data_480D # _entry.id 480D # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.379 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 480D pdb_0000480d 10.2210/pdb480d/pdb NDB UR0006 ? ? RCSB RCSB009367 ? ? WWPDB D_1000009367 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 430D _pdbx_database_related.details 'THE STRUCTURE OF THE RELATED RAT SEQUENCE DETERMINED BY X-RAY CRYSTALLOGRAPHY' _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 480D _pdbx_database_status.recvd_initial_deposition_date 1999-07-20 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.SG_entry . _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Correll, C.C.' 1 'Wool, I.G.' 2 'Munishkin, A.' 3 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'The two faces of the Escherichia coli 23 S rRNA sarcin/ricin domain: the structure at 1.11 A resolution.' J.Mol.Biol. 292 275 287 1999 JMOBAK UK 0022-2836 0070 ? 10493875 10.1006/jmbi.1999.3072 1 'Crystal structure of the ribosomal RNA domain essential for binding elongation factors' Proc.Natl.Acad.Sci.USA 95 13436 13441 1998 PNASA6 US 0027-8424 0040 ? ? 10.1073/pnas.95.23.13436 2 'Comparison of the crystal and solution structures of two RNA oligonucleotides' Biophys.J. 76 65 75 1999 BIOJAU US 0006-3495 0030 ? ? ? 3 'The sarcin/ricin loop, a modular RNA' J.Mol.Biol. 247 81 98 1995 JMOBAK UK 0022-2836 0070 ? ? 10.1006/jmbi.1994.0124 4 'The conformation of the sarcin/ricin loop from 28 S ribosomal RNA' Proc.Natl.Acad.Sci.USA 90 9581 9585 1993 PNASA6 US 0027-8424 0040 ? ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Correll, C.C.' 1 ? primary 'Wool, I.G.' 2 ? primary 'Munishkin, A.' 3 ? 1 'Correll, C.C.' 4 ? 1 'Munishkin, A.' 5 ? 1 'Chan, Y.-L.' 6 ? 1 'Ren, Z.' 7 ? 1 'Wool, I.G.' 8 ? 2 'Rife, J.P.' 9 ? 2 'Stallings, S.G.' 10 ? 2 'Correll, C.C.' 11 ? 2 'Dallas, A.' 12 ? 2 'Steitz, T.A.' 13 ? 2 'Moore, P.B.' 14 ? 3 'Szewczak, A.A.' 15 ? 3 'Moore, P.B.' 16 ? 4 'Szewczak, A.A.' 17 ? 4 'Moore, P.B.' 18 ? # _cell.entry_id 480D _cell.length_a 29.95 _cell.length_b 29.95 _cell.length_c 76.42 _cell.angle_alpha 90 _cell.angle_beta 90 _cell.angle_gamma 90 _cell.Z_PDB 4 _cell.pdbx_unique_axis ? # _symmetry.entry_id 480D _symmetry.space_group_name_H-M 'P 43' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting tetragonal _symmetry.Int_Tables_number 78 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'SARCIN/RICIN DOMAIN FROM 23 S RRNA' 8744.255 1 ? ? 'SARCIN/RICIN DOMAIN' ? 2 water nat water 18.015 84 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UGCUCCUAGUACGAGAGGACCGGAGUG _entity_poly.pdbx_seq_one_letter_code_can UGCUCCUAGUACGAGAGGACCGGAGUG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 G n 1 3 C n 1 4 U n 1 5 C n 1 6 C n 1 7 U n 1 8 A n 1 9 G n 1 10 U n 1 11 A n 1 12 C n 1 13 G n 1 14 A n 1 15 G n 1 16 A n 1 17 G n 1 18 G n 1 19 A n 1 20 C n 1 21 C n 1 22 G n 1 23 G n 1 24 A n 1 25 G n 1 26 U n 1 27 G n # _struct_ref.id 1 _struct_ref.entity_id 1 _struct_ref.db_name PDB _struct_ref.db_code 480D _struct_ref.pdbx_db_accession 480D _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 480D _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 480D _struct_ref_seq.db_align_beg 2647 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 2673 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 2647 _struct_ref_seq.pdbx_auth_seq_align_end 2673 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.entry_id 480D _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.04 _exptl_crystal.density_percent_sol 50 _exptl_crystal.description ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 292 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_details ;3.0 - 3.2 M (NH4)2SO4, BUFFER X (50 MM POTASIUM MOPS, PH 7.0; 10 MM MGCL2; AND 10 MM MNCL2), AND ~2.5 MG/ML RNA, VAPOR DIFFUSION, HANGING DROP, temperature 292K ; _exptl_crystal_grow.pdbx_pH_range ? # loop_ _exptl_crystal_grow_comp.crystal_id _exptl_crystal_grow_comp.id _exptl_crystal_grow_comp.sol_id _exptl_crystal_grow_comp.name _exptl_crystal_grow_comp.volume _exptl_crystal_grow_comp.conc _exptl_crystal_grow_comp.details 1 1 1 '(NH4)2SO4' ? ? ? 1 2 1 'POTASIUM MOPS' ? ? ? 1 3 1 MGCL2 ? ? ? 1 4 1 MNCL2 ? ? ? 1 5 2 '(NH4)2SO4' ? ? ? 1 6 2 'POTASIUM MOPS' ? ? ? 1 7 2 MGCL2 ? ? ? 1 8 2 MNCL2 ? ? ? # _diffrn.id 1 _diffrn.ambient_temp 295 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector 'IMAGE PLATE' _diffrn_detector.type 'RIGAKU RAXIS IIC' _diffrn_detector.pdbx_collection_date 1998-05-12 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator 'MSC MIRROR BOX' _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.5418 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source 'ROTATING ANODE' _diffrn_source.type 'RIGAKU RU200' _diffrn_source.pdbx_synchrotron_site ? _diffrn_source.pdbx_synchrotron_beamline ? _diffrn_source.pdbx_wavelength 1.5418 _diffrn_source.pdbx_wavelength_list ? # _reflns.entry_id 480D _reflns.observed_criterion_sigma_I -3.0 _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 20.0 _reflns.d_resolution_high 1.5 _reflns.number_obs ? _reflns.number_all 10744 _reflns.percent_possible_obs 99.7 _reflns.pdbx_Rmerge_I_obs 0.052 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI 35.5 _reflns.B_iso_Wilson_estimate 13.8 _reflns.pdbx_redundancy 5.6 _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 # _reflns_shell.d_res_high 1.50 _reflns_shell.d_res_low 1.53 _reflns_shell.percent_possible_all 98.5 _reflns_shell.Rmerge_I_obs 0.459 _reflns_shell.pdbx_Rsym_value 0.459 _reflns_shell.meanI_over_sigI_obs 2.5 _reflns_shell.pdbx_redundancy 2.50 _reflns_shell.pdbx_diffrn_id ? _reflns_shell.pdbx_ordinal 1 # _refine.entry_id 480D _refine.ls_number_reflns_obs 10535 _refine.ls_number_reflns_all 10535 _refine.pdbx_ls_sigma_I 0.0 _refine.pdbx_ls_sigma_F 0.0 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 20. _refine.ls_d_res_high 1.5 _refine.ls_percent_reflns_obs 96.8 _refine.ls_R_factor_obs 0.180 _refine.ls_R_factor_all 0.180 _refine.ls_R_factor_R_work 0.1798 _refine.ls_R_factor_R_free 0.206 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 9.9 _refine.ls_number_reflns_R_free 1075 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.B_iso_mean 17.9 _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_ls_cross_valid_method 'R FREE' _refine.details ;AFTER BULK SOLVENT CORRECTION AND ANISOTROPIC SCALING OF FOBS, CYCLES OF POWELL MINIMIZATION FOLLOWED BY B-FACTOR REFINEMENT WERE DONE. ; _refine.pdbx_starting_model 'THE RELATED RAT SARCIN/RICIN STRUCTURE (430D)' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values 'G. PARKINSON, J. VOJTECHOVSKY, L. CLOWNEY, A.T. BRUNGER, H.M. BERMAN: ACTA CRYST.D, 52, 57 (1996)' _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details '10% OF DATA THAT WAS RANDOMLY SELECTED. OVERALL R FOR ALL DATA WAS NEVER CALCULATED' _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.overall_SU_B ? _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 579 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.number_atoms_solvent 84 _refine_hist.number_atoms_total 663 _refine_hist.d_res_high 1.5 _refine_hist.d_res_low 20. # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function x_bond_d 0.004 ? ? ? 'X-RAY DIFFRACTION' ? x_bond_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_bond_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg 0.832 ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_angle_deg_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d 30.1 ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_dihedral_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d 1.1 ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? x_improper_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? x_mcbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_mcangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_scbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? x_scangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_total_number_of_bins_used 20 _refine_ls_shell.d_res_high 1.50 _refine_ls_shell.d_res_low 1.53 _refine_ls_shell.number_reflns_R_work 420 _refine_ls_shell.R_factor_R_work 0.336 _refine_ls_shell.percent_reflns_obs 88 _refine_ls_shell.R_factor_R_free 0.330 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.percent_reflns_R_free 7.5 _refine_ls_shell.number_reflns_R_free 39 _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? # _struct.entry_id 480D _struct.title 'CRYSTAL STRUCTURE OF THE SARCIN/RICIN DOMAIN FROM E. COLI 23 S RRNA' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 480D _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'SARCIN/RICIN LOOP OR DOMAIN, RNA RECOGNITION, RIBOSOMES, ELONGATION FACTORS, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A U 26 O2 ? ? A G 2648 A U 2672 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 26 N3 ? ? A G 2648 A U 2672 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 24 N1 ? ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 24 N6 ? ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 O2 ? ? ? 1_555 A C 21 N4 ? ? A U 2653 A C 2667 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog15 hydrog ? ? A G 9 N2 ? ? ? 1_555 A U 10 O4 ? ? A G 2655 A U 2656 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 19 N7 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 19 N6 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog18 hydrog ? ? A A 11 N6 ? ? ? 1_555 A G 18 N3 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A A 11 N7 ? ? ? 1_555 A G 18 N2 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog20 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? A G 2659 A A 2662 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _database_PDB_matrix.entry_id 480D _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 480D _atom_sites.fract_transf_matrix[1][1] 0.033389 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.033389 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.013086 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 2647 2647 U U A . n A 1 2 G 2 2648 2648 G G A . n A 1 3 C 3 2649 2649 C C A . n A 1 4 U 4 2650 2650 U U A . n A 1 5 C 5 2651 2651 C C A . n A 1 6 C 6 2652 2652 C C A . n A 1 7 U 7 2653 2653 U U A . n A 1 8 A 8 2654 2654 A A A . n A 1 9 G 9 2655 2655 G G A . n A 1 10 U 10 2656 2656 U U A . n A 1 11 A 11 2657 2657 A A A . n A 1 12 C 12 2658 2658 C C A . n A 1 13 G 13 2659 2659 G G A . n A 1 14 A 14 2660 2660 A A A . n A 1 15 G 15 2661 2661 G G A . n A 1 16 A 16 2662 2662 A A A . n A 1 17 G 17 2663 2663 G G A . n A 1 18 G 18 2664 2664 G G A . n A 1 19 A 19 2665 2665 A A A . n A 1 20 C 20 2666 2666 C C A . n A 1 21 C 21 2667 2667 C C A . n A 1 22 G 22 2668 2668 G G A . n A 1 23 G 23 2669 2669 G G A . n A 1 24 A 24 2670 2670 A A A . n A 1 25 G 25 2671 2671 G G A . n A 1 26 U 26 2672 2672 U U A . n A 1 27 G 27 2673 2673 G G A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 HOH 1 1001 1001 HOH HOH A . B 2 HOH 2 1002 1002 HOH HOH A . B 2 HOH 3 1003 1003 HOH HOH A . B 2 HOH 4 1004 1004 HOH HOH A . B 2 HOH 5 1005 1005 HOH HOH A . B 2 HOH 6 1006 1006 HOH HOH A . B 2 HOH 7 1007 1007 HOH HOH A . B 2 HOH 8 1008 1008 HOH HOH A . B 2 HOH 9 1009 1009 HOH HOH A . B 2 HOH 10 1010 1010 HOH HOH A . B 2 HOH 11 1011 1011 HOH HOH A . B 2 HOH 12 1012 1012 HOH HOH A . B 2 HOH 13 1013 1013 HOH HOH A . B 2 HOH 14 1014 1014 HOH HOH A . B 2 HOH 15 1015 1015 HOH HOH A . B 2 HOH 16 1016 1016 HOH HOH A . B 2 HOH 17 1017 1017 HOH HOH A . B 2 HOH 18 1018 1018 HOH HOH A . B 2 HOH 19 1019 1019 HOH HOH A . B 2 HOH 20 1020 1020 HOH HOH A . B 2 HOH 21 1021 1021 HOH HOH A . B 2 HOH 22 1022 1022 HOH HOH A . B 2 HOH 23 1023 1023 HOH HOH A . B 2 HOH 24 1024 1024 HOH HOH A . B 2 HOH 25 1025 1025 HOH HOH A . B 2 HOH 26 1026 1026 HOH HOH A . B 2 HOH 27 1027 1027 HOH HOH A . B 2 HOH 28 1028 1028 HOH HOH A . B 2 HOH 29 1029 1029 HOH HOH A . B 2 HOH 30 1030 1030 HOH HOH A . B 2 HOH 31 1031 1031 HOH HOH A . B 2 HOH 32 1032 1032 HOH HOH A . B 2 HOH 33 1033 1033 HOH HOH A . B 2 HOH 34 1034 1034 HOH HOH A . B 2 HOH 35 1035 1035 HOH HOH A . B 2 HOH 36 1036 1036 HOH HOH A . B 2 HOH 37 1037 1037 HOH HOH A . B 2 HOH 38 1038 1038 HOH HOH A . B 2 HOH 39 1039 1039 HOH HOH A . B 2 HOH 40 1040 1040 HOH HOH A . B 2 HOH 41 1041 1041 HOH HOH A . B 2 HOH 42 1042 1042 HOH HOH A . B 2 HOH 43 1043 1043 HOH HOH A . B 2 HOH 44 1044 1044 HOH HOH A . B 2 HOH 45 1045 1045 HOH HOH A . B 2 HOH 46 1046 1046 HOH HOH A . B 2 HOH 47 1047 1047 HOH HOH A . B 2 HOH 48 1048 1048 HOH HOH A . B 2 HOH 49 1049 1049 HOH HOH A . B 2 HOH 50 1050 1050 HOH HOH A . B 2 HOH 51 1051 1051 HOH HOH A . B 2 HOH 52 1052 1052 HOH HOH A . B 2 HOH 53 1053 1053 HOH HOH A . B 2 HOH 54 1054 1054 HOH HOH A . B 2 HOH 55 1055 1055 HOH HOH A . B 2 HOH 56 1056 1056 HOH HOH A . B 2 HOH 57 1057 1057 HOH HOH A . B 2 HOH 58 1058 1058 HOH HOH A . B 2 HOH 59 1059 1059 HOH HOH A . B 2 HOH 60 1060 1060 HOH HOH A . B 2 HOH 61 1061 1061 HOH HOH A . B 2 HOH 62 1062 1062 HOH HOH A . B 2 HOH 63 1063 1063 HOH HOH A . B 2 HOH 64 1064 1064 HOH HOH A . B 2 HOH 65 1065 1065 HOH HOH A . B 2 HOH 66 1066 1066 HOH HOH A . B 2 HOH 67 1067 1067 HOH HOH A . B 2 HOH 68 1068 1068 HOH HOH A . B 2 HOH 69 1069 1069 HOH HOH A . B 2 HOH 70 1070 1070 HOH HOH A . B 2 HOH 71 1071 1071 HOH HOH A . B 2 HOH 72 1072 1072 HOH HOH A . B 2 HOH 73 1073 1073 HOH HOH A . B 2 HOH 74 1074 1074 HOH HOH A . B 2 HOH 75 1075 1075 HOH HOH A . B 2 HOH 76 1076 1076 HOH HOH A . B 2 HOH 77 1077 1077 HOH HOH A . B 2 HOH 78 1078 1078 HOH HOH A . B 2 HOH 79 1079 1079 HOH HOH A . B 2 HOH 80 1080 1080 HOH HOH A . B 2 HOH 81 1081 1081 HOH HOH A . B 2 HOH 82 1082 1082 HOH HOH A . B 2 HOH 83 1083 1083 HOH HOH A . B 2 HOH 84 1084 1084 HOH HOH A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 1999-10-08 2 'Structure model' 1 1 2008-04-27 3 'Structure model' 1 2 2011-07-13 4 'Structure model' 1 3 2023-09-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Version format compliance' 2 3 'Structure model' 'Version format compliance' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal X-PLOR 'model building' . ? 1 X-PLOR refinement 3.851 ? 2 DENZO 'data reduction' . ? 3 SCALEPACK 'data scaling' . ? 4 X-PLOR phasing . ? 5 # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 OP2 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 C _pdbx_validate_close_contact.auth_seq_id_1 2658 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 O _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 HOH _pdbx_validate_close_contact.auth_seq_id_2 1032 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 2.14 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 U OP3 O N N 114 U P P N N 115 U OP1 O N N 116 U OP2 O N N 117 U "O5'" O N N 118 U "C5'" C N N 119 U "C4'" C N R 120 U "O4'" O N N 121 U "C3'" C N S 122 U "O3'" O N N 123 U "C2'" C N R 124 U "O2'" O N N 125 U "C1'" C N R 126 U N1 N N N 127 U C2 C N N 128 U O2 O N N 129 U N3 N N N 130 U C4 C N N 131 U O4 O N N 132 U C5 C N N 133 U C6 C N N 134 U HOP3 H N N 135 U HOP2 H N N 136 U "H5'" H N N 137 U "H5''" H N N 138 U "H4'" H N N 139 U "H3'" H N N 140 U "HO3'" H N N 141 U "H2'" H N N 142 U "HO2'" H N N 143 U "H1'" H N N 144 U H3 H N N 145 U H5 H N N 146 U H6 H N N 147 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 480D 'double helix' 480D 'a-form double helix' 480D 'mismatched base pair' 480D 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A U 26 1_555 -2.423 -0.636 0.202 1.037 -12.919 0.113 1 A_G2648:U2672_A A 2648 ? A 2672 ? 28 ? 1 A C 3 1_555 A G 25 1_555 -0.017 -0.231 0.211 1.879 -12.485 -2.247 2 A_C2649:G2671_A A 2649 ? A 2671 ? 19 1 1 A U 4 1_555 A A 24 1_555 -0.121 -0.047 0.048 7.796 -13.231 -0.826 3 A_U2650:A2670_A A 2650 ? A 2670 ? 20 1 1 A C 5 1_555 A G 23 1_555 0.236 -0.021 0.118 4.618 -15.003 3.793 4 A_C2651:G2669_A A 2651 ? A 2669 ? 19 1 1 A C 6 1_555 A G 22 1_555 0.248 -0.117 0.009 -3.151 -12.015 -1.804 5 A_C2652:G2668_A A 2652 ? A 2668 ? 19 1 1 A U 7 1_555 A C 21 1_555 5.814 -2.335 -0.238 0.454 -11.523 -9.187 6 A_U2653:C2667_A A 2653 ? A 2667 ? ? ? 1 A U 10 1_555 A A 19 1_555 4.105 -1.783 -0.829 5.047 -17.937 -104.963 7 A_U2656:A2665_A A 2656 ? A 2665 ? 24 4 1 A A 11 1_555 A G 18 1_555 -6.976 -4.328 -0.243 -2.024 4.181 -3.121 8 A_A2657:G2664_A A 2657 ? A 2664 ? 11 10 1 A C 12 1_555 A G 17 1_555 0.097 -0.139 -0.213 8.094 0.489 2.328 9 A_C2658:G2663_A A 2658 ? A 2663 ? 19 1 1 A G 13 1_555 A A 16 1_555 7.380 -5.476 0.794 19.403 -4.471 -18.865 10 A_G2659:A2662_A A 2659 ? A 2662 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A U 26 1_555 A C 3 1_555 A G 25 1_555 -0.560 -1.255 3.217 -1.289 4.400 44.884 -2.018 0.618 3.101 5.745 1.683 45.105 1 AA_G2648C2649:G2671U2672_AA A 2648 ? A 2672 ? A 2649 ? A 2671 ? 1 A C 3 1_555 A G 25 1_555 A U 4 1_555 A A 24 1_555 0.359 -2.167 3.059 0.467 7.128 24.282 -6.696 -0.705 2.343 16.495 -1.080 25.295 2 AA_C2649U2650:A2670G2671_AA A 2649 ? A 2671 ? A 2650 ? A 2670 ? 1 A U 4 1_555 A A 24 1_555 A C 5 1_555 A G 23 1_555 0.446 -1.608 3.298 -1.585 3.467 35.894 -3.077 -0.940 3.112 5.607 2.562 36.089 3 AA_U2650C2651:G2669A2670_AA A 2650 ? A 2670 ? A 2651 ? A 2669 ? 1 A C 5 1_555 A G 23 1_555 A C 6 1_555 A G 22 1_555 -0.749 -1.910 3.374 0.297 6.979 31.591 -4.626 1.396 2.890 12.626 -0.538 32.335 4 AA_C2651C2652:G2668G2669_AA A 2651 ? A 2669 ? A 2652 ? A 2668 ? 1 A C 6 1_555 A G 22 1_555 A U 7 1_555 A C 21 1_555 -0.368 -0.939 3.376 7.308 7.709 54.162 -1.474 0.834 3.156 8.376 -7.940 55.116 5 AA_C2652U2653:C2667G2668_AA A 2652 ? A 2668 ? A 2653 ? A 2667 ? 1 A U 7 1_555 A C 21 1_555 A U 10 1_555 A A 19 1_555 0.398 -1.038 6.474 6.716 -3.756 32.632 -0.558 1.532 6.501 -6.572 -11.750 33.503 6 AA_U2653U2656:A2665C2667_AA A 2653 ? A 2667 ? A 2656 ? A 2665 ? 1 A U 10 1_555 A A 19 1_555 A A 11 1_555 A G 18 1_555 5.207 -1.434 3.568 -1.867 -0.063 -11.233 7.337 22.954 4.363 0.318 -9.452 -11.387 7 AA_U2656A2657:G2664A2665_AA A 2656 ? A 2665 ? A 2657 ? A 2664 ? 1 A A 11 1_555 A G 18 1_555 A C 12 1_555 A G 17 1_555 0.079 -1.117 3.220 -2.018 2.634 59.194 -1.260 -0.180 3.168 2.664 2.041 59.279 8 AA_A2657C2658:G2663G2664_AA A 2657 ? A 2664 ? A 2658 ? A 2663 ? 1 A C 12 1_555 A G 17 1_555 A G 13 1_555 A A 16 1_555 -2.756 -1.367 3.017 -6.011 8.268 52.360 -2.017 2.715 3.061 9.270 6.739 53.279 9 AA_C2658G2659:A2662G2663_AA A 2658 ? A 2663 ? A 2659 ? A 2662 ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name water _pdbx_entity_nonpoly.comp_id HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 430D _pdbx_initial_refinement_model.details 'THE RELATED RAT SARCIN/RICIN STRUCTURE (430D)' #