data_4K32 # _entry.id 4K32 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 4K32 pdb_00004k32 10.2210/pdb4k32/pdb NDB NA2344 ? ? RCSB RCSB078828 ? ? WWPDB D_1000078828 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2013-07-31 2 'Structure model' 1 1 2013-09-04 3 'Structure model' 1 2 2024-02-28 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' chem_comp_atom 2 3 'Structure model' chem_comp_bond 3 3 'Structure model' database_2 4 3 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_struct_site.pdbx_auth_asym_id' 4 3 'Structure model' '_struct_site.pdbx_auth_comp_id' 5 3 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 4K32 _pdbx_database_status.recvd_initial_deposition_date 2013-04-10 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # _pdbx_database_related.db_name PDB _pdbx_database_related.db_id 4K31 _pdbx_database_related.details . _pdbx_database_related.content_type unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Shalev, M.' 1 'Kondo, J.' 2 'Adir, N.' 3 'Baasov, T.' 4 # _citation.id primary _citation.title 'Identification of the molecular attributes required for aminoglycoside activity against Leishmania.' _citation.journal_abbrev Proc.Natl.Acad.Sci.USA _citation.journal_volume 110 _citation.page_first 13333 _citation.page_last 13338 _citation.year 2013 _citation.journal_id_ASTM PNASA6 _citation.country US _citation.journal_id_ISSN 0027-8424 _citation.journal_id_CSD 0040 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 23898171 _citation.pdbx_database_id_DOI 10.1073/pnas.1307365110 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Shalev, M.' 1 ? primary 'Kondo, J.' 2 ? primary 'Kopelyanskiy, D.' 3 ? primary 'Jaffe, C.L.' 4 ? primary 'Adir, N.' 5 ? primary 'Baasov, T.' 6 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*UP*UP*CP*CP*GP*GP*AP*AP*AP*AP*GP*UP*CP*GP*C)-3') ; 7356.393 2 ? ? ? ? 2 non-polymer syn GENETICIN 496.552 2 ? ? ? ? 3 water nat water 18.015 11 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UUGCGUCGUUCCGGAAAAGUCGC _entity_poly.pdbx_seq_one_letter_code_can UUGCGUCGUUCCGGAAAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 GENETICIN GET 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 U n 1 3 G n 1 4 C n 1 5 G n 1 6 U n 1 7 C n 1 8 G n 1 9 U n 1 10 U n 1 11 C n 1 12 C n 1 13 G n 1 14 G n 1 15 A n 1 16 A n 1 17 A n 1 18 A n 1 19 G n 1 20 U n 1 21 C n 1 22 G n 1 23 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific Leishmania _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 38568 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GET non-polymer . GENETICIN G418 'C20 H40 N4 O10' 496.552 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 1 ? ? ? A . n A 1 2 U 2 2 ? ? ? A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 G 8 8 8 G G A . n A 1 9 U 9 9 9 U U A . n A 1 10 U 10 10 10 U U A . n A 1 11 C 11 11 11 C C A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n B 1 1 U 1 24 ? ? ? B . n B 1 2 U 2 25 ? ? ? B . n B 1 3 G 3 26 26 G G B . n B 1 4 C 4 27 27 C C B . n B 1 5 G 5 28 28 G G B . n B 1 6 U 6 29 29 U U B . n B 1 7 C 7 30 30 C C B . n B 1 8 G 8 31 31 G G B . n B 1 9 U 9 32 32 U U B . n B 1 10 U 10 33 33 U U B . n B 1 11 C 11 34 34 C C B . n B 1 12 C 12 35 35 C C B . n B 1 13 G 13 36 36 G G B . n B 1 14 G 14 37 37 G G B . n B 1 15 A 15 38 38 A A B . n B 1 16 A 16 39 39 A A B . n B 1 17 A 17 40 40 A A B . n B 1 18 A 18 41 41 A A B . n B 1 19 G 19 42 42 G G B . n B 1 20 U 20 43 43 U U B . n B 1 21 C 21 44 44 C C B . n B 1 22 G 22 45 45 G G B . n B 1 23 C 23 46 46 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 GET 1 101 51 GET GET A . D 2 GET 1 101 50 GET GET B . E 3 HOH 1 201 2 HOH HOH A . E 3 HOH 2 202 3 HOH HOH A . E 3 HOH 3 203 7 HOH HOH A . E 3 HOH 4 204 8 HOH HOH A . E 3 HOH 5 205 10 HOH HOH A . E 3 HOH 6 206 11 HOH HOH A . F 3 HOH 1 201 1 HOH HOH B . F 3 HOH 2 202 4 HOH HOH B . F 3 HOH 3 203 5 HOH HOH B . F 3 HOH 4 204 6 HOH HOH B . F 3 HOH 5 205 9 HOH HOH B . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal DNA 'data collection' . ? 1 PHASER phasing . ? 2 PHENIX refinement '(phenix.refine: 1.6.1_357)' ? 3 XDS 'data reduction' . ? 4 XDS 'data scaling' . ? 5 # _cell.entry_id 4K32 _cell.length_a 33.080 _cell.length_b 90.760 _cell.length_c 47.010 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 8 _cell.pdbx_unique_axis ? _cell.length_a_esd ? _cell.length_b_esd ? _cell.length_c_esd ? _cell.angle_alpha_esd ? _cell.angle_beta_esd ? _cell.angle_gamma_esd ? # _symmetry.entry_id 4K32 _symmetry.space_group_name_H-M 'P 21 21 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 18 _symmetry.space_group_name_Hall ? # _exptl.entry_id 4K32 _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 2 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.40 _exptl_crystal.density_percent_sol 48.71 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 293.15 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.pdbx_details ;50 mM Na cacodylate, 1 mM spermine tetrahydrochloride, 1-20% 2-methyl-2,4-pentadiol (vs. 40% reservoir), 100-200 mM KCl, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293.15K ; # _diffrn.id 1 _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 315r' _diffrn_detector.pdbx_collection_date ? _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9394 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'ESRF BEAMLINE ID14-4' _diffrn_source.pdbx_synchrotron_site ESRF _diffrn_source.pdbx_synchrotron_beamline ID14-4 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 0.9394 # _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.entry_id 4K32 _reflns.observed_criterion_sigma_I 21.5 _reflns.observed_criterion_sigma_F 21.5 _reflns.d_resolution_low 50 _reflns.d_resolution_high 2.5 _reflns.number_obs 4294 _reflns.number_all 21134 _reflns.percent_possible_obs 81.6 _reflns.pdbx_Rmerge_I_obs 0.046 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy ? _reflns.R_free_details ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? # _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_ordinal 1 _reflns_shell.d_res_high 2.5 _reflns_shell.d_res_low 2.57 _reflns_shell.percent_possible_all 84.7 _reflns_shell.Rmerge_I_obs 0.64 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.meanI_over_sigI_obs 2.0 _reflns_shell.pdbx_redundancy ? _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 4K32 _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 4290 _refine.ls_number_reflns_all 4290 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.04 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 23.505 _refine.ls_d_res_high 2.500 _refine.ls_percent_reflns_obs 81.64 _refine.ls_R_factor_obs 0.2096 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2058 _refine.ls_R_factor_R_free 0.2445 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 10.00 _refine.ls_number_reflns_R_free 429 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] 1.5826 _refine.aniso_B[2][2] -7.1484 _refine.aniso_B[3][3] 5.5658 _refine.aniso_B[1][2] -0.0000 _refine.aniso_B[1][3] 0.0000 _refine.aniso_B[2][3] 0.0000 _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_ksol 0.403 _refine.solvent_model_param_bsol 66.954 _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values MLHL _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML 0.41 _refine.pdbx_overall_phase_error 25.06 _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 898 _refine_hist.pdbx_number_atoms_ligand 68 _refine_hist.number_atoms_solvent 11 _refine_hist.number_atoms_total 977 _refine_hist.d_res_high 2.500 _refine_hist.d_res_low 23.505 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function f_bond_d 0.006 ? ? 1137 'X-RAY DIFFRACTION' ? f_angle_d 0.954 ? ? 1766 'X-RAY DIFFRACTION' ? f_dihedral_angle_d 16.821 ? ? 581 'X-RAY DIFFRACTION' ? f_chiral_restr 0.057 ? ? 254 'X-RAY DIFFRACTION' ? f_plane_restr 0.008 ? ? 45 'X-RAY DIFFRACTION' ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_R_work _refine_ls_shell.R_factor_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_all _refine_ls_shell.R_factor_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.number_reflns_obs 'X-RAY DIFFRACTION' . 2.5004 2.8616 1295 0.3186 85.00 0.3486 . . 143 . . . . 'X-RAY DIFFRACTION' . 2.8616 3.6033 1300 0.2102 83.00 0.2987 . . 144 . . . . 'X-RAY DIFFRACTION' . 3.6033 23.5060 1266 0.1768 77.00 0.1956 . . 142 . . . . # _database_PDB_matrix.entry_id 4K32 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 4K32 _struct.title 'Crystal structure of geneticin bound to the leishmanial rRNA A-site' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 4K32 _struct_keywords.pdbx_keywords RNA/antibiotic _struct_keywords.text 'rRNA duplex, Ribosomal A-site, Aminoglycoside, Leishmanial ribosome, RNA, RNA-antibiotic complex' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 4K32 _struct_ref.pdbx_db_accession 4K32 _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_db_isoform ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 4K32 A 1 ? 23 ? 4K32 1 ? 23 ? 1 23 2 1 4K32 B 1 ? 23 ? 4K32 24 ? 46 ? 24 46 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 4070 ? 1 MORE -49 ? 1 'SSA (A^2)' 8280 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 3 N1 ? ? ? 1_555 B C 23 N3 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 3 N2 ? ? ? 1_555 B C 23 O2 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 O6 ? ? ? 1_555 B C 23 N4 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 4 N3 ? ? ? 1_555 B G 22 N1 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 4 N4 ? ? ? 1_555 B G 22 O6 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 4 O2 ? ? ? 1_555 B G 22 N2 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 5 N1 ? ? ? 1_555 B C 21 N3 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 5 N2 ? ? ? 1_555 B C 21 O2 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 O6 ? ? ? 1_555 B C 21 N4 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 6 O4 ? ? ? 1_555 B U 20 N3 ? ? A U 6 B U 43 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A C 7 N3 ? ? ? 1_555 B G 19 N1 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 7 N4 ? ? ? 1_555 B G 19 O6 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 7 O2 ? ? ? 1_555 B G 19 N2 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 9 N3 ? ? ? 1_555 B A 16 N1 ? ? A U 9 B A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 9 O4 ? ? ? 1_555 B A 16 N6 ? ? A U 9 B A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 10 N3 ? ? ? 1_555 B A 15 N1 ? ? A U 10 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 10 O4 ? ? ? 1_555 B A 15 N6 ? ? A U 10 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 14 N1 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 14 O6 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 14 N2 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 12 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 12 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 12 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 12 N3 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 12 O2 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 12 N4 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 14 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 14 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 14 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 15 N1 ? ? ? 1_555 B U 10 N3 ? ? A A 15 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 15 N6 ? ? ? 1_555 B U 10 O4 ? ? A A 15 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 16 N1 ? ? ? 1_555 B U 9 N3 ? ? A A 16 B U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 16 N6 ? ? ? 1_555 B U 9 O4 ? ? A A 16 B U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 7 N3 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 7 O2 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 7 N4 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 20 N3 ? ? ? 1_555 B U 6 O4 ? ? A U 20 B U 29 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog38 hydrog ? ? A C 21 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 21 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 21 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 22 N1 ? ? ? 1_555 B C 4 N3 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 22 N2 ? ? ? 1_555 B C 4 O2 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 22 O6 ? ? ? 1_555 B C 4 N4 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 23 N3 ? ? ? 1_555 B G 3 N1 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 23 N4 ? ? ? 1_555 B G 3 O6 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 23 O2 ? ? ? 1_555 B G 3 N2 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A GET 101 ? 11 'BINDING SITE FOR RESIDUE GET A 101' AC2 Software B GET 101 ? 11 'BINDING SITE FOR RESIDUE GET B 101' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 11 C A 4 ? C A 4 . ? 1_555 ? 2 AC1 11 G A 5 ? G A 5 . ? 1_555 ? 3 AC1 11 U A 6 ? U A 6 . ? 1_555 ? 4 AC1 11 C A 7 ? C A 7 . ? 1_555 ? 5 AC1 11 G A 8 ? G A 8 . ? 1_555 ? 6 AC1 11 U A 9 ? U A 9 . ? 1_555 ? 7 AC1 11 A B 16 ? A B 39 . ? 1_555 ? 8 AC1 11 A B 17 ? A B 40 . ? 1_555 ? 9 AC1 11 A B 18 ? A B 41 . ? 1_555 ? 10 AC1 11 G B 19 ? G B 42 . ? 1_555 ? 11 AC1 11 U B 20 ? U B 43 . ? 1_555 ? 12 AC2 11 A A 16 ? A A 16 . ? 1_555 ? 13 AC2 11 A A 17 ? A A 17 . ? 1_555 ? 14 AC2 11 A A 18 ? A A 18 . ? 1_555 ? 15 AC2 11 G A 19 ? G A 19 . ? 1_555 ? 16 AC2 11 U A 20 ? U A 20 . ? 1_555 ? 17 AC2 11 C B 4 ? C B 27 . ? 1_555 ? 18 AC2 11 G B 5 ? G B 28 . ? 1_555 ? 19 AC2 11 U B 6 ? U B 29 . ? 1_555 ? 20 AC2 11 C B 7 ? C B 30 . ? 1_555 ? 21 AC2 11 G B 8 ? G B 31 . ? 1_555 ? 22 AC2 11 U B 9 ? U B 32 . ? 1_555 ? # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 1 _pdbx_validate_planes.auth_comp_id A _pdbx_validate_planes.auth_asym_id B _pdbx_validate_planes.auth_seq_id 40 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.056 _pdbx_validate_planes.type 'SIDE CHAIN' # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A U 1 ? A U 1 2 1 Y 1 A U 2 ? A U 2 3 1 Y 1 B U 24 ? B U 1 4 1 Y 1 B U 25 ? B U 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GET C11 C N S 111 GET O11 O N N 112 GET C21 C N R 113 GET N21 N N N 114 GET C31 C N R 115 GET O31 O N N 116 GET C41 C N S 117 GET O41 O N N 118 GET C51 C N R 119 GET O51 O N N 120 GET C61 C N R 121 GET O61 O N N 122 GET C71 C N N 123 GET C12 C N R 124 GET N12 N N N 125 GET C22 C N N 126 GET C32 C N S 127 GET N32 N N N 128 GET C42 C N R 129 GET C52 C N S 130 GET O52 O N N 131 GET C62 C N S 132 GET O62 O N N 133 GET C13 C N R 134 GET C23 C N R 135 GET O23 O N N 136 GET C33 C N R 137 GET N33 N N N 138 GET C93 C N N 139 GET C43 C N R 140 GET O43 O N N 141 GET C83 C N N 142 GET C53 C N N 143 GET O53 O N N 144 GET H111 H N N 145 GET H21 H N N 146 GET H211 H N N 147 GET H212 H N N 148 GET H311 H N N 149 GET H31 H N N 150 GET H411 H N N 151 GET H41 H N N 152 GET H511 H N N 153 GET H611 H N N 154 GET H61 H N N 155 GET H711 H N N 156 GET H712 H N N 157 GET H713 H N N 158 GET H12 H N N 159 GET H121 H N N 160 GET H122 H N N 161 GET H221 H N N 162 GET H222 H N N 163 GET H32 H N N 164 GET H321 H N N 165 GET H322 H N N 166 GET H421 H N N 167 GET H521 H N N 168 GET H52 H N N 169 GET H621 H N N 170 GET H131 H N N 171 GET H231 H N N 172 GET H23 H N N 173 GET H331 H N N 174 GET H33 H N N 175 GET H931 H N N 176 GET H932 H N N 177 GET H933 H N N 178 GET H43 H N N 179 GET H831 H N N 180 GET H832 H N N 181 GET H833 H N N 182 GET H531 H N N 183 GET H532 H N N 184 HOH O O N N 185 HOH H1 H N N 186 HOH H2 H N N 187 U OP3 O N N 188 U P P N N 189 U OP1 O N N 190 U OP2 O N N 191 U "O5'" O N N 192 U "C5'" C N N 193 U "C4'" C N R 194 U "O4'" O N N 195 U "C3'" C N S 196 U "O3'" O N N 197 U "C2'" C N R 198 U "O2'" O N N 199 U "C1'" C N R 200 U N1 N N N 201 U C2 C N N 202 U O2 O N N 203 U N3 N N N 204 U C4 C N N 205 U O4 O N N 206 U C5 C N N 207 U C6 C N N 208 U HOP3 H N N 209 U HOP2 H N N 210 U "H5'" H N N 211 U "H5''" H N N 212 U "H4'" H N N 213 U "H3'" H N N 214 U "HO3'" H N N 215 U "H2'" H N N 216 U "HO2'" H N N 217 U "H1'" H N N 218 U H3 H N N 219 U H5 H N N 220 U H6 H N N 221 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GET C11 O11 sing N N 116 GET C11 C21 sing N N 117 GET C11 O51 sing N N 118 GET C11 H111 sing N N 119 GET O11 C42 sing N N 120 GET C21 N21 sing N N 121 GET C21 C31 sing N N 122 GET C21 H21 sing N N 123 GET N21 H211 sing N N 124 GET N21 H212 sing N N 125 GET C31 O31 sing N N 126 GET C31 C41 sing N N 127 GET C31 H311 sing N N 128 GET O31 H31 sing N N 129 GET C41 O41 sing N N 130 GET C41 C51 sing N N 131 GET C41 H411 sing N N 132 GET O41 H41 sing N N 133 GET C51 O51 sing N N 134 GET C51 C61 sing N N 135 GET C51 H511 sing N N 136 GET C61 O61 sing N N 137 GET C61 C71 sing N N 138 GET C61 H611 sing N N 139 GET O61 H61 sing N N 140 GET C71 H711 sing N N 141 GET C71 H712 sing N N 142 GET C71 H713 sing N N 143 GET C12 N12 sing N N 144 GET C12 C22 sing N N 145 GET C12 C62 sing N N 146 GET C12 H12 sing N N 147 GET N12 H121 sing N N 148 GET N12 H122 sing N N 149 GET C22 C32 sing N N 150 GET C22 H221 sing N N 151 GET C22 H222 sing N N 152 GET C32 N32 sing N N 153 GET C32 C42 sing N N 154 GET C32 H32 sing N N 155 GET N32 H321 sing N N 156 GET N32 H322 sing N N 157 GET C42 C52 sing N N 158 GET C42 H421 sing N N 159 GET C52 O52 sing N N 160 GET C52 C62 sing N N 161 GET C52 H521 sing N N 162 GET O52 H52 sing N N 163 GET C62 O62 sing N N 164 GET C62 H621 sing N N 165 GET O62 C13 sing N N 166 GET C13 C23 sing N N 167 GET C13 O53 sing N N 168 GET C13 H131 sing N N 169 GET C23 O23 sing N N 170 GET C23 C33 sing N N 171 GET C23 H231 sing N N 172 GET O23 H23 sing N N 173 GET C33 N33 sing N N 174 GET C33 C43 sing N N 175 GET C33 H331 sing N N 176 GET N33 C93 sing N N 177 GET N33 H33 sing N N 178 GET C93 H931 sing N N 179 GET C93 H932 sing N N 180 GET C93 H933 sing N N 181 GET C43 O43 sing N N 182 GET C43 C83 sing N N 183 GET C43 C53 sing N N 184 GET O43 H43 sing N N 185 GET C83 H831 sing N N 186 GET C83 H832 sing N N 187 GET C83 H833 sing N N 188 GET C53 O53 sing N N 189 GET C53 H531 sing N N 190 GET C53 H532 sing N N 191 HOH O H1 sing N N 192 HOH O H2 sing N N 193 U OP3 P sing N N 194 U OP3 HOP3 sing N N 195 U P OP1 doub N N 196 U P OP2 sing N N 197 U P "O5'" sing N N 198 U OP2 HOP2 sing N N 199 U "O5'" "C5'" sing N N 200 U "C5'" "C4'" sing N N 201 U "C5'" "H5'" sing N N 202 U "C5'" "H5''" sing N N 203 U "C4'" "O4'" sing N N 204 U "C4'" "C3'" sing N N 205 U "C4'" "H4'" sing N N 206 U "O4'" "C1'" sing N N 207 U "C3'" "O3'" sing N N 208 U "C3'" "C2'" sing N N 209 U "C3'" "H3'" sing N N 210 U "O3'" "HO3'" sing N N 211 U "C2'" "O2'" sing N N 212 U "C2'" "C1'" sing N N 213 U "C2'" "H2'" sing N N 214 U "O2'" "HO2'" sing N N 215 U "C1'" N1 sing N N 216 U "C1'" "H1'" sing N N 217 U N1 C2 sing N N 218 U N1 C6 sing N N 219 U C2 O2 doub N N 220 U C2 N3 sing N N 221 U N3 C4 sing N N 222 U N3 H3 sing N N 223 U C4 O4 doub N N 224 U C4 C5 sing N N 225 U C5 C6 doub N N 226 U C5 H5 sing N N 227 U C6 H6 sing N N 228 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 4K32 'double helix' 4K32 'a-form double helix' 4K32 'mismatched base pair' 4K32 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 3 1_555 B C 23 1_555 -0.219 -0.146 0.145 0.852 -3.202 4.523 1 A_G3:C46_B A 3 ? B 46 ? 19 1 1 A C 4 1_555 B G 22 1_555 -0.659 -0.213 -0.316 12.348 -9.098 -3.791 2 A_C4:G45_B A 4 ? B 45 ? 19 1 1 A G 5 1_555 B C 21 1_555 -0.033 -0.371 -0.403 -0.452 -6.232 -0.211 3 A_G5:C44_B A 5 ? B 44 ? 19 1 1 A U 6 1_555 B U 20 1_555 -1.485 -1.541 -0.257 6.874 -6.427 -8.612 4 A_U6:U43_B A 6 ? B 43 ? ? ? 1 A C 7 1_555 B G 19 1_555 0.332 -0.313 -0.066 -10.177 8.941 -0.898 5 A_C7:G42_B A 7 ? B 42 ? 19 1 1 A U 9 1_555 B A 16 1_555 -0.154 -0.051 0.087 -0.189 -15.775 4.296 6 A_U9:A39_B A 9 ? B 39 ? 20 1 1 A U 10 1_555 B A 15 1_555 0.228 -0.262 -0.079 6.771 -15.019 4.776 7 A_U10:A38_B A 10 ? B 38 ? 20 1 1 A C 11 1_555 B G 14 1_555 0.494 -0.150 -0.084 4.358 -10.341 2.318 8 A_C11:G37_B A 11 ? B 37 ? 19 1 1 A C 12 1_555 B G 13 1_555 -0.122 -0.170 0.039 0.064 -10.957 -1.455 9 A_C12:G36_B A 12 ? B 36 ? 19 1 1 A G 13 1_555 B C 12 1_555 -0.006 -0.318 0.325 -3.802 -15.273 -0.410 10 A_G13:C35_B A 13 ? B 35 ? 19 1 1 A G 14 1_555 B C 11 1_555 -0.144 -0.258 0.044 -7.002 -11.766 -0.778 11 A_G14:C34_B A 14 ? B 34 ? 19 1 1 A A 15 1_555 B U 10 1_555 -0.164 -0.266 0.235 -5.084 -11.542 0.145 12 A_A15:U33_B A 15 ? B 33 ? 20 1 1 A A 16 1_555 B U 9 1_555 0.348 -0.180 -0.027 1.385 -20.868 -4.975 13 A_A16:U32_B A 16 ? B 32 ? 20 1 1 A G 19 1_555 B C 7 1_555 0.287 -0.153 -0.560 -4.069 -8.913 2.746 14 A_G19:C30_B A 19 ? B 30 ? 19 1 1 A U 20 1_555 B U 6 1_555 2.012 -1.482 -0.393 -9.046 -12.565 -4.761 15 A_U20:U29_B A 20 ? B 29 ? ? ? 1 A C 21 1_555 B G 5 1_555 0.295 -0.240 -0.441 4.381 -7.667 3.727 16 A_C21:G28_B A 21 ? B 28 ? 19 1 1 A G 22 1_555 B C 4 1_555 0.049 -0.253 0.223 -7.443 -7.561 -3.340 17 A_G22:C27_B A 22 ? B 27 ? 19 1 1 A C 23 1_555 B G 3 1_555 1.160 -0.098 -0.018 1.935 2.996 -5.067 18 A_C23:G26_B A 23 ? B 26 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 3 1_555 B C 23 1_555 A C 4 1_555 B G 22 1_555 -0.604 -2.122 3.123 2.547 -3.048 29.633 -3.496 1.688 3.258 -5.925 -4.951 29.892 1 AA_G3C4:G45C46_BB A 3 ? B 46 ? A 4 ? B 45 ? 1 A C 4 1_555 B G 22 1_555 A G 5 1_555 B C 21 1_555 0.227 -1.452 3.685 1.469 14.770 34.864 -4.230 -0.153 2.867 23.384 -2.326 37.802 2 AA_C4G5:C44G45_BB A 4 ? B 45 ? A 5 ? B 44 ? 1 A G 5 1_555 B C 21 1_555 A U 6 1_555 B U 20 1_555 -0.354 -1.875 2.952 -3.368 -0.359 27.664 -3.814 0.000 2.996 -0.747 7.009 27.867 3 AA_G5U6:U43C44_BB A 5 ? B 44 ? A 6 ? B 43 ? 1 A U 6 1_555 B U 20 1_555 A C 7 1_555 B G 19 1_555 0.865 -2.538 3.874 -0.699 5.948 41.885 -4.206 -1.280 3.484 8.269 0.972 42.292 4 AA_U6C7:G42U43_BB A 6 ? B 43 ? A 7 ? B 42 ? 1 A U 9 1_555 B A 16 1_555 A U 10 1_555 B A 15 1_555 -0.013 -1.210 3.109 -1.078 5.093 33.999 -2.782 -0.133 2.901 8.647 1.830 34.384 5 AA_U9U10:A38A39_BB A 9 ? B 39 ? A 10 ? B 38 ? 1 A U 10 1_555 B A 15 1_555 A C 11 1_555 B G 14 1_555 -0.239 -1.446 3.308 -1.018 6.533 33.678 -3.447 0.250 2.989 11.142 1.736 34.303 6 AA_U10C11:G37A38_BB A 10 ? B 38 ? A 11 ? B 37 ? 1 A C 11 1_555 B G 14 1_555 A C 12 1_555 B G 13 1_555 -0.604 -1.780 3.393 -2.695 5.922 26.824 -5.160 0.617 2.983 12.532 5.704 27.588 7 AA_C11C12:G36G37_BB A 11 ? B 37 ? A 12 ? B 36 ? 1 A C 12 1_555 B G 13 1_555 A G 13 1_555 B C 12 1_555 0.441 -2.026 3.293 0.324 7.408 32.087 -4.764 -0.727 2.773 13.183 -0.576 32.910 8 AA_C12G13:C35G36_BB A 12 ? B 36 ? A 13 ? B 35 ? 1 A G 13 1_555 B C 12 1_555 A G 14 1_555 B C 11 1_555 -0.188 -1.850 3.284 1.186 6.027 29.760 -4.678 0.585 2.853 11.579 -2.278 30.373 9 AA_G13G14:C34C35_BB A 13 ? B 35 ? A 14 ? B 34 ? 1 A G 14 1_555 B C 11 1_555 A A 15 1_555 B U 10 1_555 -0.073 -1.135 3.155 0.797 9.338 32.234 -3.376 0.246 2.727 16.391 -1.398 33.534 10 AA_G14A15:U33C34_BB A 14 ? B 34 ? A 15 ? B 33 ? 1 A A 15 1_555 B U 10 1_555 A A 16 1_555 B U 9 1_555 0.161 -1.161 3.103 3.578 8.732 33.871 -3.111 0.220 2.732 14.638 -5.998 35.124 11 AA_A15A16:U32U33_BB A 15 ? B 33 ? A 16 ? B 32 ? 1 A G 19 1_555 B C 7 1_555 A U 20 1_555 B U 6 1_555 -1.172 -2.147 3.631 -1.518 6.075 39.653 -3.870 1.523 3.321 8.889 2.222 40.125 12 AA_G19U20:U29C30_BB A 19 ? B 30 ? A 20 ? B 29 ? 1 A U 20 1_555 B U 6 1_555 A C 21 1_555 B G 5 1_555 0.422 -1.507 2.872 0.916 -1.051 24.258 -3.286 -0.745 2.948 -2.498 -2.177 24.298 13 AA_U20C21:G28U29_BB A 20 ? B 29 ? A 21 ? B 28 ? 1 A C 21 1_555 B G 5 1_555 A G 22 1_555 B C 4 1_555 -0.896 -1.453 3.553 -1.636 6.893 31.668 -3.871 1.302 3.214 12.436 2.951 32.431 14 AA_C21G22:C27G28_BB A 21 ? B 28 ? A 22 ? B 27 ? 1 A G 22 1_555 B C 4 1_555 A C 23 1_555 B G 3 1_555 0.650 -1.646 3.124 3.637 2.538 37.610 -2.845 -0.558 3.058 3.920 -5.618 37.861 15 AA_G22C23:G26C27_BB A 22 ? B 27 ? A 23 ? B 26 ? # _atom_sites.entry_id 4K32 _atom_sites.fract_transf_matrix[1][1] 0.030230 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.011018 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.021272 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_