408G mutation in 16S rRNA and for the antiprotozoal activity of aminoglycosides ; _citation.journal_abbrev Angew.Chem.Int.Ed.Engl. _citation.journal_volume 51 _citation.page_first 465 _citation.page_last 468 _citation.year 2012 _citation.journal_id_ASTM ? _citation.country GE _citation.journal_id_ISSN 1433-7851 _citation.journal_id_CSD 9999 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 22110016 _citation.pdbx_database_id_DOI 10.1002/anie.201106084 # _citation_author.citation_id primary _citation_author.name 'Kondo, J.' _citation_author.ordinal 1 _citation_author.identifier_ORCID ? # _cell.entry_id 3TD1 _cell.length_a 33.470 _cell.length_b 88.300 _cell.length_c 46.210 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 8 _cell.pdbx_unique_axis ? _cell.length_a_esd ? _cell.length_b_esd ? _cell.length_c_esd ? _cell.angle_alpha_esd ? _cell.angle_beta_esd ? _cell.angle_gamma_esd ? # _symmetry.entry_id 3TD1 _symmetry.space_group_name_H-M 'P 21 21 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 18 _symmetry.space_group_name_Hall ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP*(5BU)P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') ; 7450.304 2 ? ? ? ? 2 non-polymer syn GENETICIN 496.552 2 ? ? ? ? 3 water nat water 18.015 189 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'UUGCGUCGCG(5BU)CGACGAAGUCGC' _entity_poly.pdbx_seq_one_letter_code_can UUGCGUCGCGUCGACGAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 U n 1 3 G n 1 4 C n 1 5 G n 1 6 U n 1 7 C n 1 8 G n 1 9 C n 1 10 G n 1 11 5BU n 1 12 C n 1 13 G n 1 14 A n 1 15 C n 1 16 G n 1 17 A n 1 18 A n 1 19 G n 1 20 U n 1 21 C n 1 22 G n 1 23 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'Synthetic RNA' # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 3TD1 _struct_ref.pdbx_db_accession 3TD1 _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 3TD1 A 1 ? 23 ? 3TD1 1 ? 23 ? 1 23 2 1 3TD1 B 1 ? 23 ? 3TD1 24 ? 46 ? 24 46 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 5BU 'RNA linking' n "5-BROMO-URIDINE-5'-MONOPHOSPHATE" ? 'C9 H12 Br N2 O9 P' 403.077 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GET non-polymer . GENETICIN G418 'C20 H40 N4 O10' 496.552 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.entry_id 3TD1 _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.29 _exptl_crystal.density_percent_sol 46.32 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_details ;Sodium Cacodylate, Spermine tetrahydrochloride, Ammonium chloride, 2-methyl-2,4-pentanediol , pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.id 1 _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 315r' _diffrn_detector.pdbx_collection_date 2011-02-26 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.0 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A' _diffrn_source.pdbx_synchrotron_site 'Photon Factory' _diffrn_source.pdbx_synchrotron_beamline BL-17A _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 1.0 # _reflns.entry_id 3TD1 _reflns.observed_criterion_sigma_I ? _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 31.9 _reflns.d_resolution_high 2.1 _reflns.number_obs 8461 _reflns.number_all ? _reflns.percent_possible_obs 99.9 _reflns.pdbx_Rmerge_I_obs 0.065 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 6.9 _reflns.R_free_details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_ordinal 1 _reflns.pdbx_diffrn_id 1 # _reflns_shell.d_res_high 2.1 _reflns_shell.d_res_low 2.2 _reflns_shell.percent_possible_all 100.0 _reflns_shell.Rmerge_I_obs 0.359 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.pdbx_redundancy 7.0 _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.number_possible ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.meanI_over_sigI_all ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 # _refine.entry_id 3TD1 _refine.ls_number_reflns_obs 8457 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 31.9 _refine.ls_d_res_high 2.1 _refine.ls_percent_reflns_obs ? _refine.ls_R_factor_obs ? _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.196 _refine.ls_R_factor_R_free 0.243 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free ? _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model 'PDB entry 1MWL' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details Random _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.ls_redundancy_reflns_obs ? _refine.B_iso_min ? _refine.B_iso_max ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_diffrn_id 1 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_overall_ESU_R ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 959 _refine_hist.pdbx_number_atoms_ligand 68 _refine_hist.number_atoms_solvent 189 _refine_hist.number_atoms_total 1216 _refine_hist.d_res_high 2.1 _refine_hist.d_res_low 31.9 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_restraint_function _refine_ls_restr.pdbx_refine_id c_bond_d 0.005 ? ? ? ? 'X-RAY DIFFRACTION' c_angle_deg 0.8 ? ? ? ? 'X-RAY DIFFRACTION' # _struct.entry_id 3TD1 _struct.title 'Crystal structure of the bacterial A1408G-mutant and the protozoa cytoplasmic ribosomal decoding site in complex with geneticin' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 3TD1 _struct_keywords.pdbx_keywords RNA/ANTIBIOTIC _struct_keywords.text 'decoding, ribosome, RNA-ANTIBIOTIC complex' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A G 10 "O3'" ? ? ? 1_555 A 5BU 11 P ? ? A G 10 A 5BU 11 1_555 ? ? ? ? ? ? ? 1.605 ? ? covale2 covale both ? A 5BU 11 "O3'" ? ? ? 1_555 A C 12 P ? ? A 5BU 11 A C 12 1_555 ? ? ? ? ? ? ? 1.608 ? ? covale3 covale both ? B G 10 "O3'" ? ? ? 1_555 B 5BU 11 P ? ? B G 33 B 5BU 34 1_555 ? ? ? ? ? ? ? 1.605 ? ? covale4 covale both ? B 5BU 11 "O3'" ? ? ? 1_555 B C 12 P ? ? B 5BU 34 B C 35 1_555 ? ? ? ? ? ? ? 1.608 ? ? hydrog1 hydrog ? ? A G 3 N1 ? ? ? 1_555 B C 23 N3 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 3 N2 ? ? ? 1_555 B C 23 O2 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 O6 ? ? ? 1_555 B C 23 N4 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 4 N3 ? ? ? 1_555 B G 22 N1 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 4 N4 ? ? ? 1_555 B G 22 O6 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 4 O2 ? ? ? 1_555 B G 22 N2 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 5 N1 ? ? ? 1_555 B C 21 N3 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 5 N2 ? ? ? 1_555 B C 21 O2 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 O6 ? ? ? 1_555 B C 21 N4 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 6 O4 ? ? ? 1_555 B U 20 N3 ? ? A U 6 B U 43 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A C 7 N3 ? ? ? 1_555 B G 19 N1 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 7 N4 ? ? ? 1_555 B G 19 O6 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 7 O2 ? ? ? 1_555 B G 19 N2 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 9 N3 ? ? ? 1_555 B G 16 N1 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 9 N4 ? ? ? 1_555 B G 16 O6 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 9 O2 ? ? ? 1_555 B G 16 N2 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 10 N1 ? ? ? 1_555 B C 15 N3 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 N2 ? ? ? 1_555 B C 15 O2 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 10 O6 ? ? ? 1_555 B C 15 N4 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A 5BU 11 N3 ? ? ? 1_555 B A 14 N1 ? ? A 5BU 11 B A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A 5BU 11 O4 ? ? ? 1_555 B A 14 N6 ? ? A 5BU 11 B A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 12 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 12 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 12 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 12 N3 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 12 O2 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 12 N4 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 14 N1 ? ? ? 1_555 B 5BU 11 N3 ? ? A A 14 B 5BU 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A A 14 N6 ? ? ? 1_555 B 5BU 11 O4 ? ? A A 14 B 5BU 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 15 N3 ? ? ? 1_555 B G 10 N1 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 15 N4 ? ? ? 1_555 B G 10 O6 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 O2 ? ? ? 1_555 B G 10 N2 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 16 N1 ? ? ? 1_555 B C 9 N3 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 16 N2 ? ? ? 1_555 B C 9 O2 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 16 O6 ? ? ? 1_555 B C 9 N4 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 7 N3 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 7 O2 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 7 N4 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 20 N3 ? ? ? 1_555 B U 6 O4 ? ? A U 20 B U 29 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog40 hydrog ? ? A C 21 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 21 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 21 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 22 N1 ? ? ? 1_555 B C 4 N3 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 22 N2 ? ? ? 1_555 B C 4 O2 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 22 O6 ? ? ? 1_555 B C 4 N4 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 23 N3 ? ? ? 1_555 B G 3 N1 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 23 N4 ? ? ? 1_555 B G 3 O6 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 23 O2 ? ? ? 1_555 B G 3 N2 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software B GET 50 ? 19 'BINDING SITE FOR RESIDUE GET B 50' AC2 Software B GET 51 ? 18 'BINDING SITE FOR RESIDUE GET B 51' 1 ? ? ? ? ? ? ? # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 19 G A 16 ? G A 16 . ? 1_555 ? 2 AC1 19 A A 17 ? A A 17 . ? 1_555 ? 3 AC1 19 A A 18 ? A A 18 . ? 1_555 ? 4 AC1 19 G A 19 ? G A 19 . ? 1_555 ? 5 AC1 19 U A 20 ? U A 20 . ? 1_555 ? 6 AC1 19 HOH E . ? HOH A 114 . ? 1_555 ? 7 AC1 19 HOH E . ? HOH A 135 . ? 1_555 ? 8 AC1 19 C B 4 ? C B 27 . ? 1_555 ? 9 AC1 19 G B 5 ? G B 28 . ? 1_555 ? 10 AC1 19 U B 6 ? U B 29 . ? 1_555 ? 11 AC1 19 C B 7 ? C B 30 . ? 1_555 ? 12 AC1 19 G B 8 ? G B 31 . ? 1_555 ? 13 AC1 19 C B 9 ? C B 32 . ? 1_555 ? 14 AC1 19 HOH F . ? HOH B 105 . ? 1_555 ? 15 AC1 19 HOH F . ? HOH B 127 . ? 1_555 ? 16 AC1 19 HOH F . ? HOH B 147 . ? 1_555 ? 17 AC1 19 HOH F . ? HOH B 178 . ? 1_555 ? 18 AC1 19 HOH F . ? HOH B 195 . ? 1_555 ? 19 AC1 19 HOH F . ? HOH B 222 . ? 1_555 ? 20 AC2 18 C A 4 ? C A 4 . ? 1_555 ? 21 AC2 18 G A 5 ? G A 5 . ? 1_555 ? 22 AC2 18 U A 6 ? U A 6 . ? 1_555 ? 23 AC2 18 C A 7 ? C A 7 . ? 1_555 ? 24 AC2 18 G A 8 ? G A 8 . ? 1_555 ? 25 AC2 18 C A 9 ? C A 9 . ? 1_555 ? 26 AC2 18 HOH E . ? HOH A 172 . ? 1_555 ? 27 AC2 18 G B 16 ? G B 39 . ? 1_555 ? 28 AC2 18 A B 17 ? A B 40 . ? 1_555 ? 29 AC2 18 A B 18 ? A B 41 . ? 1_555 ? 30 AC2 18 G B 19 ? G B 42 . ? 1_555 ? 31 AC2 18 U B 20 ? U B 43 . ? 1_555 ? 32 AC2 18 HOH F . ? HOH B 110 . ? 1_555 ? 33 AC2 18 HOH F . ? HOH B 115 . ? 1_555 ? 34 AC2 18 HOH F . ? HOH B 121 . ? 1_555 ? 35 AC2 18 HOH F . ? HOH B 130 . ? 1_555 ? 36 AC2 18 HOH F . ? HOH B 149 . ? 1_555 ? 37 AC2 18 HOH F . ? HOH B 157 . ? 1_555 ? # _database_PDB_matrix.entry_id 3TD1 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 3TD1 _atom_sites.fract_transf_matrix[1][1] 0.029878 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.011325 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.021640 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol BR C N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 1 ? ? ? A . n A 1 2 U 2 2 2 U U A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 G 8 8 8 G G A . n A 1 9 C 9 9 9 C C A . n A 1 10 G 10 10 10 G G A . n A 1 11 5BU 11 11 11 5BU 5BU A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n B 1 1 U 1 24 24 U U B . n B 1 2 U 2 25 25 U U B . n B 1 3 G 3 26 26 G G B . n B 1 4 C 4 27 27 C C B . n B 1 5 G 5 28 28 G G B . n B 1 6 U 6 29 29 U U B . n B 1 7 C 7 30 30 C C B . n B 1 8 G 8 31 31 G G B . n B 1 9 C 9 32 32 C C B . n B 1 10 G 10 33 33 G G B . n B 1 11 5BU 11 34 34 5BU 5BU B . n B 1 12 C 12 35 35 C C B . n B 1 13 G 13 36 36 G G B . n B 1 14 A 14 37 37 A A B . n B 1 15 C 15 38 38 C C B . n B 1 16 G 16 39 39 G G B . n B 1 17 A 17 40 40 A A B . n B 1 18 A 18 41 41 A A B . n B 1 19 G 19 42 42 G G B . n B 1 20 U 20 43 43 U U B . n B 1 21 C 21 44 44 C C B . n B 1 22 G 22 45 45 G G B . n B 1 23 C 23 46 46 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 GET 1 50 50 GET GET B . D 2 GET 1 51 51 GET GET B . E 3 HOH 1 101 101 HOH HOH A . E 3 HOH 2 102 102 HOH HOH A . E 3 HOH 3 107 107 HOH HOH A . E 3 HOH 4 109 109 HOH HOH A . E 3 HOH 5 112 112 HOH HOH A . E 3 HOH 6 114 114 HOH HOH A . E 3 HOH 7 117 117 HOH HOH A . E 3 HOH 8 118 118 HOH HOH A . E 3 HOH 9 122 122 HOH HOH A . E 3 HOH 10 123 123 HOH HOH A . E 3 HOH 11 126 126 HOH HOH A . E 3 HOH 12 129 129 HOH HOH A . E 3 HOH 13 132 132 HOH HOH A . E 3 HOH 14 135 135 HOH HOH A . E 3 HOH 15 136 136 HOH HOH A . E 3 HOH 16 137 137 HOH HOH A . E 3 HOH 17 139 139 HOH HOH A . E 3 HOH 18 140 140 HOH HOH A . E 3 HOH 19 143 143 HOH HOH A . E 3 HOH 20 144 144 HOH HOH A . E 3 HOH 21 146 146 HOH HOH A . E 3 HOH 22 150 150 HOH HOH A . E 3 HOH 23 151 151 HOH HOH A . E 3 HOH 24 153 153 HOH HOH A . E 3 HOH 25 154 154 HOH HOH A . E 3 HOH 26 155 155 HOH HOH A . E 3 HOH 27 158 158 HOH HOH A . E 3 HOH 28 159 159 HOH HOH A . E 3 HOH 29 163 163 HOH HOH A . E 3 HOH 30 164 164 HOH HOH A . E 3 HOH 31 165 165 HOH HOH A . E 3 HOH 32 172 172 HOH HOH A . E 3 HOH 33 173 173 HOH HOH A . E 3 HOH 34 174 174 HOH HOH A . E 3 HOH 35 175 175 HOH HOH A . E 3 HOH 36 180 180 HOH HOH A . E 3 HOH 37 181 181 HOH HOH A . E 3 HOH 38 182 182 HOH HOH A . E 3 HOH 39 183 183 HOH HOH A . E 3 HOH 40 185 185 HOH HOH A . E 3 HOH 41 188 188 HOH HOH A . E 3 HOH 42 190 190 HOH HOH A . E 3 HOH 43 191 191 HOH HOH A . E 3 HOH 44 196 196 HOH HOH A . E 3 HOH 45 197 197 HOH HOH A . E 3 HOH 46 198 198 HOH HOH A . E 3 HOH 47 199 199 HOH HOH A . E 3 HOH 48 200 200 HOH HOH A . E 3 HOH 49 201 201 HOH HOH A . E 3 HOH 50 207 207 HOH HOH A . E 3 HOH 51 208 208 HOH HOH A . E 3 HOH 52 209 209 HOH HOH A . E 3 HOH 53 210 210 HOH HOH A . E 3 HOH 54 212 212 HOH HOH A . E 3 HOH 55 214 214 HOH HOH A . E 3 HOH 56 219 219 HOH HOH A . E 3 HOH 57 223 223 HOH HOH A . E 3 HOH 58 226 226 HOH HOH A . E 3 HOH 59 230 230 HOH HOH A . E 3 HOH 60 231 231 HOH HOH A . E 3 HOH 61 232 232 HOH HOH A . E 3 HOH 62 239 239 HOH HOH A . E 3 HOH 63 240 240 HOH HOH A . E 3 HOH 64 242 242 HOH HOH A . E 3 HOH 65 245 245 HOH HOH A . E 3 HOH 66 246 246 HOH HOH A . E 3 HOH 67 248 248 HOH HOH A . E 3 HOH 68 249 249 HOH HOH A . E 3 HOH 69 250 250 HOH HOH A . E 3 HOH 70 251 251 HOH HOH A . E 3 HOH 71 253 253 HOH HOH A . E 3 HOH 72 255 255 HOH HOH A . E 3 HOH 73 256 256 HOH HOH A . E 3 HOH 74 258 258 HOH HOH A . E 3 HOH 75 259 259 HOH HOH A . E 3 HOH 76 261 261 HOH HOH A . E 3 HOH 77 262 262 HOH HOH A . E 3 HOH 78 263 263 HOH HOH A . E 3 HOH 79 268 268 HOH HOH A . E 3 HOH 80 269 269 HOH HOH A . E 3 HOH 81 270 270 HOH HOH A . E 3 HOH 82 277 277 HOH HOH A . E 3 HOH 83 280 280 HOH HOH A . E 3 HOH 84 282 282 HOH HOH A . E 3 HOH 85 283 283 HOH HOH A . E 3 HOH 86 286 286 HOH HOH A . E 3 HOH 87 287 287 HOH HOH A . E 3 HOH 88 288 288 HOH HOH A . E 3 HOH 89 289 289 HOH HOH A . F 3 HOH 1 103 103 HOH HOH B . F 3 HOH 2 104 104 HOH HOH B . F 3 HOH 3 105 105 HOH HOH B . F 3 HOH 4 106 106 HOH HOH B . F 3 HOH 5 108 108 HOH HOH B . F 3 HOH 6 110 110 HOH HOH B . F 3 HOH 7 111 111 HOH HOH B . F 3 HOH 8 113 113 HOH HOH B . F 3 HOH 9 115 115 HOH HOH B . F 3 HOH 10 116 116 HOH HOH B . F 3 HOH 11 119 119 HOH HOH B . F 3 HOH 12 120 120 HOH HOH B . F 3 HOH 13 121 121 HOH HOH B . F 3 HOH 14 124 124 HOH HOH B . F 3 HOH 15 125 125 HOH HOH B . F 3 HOH 16 127 127 HOH HOH B . F 3 HOH 17 128 128 HOH HOH B . F 3 HOH 18 130 130 HOH HOH B . F 3 HOH 19 131 131 HOH HOH B . F 3 HOH 20 133 133 HOH HOH B . F 3 HOH 21 134 134 HOH HOH B . F 3 HOH 22 138 138 HOH HOH B . F 3 HOH 23 141 141 HOH HOH B . F 3 HOH 24 142 142 HOH HOH B . F 3 HOH 25 145 145 HOH HOH B . F 3 HOH 26 147 147 HOH HOH B . F 3 HOH 27 148 148 HOH HOH B . F 3 HOH 28 149 149 HOH HOH B . F 3 HOH 29 152 152 HOH HOH B . F 3 HOH 30 156 156 HOH HOH B . F 3 HOH 31 157 157 HOH HOH B . F 3 HOH 32 160 160 HOH HOH B . F 3 HOH 33 161 161 HOH HOH B . F 3 HOH 34 162 162 HOH HOH B . F 3 HOH 35 166 166 HOH HOH B . F 3 HOH 36 167 167 HOH HOH B . F 3 HOH 37 168 168 HOH HOH B . F 3 HOH 38 169 169 HOH HOH B . F 3 HOH 39 170 170 HOH HOH B . F 3 HOH 40 171 171 HOH HOH B . F 3 HOH 41 176 176 HOH HOH B . F 3 HOH 42 177 177 HOH HOH B . F 3 HOH 43 178 178 HOH HOH B . F 3 HOH 44 179 179 HOH HOH B . F 3 HOH 45 184 184 HOH HOH B . F 3 HOH 46 186 186 HOH HOH B . F 3 HOH 47 187 187 HOH HOH B . F 3 HOH 48 189 189 HOH HOH B . F 3 HOH 49 192 192 HOH HOH B . F 3 HOH 50 193 193 HOH HOH B . F 3 HOH 51 194 194 HOH HOH B . F 3 HOH 52 195 195 HOH HOH B . F 3 HOH 53 202 202 HOH HOH B . F 3 HOH 54 203 203 HOH HOH B . F 3 HOH 55 204 204 HOH HOH B . F 3 HOH 56 205 205 HOH HOH B . F 3 HOH 57 206 206 HOH HOH B . F 3 HOH 58 211 211 HOH HOH B . F 3 HOH 59 213 213 HOH HOH B . F 3 HOH 60 215 215 HOH HOH B . F 3 HOH 61 216 216 HOH HOH B . F 3 HOH 62 217 217 HOH HOH B . F 3 HOH 63 218 218 HOH HOH B . F 3 HOH 64 220 220 HOH HOH B . F 3 HOH 65 221 221 HOH HOH B . F 3 HOH 66 222 222 HOH HOH B . F 3 HOH 67 224 224 HOH HOH B . F 3 HOH 68 225 225 HOH HOH B . F 3 HOH 69 227 227 HOH HOH B . F 3 HOH 70 228 228 HOH HOH B . F 3 HOH 71 229 229 HOH HOH B . F 3 HOH 72 233 233 HOH HOH B . F 3 HOH 73 234 234 HOH HOH B . F 3 HOH 74 235 235 HOH HOH B . F 3 HOH 75 236 236 HOH HOH B . F 3 HOH 76 237 237 HOH HOH B . F 3 HOH 77 238 238 HOH HOH B . F 3 HOH 78 241 241 HOH HOH B . F 3 HOH 79 243 243 HOH HOH B . F 3 HOH 80 244 244 HOH HOH B . F 3 HOH 81 247 247 HOH HOH B . F 3 HOH 82 252 252 HOH HOH B . F 3 HOH 83 254 254 HOH HOH B . F 3 HOH 84 257 257 HOH HOH B . F 3 HOH 85 260 260 HOH HOH B . F 3 HOH 86 264 264 HOH HOH B . F 3 HOH 87 265 265 HOH HOH B . F 3 HOH 88 266 266 HOH HOH B . F 3 HOH 89 267 267 HOH HOH B . F 3 HOH 90 271 271 HOH HOH B . F 3 HOH 91 272 272 HOH HOH B . F 3 HOH 92 273 273 HOH HOH B . F 3 HOH 93 274 274 HOH HOH B . F 3 HOH 94 275 275 HOH HOH B . F 3 HOH 95 276 276 HOH HOH B . F 3 HOH 96 278 278 HOH HOH B . F 3 HOH 97 279 279 HOH HOH B . F 3 HOH 98 281 281 HOH HOH B . F 3 HOH 99 284 284 HOH HOH B . F 3 HOH 100 285 285 HOH HOH B . # loop_ _pdbx_struct_mod_residue.id _pdbx_struct_mod_residue.label_asym_id _pdbx_struct_mod_residue.label_comp_id _pdbx_struct_mod_residue.label_seq_id _pdbx_struct_mod_residue.auth_asym_id _pdbx_struct_mod_residue.auth_comp_id _pdbx_struct_mod_residue.auth_seq_id _pdbx_struct_mod_residue.PDB_ins_code _pdbx_struct_mod_residue.parent_comp_id _pdbx_struct_mod_residue.details 1 A 5BU 11 A 5BU 11 ? U "5-BROMO-URIDINE-5'-MONOPHOSPHATE" 2 B 5BU 11 B 5BU 34 ? U "5-BROMO-URIDINE-5'-MONOPHOSPHATE" # _struct_site_keywords.site_id 1 _struct_site_keywords.text 'MAJOR GROOVE BINDER' # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 5460 ? 1 MORE -46 ? 1 'SSA (A^2)' 7970 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_special_symmetry.id _pdbx_struct_special_symmetry.PDB_model_num _pdbx_struct_special_symmetry.auth_asym_id _pdbx_struct_special_symmetry.auth_comp_id _pdbx_struct_special_symmetry.auth_seq_id _pdbx_struct_special_symmetry.PDB_ins_code _pdbx_struct_special_symmetry.label_asym_id _pdbx_struct_special_symmetry.label_comp_id _pdbx_struct_special_symmetry.label_seq_id 1 1 A HOH 223 ? E HOH . 2 1 B HOH 224 ? F HOH . # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2011-12-07 2 'Structure model' 1 1 2014-03-12 3 'Structure model' 1 2 2023-11-01 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' 5 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' chem_comp_atom 2 3 'Structure model' chem_comp_bond 3 3 'Structure model' database_2 4 3 'Structure model' pdbx_initial_refinement_model 5 3 'Structure model' struct_conn 6 3 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_struct_conn.pdbx_leaving_atom_flag' 4 3 'Structure model' '_struct_site.pdbx_auth_asym_id' 5 3 'Structure model' '_struct_site.pdbx_auth_comp_id' 6 3 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal PHENIX 'model building' . ? 1 CNS refinement . ? 2 d*TREK 'data reduction' . ? 3 SCALA 'data scaling' . ? 4 PHENIX phasing . ? 5 # _pdbx_unobs_or_zero_occ_residues.id 1 _pdbx_unobs_or_zero_occ_residues.PDB_model_num 1 _pdbx_unobs_or_zero_occ_residues.polymer_flag Y _pdbx_unobs_or_zero_occ_residues.occupancy_flag 1 _pdbx_unobs_or_zero_occ_residues.auth_asym_id A _pdbx_unobs_or_zero_occ_residues.auth_comp_id U _pdbx_unobs_or_zero_occ_residues.auth_seq_id 1 _pdbx_unobs_or_zero_occ_residues.PDB_ins_code ? _pdbx_unobs_or_zero_occ_residues.label_asym_id A _pdbx_unobs_or_zero_occ_residues.label_comp_id U _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 5BU P P N N 1 5BU OP1 O N N 2 5BU OP2 O N N 3 5BU OP3 O N N 4 5BU "O5'" O N N 5 5BU "C5'" C N N 6 5BU "C4'" C N R 7 5BU "O4'" O N N 8 5BU "C3'" C N S 9 5BU "O3'" O N N 10 5BU "C2'" C N R 11 5BU "O2'" O N N 12 5BU "C1'" C N R 13 5BU N1 N N N 14 5BU C2 C N N 15 5BU O2 O N N 16 5BU N3 N N N 17 5BU C4 C N N 18 5BU O4 O N N 19 5BU C5 C N N 20 5BU C6 C N N 21 5BU BR BR N N 22 5BU HOP2 H N N 23 5BU HOP3 H N N 24 5BU "H5'" H N N 25 5BU "H5''" H N N 26 5BU "H4'" H N N 27 5BU "H3'" H N N 28 5BU "HO3'" H N N 29 5BU "H2'" H N N 30 5BU "HO2'" H N N 31 5BU "H1'" H N N 32 5BU H3 H N N 33 5BU H6 H N N 34 A OP3 O N N 35 A P P N N 36 A OP1 O N N 37 A OP2 O N N 38 A "O5'" O N N 39 A "C5'" C N N 40 A "C4'" C N R 41 A "O4'" O N N 42 A "C3'" C N S 43 A "O3'" O N N 44 A "C2'" C N R 45 A "O2'" O N N 46 A "C1'" C N R 47 A N9 N Y N 48 A C8 C Y N 49 A N7 N Y N 50 A C5 C Y N 51 A C6 C Y N 52 A N6 N N N 53 A N1 N Y N 54 A C2 C Y N 55 A N3 N Y N 56 A C4 C Y N 57 A HOP3 H N N 58 A HOP2 H N N 59 A "H5'" H N N 60 A "H5''" H N N 61 A "H4'" H N N 62 A "H3'" H N N 63 A "HO3'" H N N 64 A "H2'" H N N 65 A "HO2'" H N N 66 A "H1'" H N N 67 A H8 H N N 68 A H61 H N N 69 A H62 H N N 70 A H2 H N N 71 C OP3 O N N 72 C P P N N 73 C OP1 O N N 74 C OP2 O N N 75 C "O5'" O N N 76 C "C5'" C N N 77 C "C4'" C N R 78 C "O4'" O N N 79 C "C3'" C N S 80 C "O3'" O N N 81 C "C2'" C N R 82 C "O2'" O N N 83 C "C1'" C N R 84 C N1 N N N 85 C C2 C N N 86 C O2 O N N 87 C N3 N N N 88 C C4 C N N 89 C N4 N N N 90 C C5 C N N 91 C C6 C N N 92 C HOP3 H N N 93 C HOP2 H N N 94 C "H5'" H N N 95 C "H5''" H N N 96 C "H4'" H N N 97 C "H3'" H N N 98 C "HO3'" H N N 99 C "H2'" H N N 100 C "HO2'" H N N 101 C "H1'" H N N 102 C H41 H N N 103 C H42 H N N 104 C H5 H N N 105 C H6 H N N 106 G OP3 O N N 107 G P P N N 108 G OP1 O N N 109 G OP2 O N N 110 G "O5'" O N N 111 G "C5'" C N N 112 G "C4'" C N R 113 G "O4'" O N N 114 G "C3'" C N S 115 G "O3'" O N N 116 G "C2'" C N R 117 G "O2'" O N N 118 G "C1'" C N R 119 G N9 N Y N 120 G C8 C Y N 121 G N7 N Y N 122 G C5 C Y N 123 G C6 C N N 124 G O6 O N N 125 G N1 N N N 126 G C2 C N N 127 G N2 N N N 128 G N3 N N N 129 G C4 C Y N 130 G HOP3 H N N 131 G HOP2 H N N 132 G "H5'" H N N 133 G "H5''" H N N 134 G "H4'" H N N 135 G "H3'" H N N 136 G "HO3'" H N N 137 G "H2'" H N N 138 G "HO2'" H N N 139 G "H1'" H N N 140 G H8 H N N 141 G H1 H N N 142 G H21 H N N 143 G H22 H N N 144 GET C11 C N S 145 GET O11 O N N 146 GET C21 C N R 147 GET N21 N N N 148 GET C31 C N R 149 GET O31 O N N 150 GET C41 C N S 151 GET O41 O N N 152 GET C51 C N R 153 GET O51 O N N 154 GET C61 C N R 155 GET O61 O N N 156 GET C71 C N N 157 GET C12 C N R 158 GET N12 N N N 159 GET C22 C N N 160 GET C32 C N S 161 GET N32 N N N 162 GET C42 C N R 163 GET C52 C N S 164 GET O52 O N N 165 GET C62 C N S 166 GET O62 O N N 167 GET C13 C N R 168 GET C23 C N R 169 GET O23 O N N 170 GET C33 C N R 171 GET N33 N N N 172 GET C93 C N N 173 GET C43 C N R 174 GET O43 O N N 175 GET C83 C N N 176 GET C53 C N N 177 GET O53 O N N 178 GET H111 H N N 179 GET H21 H N N 180 GET H211 H N N 181 GET H212 H N N 182 GET H311 H N N 183 GET H31 H N N 184 GET H411 H N N 185 GET H41 H N N 186 GET H511 H N N 187 GET H611 H N N 188 GET H61 H N N 189 GET H711 H N N 190 GET H712 H N N 191 GET H713 H N N 192 GET H12 H N N 193 GET H121 H N N 194 GET H122 H N N 195 GET H221 H N N 196 GET H222 H N N 197 GET H32 H N N 198 GET H321 H N N 199 GET H322 H N N 200 GET H421 H N N 201 GET H521 H N N 202 GET H52 H N N 203 GET H621 H N N 204 GET H131 H N N 205 GET H231 H N N 206 GET H23 H N N 207 GET H331 H N N 208 GET H33 H N N 209 GET H931 H N N 210 GET H932 H N N 211 GET H933 H N N 212 GET H43 H N N 213 GET H831 H N N 214 GET H832 H N N 215 GET H833 H N N 216 GET H531 H N N 217 GET H532 H N N 218 HOH O O N N 219 HOH H1 H N N 220 HOH H2 H N N 221 U OP3 O N N 222 U P P N N 223 U OP1 O N N 224 U OP2 O N N 225 U "O5'" O N N 226 U "C5'" C N N 227 U "C4'" C N R 228 U "O4'" O N N 229 U "C3'" C N S 230 U "O3'" O N N 231 U "C2'" C N R 232 U "O2'" O N N 233 U "C1'" C N R 234 U N1 N N N 235 U C2 C N N 236 U O2 O N N 237 U N3 N N N 238 U C4 C N N 239 U O4 O N N 240 U C5 C N N 241 U C6 C N N 242 U HOP3 H N N 243 U HOP2 H N N 244 U "H5'" H N N 245 U "H5''" H N N 246 U "H4'" H N N 247 U "H3'" H N N 248 U "HO3'" H N N 249 U "H2'" H N N 250 U "HO2'" H N N 251 U "H1'" H N N 252 U H3 H N N 253 U H5 H N N 254 U H6 H N N 255 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 5BU P OP1 doub N N 1 5BU P OP2 sing N N 2 5BU P OP3 sing N N 3 5BU P "O5'" sing N N 4 5BU OP2 HOP2 sing N N 5 5BU OP3 HOP3 sing N N 6 5BU "O5'" "C5'" sing N N 7 5BU "C5'" "C4'" sing N N 8 5BU "C5'" "H5'" sing N N 9 5BU "C5'" "H5''" sing N N 10 5BU "C4'" "O4'" sing N N 11 5BU "C4'" "C3'" sing N N 12 5BU "C4'" "H4'" sing N N 13 5BU "O4'" "C1'" sing N N 14 5BU "C3'" "O3'" sing N N 15 5BU "C3'" "C2'" sing N N 16 5BU "C3'" "H3'" sing N N 17 5BU "O3'" "HO3'" sing N N 18 5BU "C2'" "O2'" sing N N 19 5BU "C2'" "C1'" sing N N 20 5BU "C2'" "H2'" sing N N 21 5BU "O2'" "HO2'" sing N N 22 5BU "C1'" N1 sing N N 23 5BU "C1'" "H1'" sing N N 24 5BU N1 C2 sing N N 25 5BU N1 C6 sing N N 26 5BU C2 O2 doub N N 27 5BU C2 N3 sing N N 28 5BU N3 C4 sing N N 29 5BU N3 H3 sing N N 30 5BU C4 O4 doub N N 31 5BU C4 C5 sing N N 32 5BU C5 C6 doub N N 33 5BU C5 BR sing N N 34 5BU C6 H6 sing N N 35 A OP3 P sing N N 36 A OP3 HOP3 sing N N 37 A P OP1 doub N N 38 A P OP2 sing N N 39 A P "O5'" sing N N 40 A OP2 HOP2 sing N N 41 A "O5'" "C5'" sing N N 42 A "C5'" "C4'" sing N N 43 A "C5'" "H5'" sing N N 44 A "C5'" "H5''" sing N N 45 A "C4'" "O4'" sing N N 46 A "C4'" "C3'" sing N N 47 A "C4'" "H4'" sing N N 48 A "O4'" "C1'" sing N N 49 A "C3'" "O3'" sing N N 50 A "C3'" "C2'" sing N N 51 A "C3'" "H3'" sing N N 52 A "O3'" "HO3'" sing N N 53 A "C2'" "O2'" sing N N 54 A "C2'" "C1'" sing N N 55 A "C2'" "H2'" sing N N 56 A "O2'" "HO2'" sing N N 57 A "C1'" N9 sing N N 58 A "C1'" "H1'" sing N N 59 A N9 C8 sing Y N 60 A N9 C4 sing Y N 61 A C8 N7 doub Y N 62 A C8 H8 sing N N 63 A N7 C5 sing Y N 64 A C5 C6 sing Y N 65 A C5 C4 doub Y N 66 A C6 N6 sing N N 67 A C6 N1 doub Y N 68 A N6 H61 sing N N 69 A N6 H62 sing N N 70 A N1 C2 sing Y N 71 A C2 N3 doub Y N 72 A C2 H2 sing N N 73 A N3 C4 sing Y N 74 C OP3 P sing N N 75 C OP3 HOP3 sing N N 76 C P OP1 doub N N 77 C P OP2 sing N N 78 C P "O5'" sing N N 79 C OP2 HOP2 sing N N 80 C "O5'" "C5'" sing N N 81 C "C5'" "C4'" sing N N 82 C "C5'" "H5'" sing N N 83 C "C5'" "H5''" sing N N 84 C "C4'" "O4'" sing N N 85 C "C4'" "C3'" sing N N 86 C "C4'" "H4'" sing N N 87 C "O4'" "C1'" sing N N 88 C "C3'" "O3'" sing N N 89 C "C3'" "C2'" sing N N 90 C "C3'" "H3'" sing N N 91 C "O3'" "HO3'" sing N N 92 C "C2'" "O2'" sing N N 93 C "C2'" "C1'" sing N N 94 C "C2'" "H2'" sing N N 95 C "O2'" "HO2'" sing N N 96 C "C1'" N1 sing N N 97 C "C1'" "H1'" sing N N 98 C N1 C2 sing N N 99 C N1 C6 sing N N 100 C C2 O2 doub N N 101 C C2 N3 sing N N 102 C N3 C4 doub N N 103 C C4 N4 sing N N 104 C C4 C5 sing N N 105 C N4 H41 sing N N 106 C N4 H42 sing N N 107 C C5 C6 doub N N 108 C C5 H5 sing N N 109 C C6 H6 sing N N 110 G OP3 P sing N N 111 G OP3 HOP3 sing N N 112 G P OP1 doub N N 113 G P OP2 sing N N 114 G P "O5'" sing N N 115 G OP2 HOP2 sing N N 116 G "O5'" "C5'" sing N N 117 G "C5'" "C4'" sing N N 118 G "C5'" "H5'" sing N N 119 G "C5'" "H5''" sing N N 120 G "C4'" "O4'" sing N N 121 G "C4'" "C3'" sing N N 122 G "C4'" "H4'" sing N N 123 G "O4'" "C1'" sing N N 124 G "C3'" "O3'" sing N N 125 G "C3'" "C2'" sing N N 126 G "C3'" "H3'" sing N N 127 G "O3'" "HO3'" sing N N 128 G "C2'" "O2'" sing N N 129 G "C2'" "C1'" sing N N 130 G "C2'" "H2'" sing N N 131 G "O2'" "HO2'" sing N N 132 G "C1'" N9 sing N N 133 G "C1'" "H1'" sing N N 134 G N9 C8 sing Y N 135 G N9 C4 sing Y N 136 G C8 N7 doub Y N 137 G C8 H8 sing N N 138 G N7 C5 sing Y N 139 G C5 C6 sing N N 140 G C5 C4 doub Y N 141 G C6 O6 doub N N 142 G C6 N1 sing N N 143 G N1 C2 sing N N 144 G N1 H1 sing N N 145 G C2 N2 sing N N 146 G C2 N3 doub N N 147 G N2 H21 sing N N 148 G N2 H22 sing N N 149 G N3 C4 sing N N 150 GET C11 O11 sing N N 151 GET C11 C21 sing N N 152 GET C11 O51 sing N N 153 GET C11 H111 sing N N 154 GET O11 C42 sing N N 155 GET C21 N21 sing N N 156 GET C21 C31 sing N N 157 GET C21 H21 sing N N 158 GET N21 H211 sing N N 159 GET N21 H212 sing N N 160 GET C31 O31 sing N N 161 GET C31 C41 sing N N 162 GET C31 H311 sing N N 163 GET O31 H31 sing N N 164 GET C41 O41 sing N N 165 GET C41 C51 sing N N 166 GET C41 H411 sing N N 167 GET O41 H41 sing N N 168 GET C51 O51 sing N N 169 GET C51 C61 sing N N 170 GET C51 H511 sing N N 171 GET C61 O61 sing N N 172 GET C61 C71 sing N N 173 GET C61 H611 sing N N 174 GET O61 H61 sing N N 175 GET C71 H711 sing N N 176 GET C71 H712 sing N N 177 GET C71 H713 sing N N 178 GET C12 N12 sing N N 179 GET C12 C22 sing N N 180 GET C12 C62 sing N N 181 GET C12 H12 sing N N 182 GET N12 H121 sing N N 183 GET N12 H122 sing N N 184 GET C22 C32 sing N N 185 GET C22 H221 sing N N 186 GET C22 H222 sing N N 187 GET C32 N32 sing N N 188 GET C32 C42 sing N N 189 GET C32 H32 sing N N 190 GET N32 H321 sing N N 191 GET N32 H322 sing N N 192 GET C42 C52 sing N N 193 GET C42 H421 sing N N 194 GET C52 O52 sing N N 195 GET C52 C62 sing N N 196 GET C52 H521 sing N N 197 GET O52 H52 sing N N 198 GET C62 O62 sing N N 199 GET C62 H621 sing N N 200 GET O62 C13 sing N N 201 GET C13 C23 sing N N 202 GET C13 O53 sing N N 203 GET C13 H131 sing N N 204 GET C23 O23 sing N N 205 GET C23 C33 sing N N 206 GET C23 H231 sing N N 207 GET O23 H23 sing N N 208 GET C33 N33 sing N N 209 GET C33 C43 sing N N 210 GET C33 H331 sing N N 211 GET N33 C93 sing N N 212 GET N33 H33 sing N N 213 GET C93 H931 sing N N 214 GET C93 H932 sing N N 215 GET C93 H933 sing N N 216 GET C43 O43 sing N N 217 GET C43 C83 sing N N 218 GET C43 C53 sing N N 219 GET O43 H43 sing N N 220 GET C83 H831 sing N N 221 GET C83 H832 sing N N 222 GET C83 H833 sing N N 223 GET C53 O53 sing N N 224 GET C53 H531 sing N N 225 GET C53 H532 sing N N 226 HOH O H1 sing N N 227 HOH O H2 sing N N 228 U OP3 P sing N N 229 U OP3 HOP3 sing N N 230 U P OP1 doub N N 231 U P OP2 sing N N 232 U P "O5'" sing N N 233 U OP2 HOP2 sing N N 234 U "O5'" "C5'" sing N N 235 U "C5'" "C4'" sing N N 236 U "C5'" "H5'" sing N N 237 U "C5'" "H5''" sing N N 238 U "C4'" "O4'" sing N N 239 U "C4'" "C3'" sing N N 240 U "C4'" "H4'" sing N N 241 U "O4'" "C1'" sing N N 242 U "C3'" "O3'" sing N N 243 U "C3'" "C2'" sing N N 244 U "C3'" "H3'" sing N N 245 U "O3'" "HO3'" sing N N 246 U "C2'" "O2'" sing N N 247 U "C2'" "C1'" sing N N 248 U "C2'" "H2'" sing N N 249 U "O2'" "HO2'" sing N N 250 U "C1'" N1 sing N N 251 U "C1'" "H1'" sing N N 252 U N1 C2 sing N N 253 U N1 C6 sing N N 254 U C2 O2 doub N N 255 U C2 N3 sing N N 256 U N3 C4 sing N N 257 U N3 H3 sing N N 258 U C4 O4 doub N N 259 U C4 C5 sing N N 260 U C5 C6 doub N N 261 U C5 H5 sing N N 262 U C6 H6 sing N N 263 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 3TD1 'a-form double helix' 3TD1 'mismatched base pair' 3TD1 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 3 1_555 B C 23 1_555 -0.438 -0.088 0.201 2.418 -4.749 1.685 1 A_G3:C46_B A 3 ? B 46 ? 19 1 1 A C 4 1_555 B G 22 1_555 0.340 -0.238 0.230 2.449 -7.022 -0.489 2 A_C4:G45_B A 4 ? B 45 ? 19 1 1 A G 5 1_555 B C 21 1_555 -0.168 -0.281 -0.353 -3.990 -5.385 0.490 3 A_G5:C44_B A 5 ? B 44 ? 19 1 1 A U 6 1_555 B U 20 1_555 -2.029 -1.427 -0.490 2.547 -5.397 -11.424 4 A_U6:U43_B A 6 ? B 43 ? ? ? 1 A C 7 1_555 B G 19 1_555 0.118 -0.098 0.063 -7.096 2.512 -2.317 5 A_C7:G42_B A 7 ? B 42 ? 19 1 1 A C 9 1_555 B G 16 1_555 0.300 -0.172 -0.071 4.236 -10.006 2.481 6 A_C9:G39_B A 9 ? B 39 ? 19 1 1 A G 10 1_555 B C 15 1_555 -0.510 -0.248 0.141 -1.337 -11.198 3.683 7 A_G10:C38_B A 10 ? B 38 ? 19 1 1 A 5BU 11 1_555 B A 14 1_555 -0.205 -0.260 0.221 -5.604 -16.806 -0.018 8 A_5BU11:A37_B A 11 ? B 37 ? 20 1 1 A C 12 1_555 B G 13 1_555 0.136 -0.198 0.173 -3.499 -10.223 1.932 9 A_C12:G36_B A 12 ? B 36 ? 19 1 1 A G 13 1_555 B C 12 1_555 -0.181 -0.122 0.366 -1.623 -11.518 1.484 10 A_G13:C35_B A 13 ? B 35 ? 19 1 1 A A 14 1_555 B 5BU 11 1_555 0.197 -0.111 0.133 1.019 -13.735 -3.157 11 A_A14:5BU34_B A 14 ? B 34 ? 20 1 1 A C 15 1_555 B G 10 1_555 0.350 -0.123 0.113 2.387 -9.568 1.754 12 A_C15:G33_B A 15 ? B 33 ? 19 1 1 A G 16 1_555 B C 9 1_555 -0.078 -0.160 -0.018 -3.672 -14.244 0.235 13 A_G16:C32_B A 16 ? B 32 ? 19 1 1 A G 19 1_555 B C 7 1_555 -0.317 -0.152 -0.247 -2.076 -4.395 1.477 14 A_G19:C30_B A 19 ? B 30 ? 19 1 1 A U 20 1_555 B U 6 1_555 2.034 -1.536 -0.351 -12.805 -10.258 -5.170 15 A_U20:U29_B A 20 ? B 29 ? ? ? 1 A C 21 1_555 B G 5 1_555 0.315 -0.265 -0.454 5.296 -10.321 3.669 16 A_C21:G28_B A 21 ? B 28 ? 19 1 1 A G 22 1_555 B C 4 1_555 -0.244 -0.214 -0.154 -9.576 -8.447 -1.990 17 A_G22:C27_B A 22 ? B 27 ? 19 1 1 A C 23 1_555 B G 3 1_555 0.709 -0.325 0.122 0.359 0.800 -1.703 18 A_C23:G26_B A 23 ? B 26 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 3 1_555 B C 23 1_555 A C 4 1_555 B G 22 1_555 -0.625 -1.767 3.280 -1.752 0.617 35.787 -2.961 0.763 3.276 1.004 2.849 35.834 1 AA_G3C4:G45C46_BB A 3 ? B 46 ? A 4 ? B 45 ? 1 A C 4 1_555 B G 22 1_555 A G 5 1_555 B C 21 1_555 -0.019 -1.586 3.327 2.552 9.401 29.718 -4.631 0.494 2.701 17.739 -4.816 31.240 2 AA_C4G5:C44G45_BB A 4 ? B 45 ? A 5 ? B 44 ? 1 A G 5 1_555 B C 21 1_555 A U 6 1_555 B U 20 1_555 -0.516 -1.921 3.076 -1.022 1.542 26.568 -4.546 0.872 2.979 3.350 2.220 26.631 3 AA_G5U6:U43C44_BB A 5 ? B 44 ? A 6 ? B 43 ? 1 A U 6 1_555 B U 20 1_555 A C 7 1_555 B G 19 1_555 1.105 -2.510 3.662 -2.976 1.794 40.977 -3.787 -1.926 3.468 2.557 4.242 41.117 4 AA_U6C7:G42U43_BB A 6 ? B 43 ? A 7 ? B 42 ? 1 A C 9 1_555 B G 16 1_555 A G 10 1_555 B C 15 1_555 0.075 -2.002 3.188 -2.319 11.799 27.159 -6.029 -0.564 2.138 23.706 4.660 29.656 5 AA_C9G10:C38G39_BB A 9 ? B 39 ? A 10 ? B 38 ? 1 A G 10 1_555 B C 15 1_555 A 5BU 11 1_555 B A 14 1_555 -0.900 -1.628 3.318 -1.972 2.333 34.117 -3.134 1.216 3.248 3.967 3.352 34.249 6 AA_G105BU11:A37C38_BB A 10 ? B 38 ? A 11 ? B 37 ? 1 A 5BU 11 1_555 B A 14 1_555 A C 12 1_555 B G 13 1_555 0.252 -1.265 3.143 1.056 3.267 33.839 -2.655 -0.271 3.017 5.595 -1.808 34.007 7 AA_5BU11C12:G36A37_BB A 11 ? B 37 ? A 12 ? B 36 ? 1 A C 12 1_555 B G 13 1_555 A G 13 1_555 B C 12 1_555 0.337 -1.747 3.031 -0.593 10.132 28.393 -5.094 -0.749 2.279 19.871 1.162 30.118 8 AA_C12G13:C35G36_BB A 12 ? B 36 ? A 13 ? B 35 ? 1 A G 13 1_555 B C 12 1_555 A A 14 1_555 B 5BU 11 1_555 -0.843 -1.439 3.206 1.290 5.638 33.270 -3.336 1.648 2.897 9.756 -2.231 33.755 9 AA_G13A14:5BU34C35_BB A 13 ? B 35 ? A 14 ? B 34 ? 1 A A 14 1_555 B 5BU 11 1_555 A C 15 1_555 B G 10 1_555 0.717 -1.355 3.181 1.179 5.378 33.381 -3.149 -1.053 2.956 9.283 -2.035 33.819 10 AA_A14C15:G335BU34_BB A 14 ? B 34 ? A 15 ? B 33 ? 1 A C 15 1_555 B G 10 1_555 A G 16 1_555 B C 9 1_555 0.415 -1.777 3.316 4.388 11.826 28.207 -5.457 0.006 2.428 22.874 -8.488 30.847 11 AA_C15G16:C32G33_BB A 15 ? B 33 ? A 16 ? B 32 ? 1 A G 19 1_555 B C 7 1_555 A U 20 1_555 B U 6 1_555 -1.016 -2.359 3.725 1.467 4.637 41.635 -3.828 1.588 3.419 6.497 -2.055 41.906 12 AA_G19U20:U29C30_BB A 19 ? B 30 ? A 20 ? B 29 ? 1 A U 20 1_555 B U 6 1_555 A C 21 1_555 B G 5 1_555 0.469 -1.626 2.651 2.371 0.014 24.755 -3.780 -0.507 2.682 0.034 -5.514 24.866 13 AA_U20C21:G28U29_BB A 20 ? B 29 ? A 21 ? B 28 ? 1 A C 21 1_555 B G 5 1_555 A G 22 1_555 B C 4 1_555 -0.821 -1.567 3.698 -0.462 9.231 30.813 -4.592 1.396 3.122 16.901 0.846 32.137 14 AA_C21G22:C27G28_BB A 21 ? B 28 ? A 22 ? B 27 ? 1 A G 22 1_555 B C 4 1_555 A C 23 1_555 B G 3 1_555 0.759 -1.129 3.148 -0.741 2.454 35.387 -2.193 -1.348 3.049 4.030 1.218 35.477 15 AA_G22C23:G26C27_BB A 22 ? B 27 ? A 23 ? B 26 ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 GENETICIN GET 3 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 1MWL _pdbx_initial_refinement_model.details 'PDB entry 1MWL' #