data_4KQY # _entry.id 4KQY # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.388 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 4KQY pdb_00004kqy 10.2210/pdb4kqy/pdb NDB NA2446 ? ? RCSB RCSB079683 ? ? WWPDB D_1000079683 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2013-08-07 2 'Structure model' 1 1 2024-03-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 2 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' database_2 4 2 'Structure model' pdbx_struct_conn_angle 5 2 'Structure model' struct_conn 6 2 'Structure model' struct_ref_seq_dif 7 2 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' 3 2 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_comp_id' 4 2 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id' 5 2 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_atom_id' 6 2 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_comp_id' 7 2 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_seq_id' 8 2 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_comp_id' 9 2 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id' 10 2 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_atom_id' 11 2 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_comp_id' 12 2 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_seq_id' 13 2 'Structure model' '_struct_conn.pdbx_dist_value' 14 2 'Structure model' '_struct_conn.ptnr1_auth_comp_id' 15 2 'Structure model' '_struct_conn.ptnr1_auth_seq_id' 16 2 'Structure model' '_struct_conn.ptnr1_label_comp_id' 17 2 'Structure model' '_struct_conn.ptnr1_label_seq_id' 18 2 'Structure model' '_struct_conn.ptnr2_auth_seq_id' 19 2 'Structure model' '_struct_conn.ptnr2_label_asym_id' 20 2 'Structure model' '_struct_ref_seq_dif.details' 21 2 'Structure model' '_struct_site.pdbx_auth_asym_id' 22 2 'Structure model' '_struct_site.pdbx_auth_comp_id' 23 2 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_PDB_obs_spr.id SPRSDE _pdbx_database_PDB_obs_spr.date 2013-08-07 _pdbx_database_PDB_obs_spr.pdb_id 4KQY _pdbx_database_PDB_obs_spr.replace_pdb_id 3NPB _pdbx_database_PDB_obs_spr.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 4KQY _pdbx_database_status.recvd_initial_deposition_date 2013-05-15 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site PDBJ _pdbx_database_status.methods_development_category ? _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # _audit_author.name 'Lu, C.' _audit_author.pdbx_ordinal 1 # _citation.id primary _citation.title 'SAM recognition and conformational switching mechanism in the Bacillus subtilis yitJ S box/SAM-I riboswitch' _citation.journal_abbrev J.Mol.Biol. _citation.journal_volume 404 _citation.page_first 803 _citation.page_last 818 _citation.year 2010 _citation.journal_id_ASTM JMOBAK _citation.country UK _citation.journal_id_ISSN 0022-2836 _citation.journal_id_CSD 0070 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 20951706 _citation.pdbx_database_id_DOI 10.1016/j.jmb.2010.09.059 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lu, C.' 1 ? primary 'Ding, F.' 2 ? primary 'Chowdhury, A.' 3 ? primary 'Pradhan, V.' 4 ? primary 'Tomsic, J.' 5 ? primary 'Holmes, W.M.' 6 ? primary 'Henkin, T.M.' 7 ? primary 'Ke, A.' 8 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'YitJ S box/SAM-I riboswitch' 38572.141 1 ? ? ? ? 2 non-polymer syn S-ADENOSYLMETHIONINE 398.437 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 4 water nat water 18.015 8 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GUUCUUAUCAAGAGAAGCAGAGGGACUGGCCCGACGAAGCUUCAGCAACCGGUGUAAUGGCGAAAGCCAUGACCAAGGUG CUAAAUCCAGCAAGCUCGAACAGCUUGGAAGAUAAGAAC ; _entity_poly.pdbx_seq_one_letter_code_can ;GUUCUUAUCAAGAGAAGCAGAGGGACUGGCCCGACGAAGCUUCAGCAACCGGUGUAAUGGCGAAAGCCAUGACCAAGGUG CUAAAUCCAGCAAGCUCGAACAGCUUGGAAGAUAAGAAC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 S-ADENOSYLMETHIONINE SAM 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 U n 1 3 U n 1 4 C n 1 5 U n 1 6 U n 1 7 A n 1 8 U n 1 9 C n 1 10 A n 1 11 A n 1 12 G n 1 13 A n 1 14 G n 1 15 A n 1 16 A n 1 17 G n 1 18 C n 1 19 A n 1 20 G n 1 21 A n 1 22 G n 1 23 G n 1 24 G n 1 25 A n 1 26 C n 1 27 U n 1 28 G n 1 29 G n 1 30 C n 1 31 C n 1 32 C n 1 33 G n 1 34 A n 1 35 C n 1 36 G n 1 37 A n 1 38 A n 1 39 G n 1 40 C n 1 41 U n 1 42 U n 1 43 C n 1 44 A n 1 45 G n 1 46 C n 1 47 A n 1 48 A n 1 49 C n 1 50 C n 1 51 G n 1 52 G n 1 53 U n 1 54 G n 1 55 U n 1 56 A n 1 57 A n 1 58 U n 1 59 G n 1 60 G n 1 61 C n 1 62 G n 1 63 A n 1 64 A n 1 65 A n 1 66 G n 1 67 C n 1 68 C n 1 69 A n 1 70 U n 1 71 G n 1 72 A n 1 73 C n 1 74 C n 1 75 A n 1 76 A n 1 77 G n 1 78 G n 1 79 U n 1 80 G n 1 81 C n 1 82 U n 1 83 A n 1 84 A n 1 85 A n 1 86 U n 1 87 C n 1 88 C n 1 89 A n 1 90 G n 1 91 C n 1 92 A n 1 93 A n 1 94 G n 1 95 C n 1 96 U n 1 97 C n 1 98 G n 1 99 A n 1 100 A n 1 101 C n 1 102 A n 1 103 G n 1 104 C n 1 105 U n 1 106 U n 1 107 G n 1 108 G n 1 109 A n 1 110 A n 1 111 G n 1 112 A n 1 113 U n 1 114 A n 1 115 A n 1 116 G n 1 117 A n 1 118 A n 1 119 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'Bacillus subtilis' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 1192196 _pdbx_entity_src_syn.details 'In vitro transcription' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 SAM non-polymer . S-ADENOSYLMETHIONINE ? 'C15 H22 N6 O5 S' 398.437 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 0 0 G G A . n A 1 2 U 2 1 1 U U A . n A 1 3 U 3 2 2 U U A . n A 1 4 C 4 3 3 C C A . n A 1 5 U 5 4 4 U U A . n A 1 6 U 6 5 5 U U A . n A 1 7 A 7 6 6 A A A . n A 1 8 U 8 7 7 U U A . n A 1 9 C 9 8 8 C C A . n A 1 10 A 10 9 9 A A A . n A 1 11 A 11 10 10 A A A . n A 1 12 G 12 11 11 G G A . n A 1 13 A 13 12 12 A A A . n A 1 14 G 14 13 13 G G A . n A 1 15 A 15 14 14 A A A . n A 1 16 A 16 15 15 A A A . n A 1 17 G 17 16 16 G G A . n A 1 18 C 18 17 17 C C A . n A 1 19 A 19 18 18 A A A . n A 1 20 G 20 19 19 G G A . n A 1 21 A 21 20 20 A A A . n A 1 22 G 22 21 21 G G A . n A 1 23 G 23 22 22 G G A . n A 1 24 G 24 23 23 G G A . n A 1 25 A 25 24 24 A A A . n A 1 26 C 26 25 25 C C A . n A 1 27 U 27 26 26 U U A . n A 1 28 G 28 27 27 G G A . n A 1 29 G 29 28 28 G G A . n A 1 30 C 30 29 29 C C A . n A 1 31 C 31 30 30 C C A . n A 1 32 C 32 31 31 C C A . n A 1 33 G 33 32 32 G G A . n A 1 34 A 34 33 33 A A A . n A 1 35 C 35 34 34 C C A . n A 1 36 G 36 35 35 G G A . n A 1 37 A 37 36 36 A A A . n A 1 38 A 38 37 37 A A A . n A 1 39 G 39 38 38 G G A . n A 1 40 C 40 39 39 C C A . n A 1 41 U 41 40 40 U U A . n A 1 42 U 42 41 41 U U A . n A 1 43 C 43 42 42 C C A . n A 1 44 A 44 43 43 A A A . n A 1 45 G 45 44 44 G G A . n A 1 46 C 46 45 45 C C A . n A 1 47 A 47 46 46 A A A . n A 1 48 A 48 47 47 A A A . n A 1 49 C 49 48 48 C C A . n A 1 50 C 50 49 49 C C A . n A 1 51 G 51 50 50 G G A . n A 1 52 G 52 51 51 G G A . n A 1 53 U 53 52 52 U U A . n A 1 54 G 54 53 53 G G A . n A 1 55 U 55 54 54 U U A . n A 1 56 A 56 55 55 A A A . n A 1 57 A 57 56 56 A A A . n A 1 58 U 58 57 57 U U A . n A 1 59 G 59 58 58 G G A . n A 1 60 G 60 59 59 G G A . n A 1 61 C 61 60 60 C C A . n A 1 62 G 62 61 61 G G A . n A 1 63 A 63 62 62 A A A . n A 1 64 A 64 63 63 A A A . n A 1 65 A 65 64 64 A A A . n A 1 66 G 66 65 65 G G A . n A 1 67 C 67 66 66 C C A . n A 1 68 C 68 67 67 C C A . n A 1 69 A 69 68 68 A A A . n A 1 70 U 70 69 69 U U A . n A 1 71 G 71 70 70 G G A . n A 1 72 A 72 71 71 A A A . n A 1 73 C 73 72 72 C C A . n A 1 74 C 74 73 73 C C A . n A 1 75 A 75 74 74 A A A . n A 1 76 A 76 75 75 A A A . n A 1 77 G 77 76 76 G G A . n A 1 78 G 78 77 77 G G A . n A 1 79 U 79 78 78 U U A . n A 1 80 G 80 79 79 G G A . n A 1 81 C 81 80 80 C C A . n A 1 82 U 82 81 81 U U A . n A 1 83 A 83 82 82 A A A . n A 1 84 A 84 83 83 A A A . n A 1 85 A 85 84 84 A A A . n A 1 86 U 86 85 85 U U A . n A 1 87 C 87 86 86 C C A . n A 1 88 C 88 87 87 C C A . n A 1 89 A 89 88 88 A A A . n A 1 90 G 90 89 89 G G A . n A 1 91 C 91 90 90 C C A . n A 1 92 A 92 91 91 A A A . n A 1 93 A 93 92 92 A A A . n A 1 94 G 94 93 93 G G A . n A 1 95 C 95 94 94 C C A . n A 1 96 U 96 95 95 U U A . n A 1 97 C 97 96 96 C C A . n A 1 98 G 98 97 97 G G A . n A 1 99 A 99 98 98 A A A . n A 1 100 A 100 99 99 A A A . n A 1 101 C 101 100 100 C C A . n A 1 102 A 102 101 101 A A A . n A 1 103 G 103 102 102 G G A . n A 1 104 C 104 103 103 C C A . n A 1 105 U 105 104 104 U U A . n A 1 106 U 106 105 105 U U A . n A 1 107 G 107 106 106 G G A . n A 1 108 G 108 107 107 G G A . n A 1 109 A 109 108 108 A A A . n A 1 110 A 110 109 109 A A A . n A 1 111 G 111 110 110 G G A . n A 1 112 A 112 111 111 A A A . n A 1 113 U 113 112 112 U U A . n A 1 114 A 114 113 113 A A A . n A 1 115 A 115 114 114 A A A . n A 1 116 G 116 115 115 G G A . n A 1 117 A 117 116 116 A A A . n A 1 118 A 118 117 117 A A A . n A 1 119 C 119 118 118 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 SAM 1 201 119 SAM SAM A . C 3 MG 1 202 201 MG MG A . D 3 MG 1 203 202 MG MG A . E 4 HOH 1 301 120 HOH HOH A . E 4 HOH 2 302 121 HOH HOH A . E 4 HOH 3 303 122 HOH HOH A . E 4 HOH 4 304 123 HOH HOH A . E 4 HOH 5 305 124 HOH HOH A . E 4 HOH 6 306 125 HOH HOH A . E 4 HOH 7 307 126 HOH HOH A . E 4 HOH 8 308 127 HOH HOH A . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal HKL-2000 'data collection' . ? 1 PHASER phasing . ? 2 REFMAC refinement 5.7.0032 ? 3 HKL-2000 'data reduction' . ? 4 HKL-2000 'data scaling' . ? 5 # _cell.entry_id 4KQY _cell.length_a 58.732 _cell.length_b 58.732 _cell.length_c 204.091 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 6 _cell.pdbx_unique_axis ? _cell.length_a_esd ? _cell.length_b_esd ? _cell.length_c_esd ? _cell.angle_alpha_esd ? _cell.angle_beta_esd ? _cell.angle_gamma_esd ? # _symmetry.entry_id 4KQY _symmetry.space_group_name_H-M 'P 31 2 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 152 _symmetry.space_group_name_Hall ? # _exptl.entry_id 4KQY _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.63 _exptl_crystal.density_percent_sol 53.31 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION' _exptl_crystal_grow.temp 298 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_details '40mM sodium cacodylate, pH 7.0, 80mM strontium chloride, 15% MPD, 2mM spermine, 1mM SAM, VAPOR DIFFUSION, temperature 298K' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.id 1 _diffrn.ambient_temp 80 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 270' _diffrn_detector.pdbx_collection_date ? _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'CHESS BEAMLINE F1' _diffrn_source.pdbx_synchrotron_site CHESS _diffrn_source.pdbx_synchrotron_beamline F1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 0.9 # _reflns.entry_id 4KQY _reflns.observed_criterion_sigma_I ? _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 24.68 _reflns.d_resolution_high 3.01 _reflns.number_obs 7365 _reflns.number_all 8168 _reflns.percent_possible_obs 94.6 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy ? _reflns.R_free_details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_ordinal 1 _reflns.pdbx_diffrn_id 1 # _refine.entry_id 4KQY _refine.ls_number_reflns_obs 7365 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I 2 _refine.pdbx_ls_sigma_F ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 24.68 _refine.ls_d_res_high 3.02 _refine.ls_percent_reflns_obs 94.48 _refine.ls_R_factor_obs 0.24291 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.23657 _refine.ls_R_factor_R_free 0.30025 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 9.8 _refine.ls_number_reflns_R_free 802 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc 0.935 _refine.correlation_coeff_Fo_to_Fc_free 0.891 _refine.B_iso_mean 53.925 _refine.aniso_B[1][1] -0.52 _refine.aniso_B[2][2] -0.52 _refine.aniso_B[3][3] 1.69 _refine.aniso_B[1][2] -0.52 _refine.aniso_B[1][3] 0.00 _refine.aniso_B[2][3] 0.00 _refine.solvent_model_details MASK _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii 1.20 _refine.pdbx_solvent_ion_probe_radii 0.80 _refine.pdbx_solvent_shrinkage_radii 0.80 _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.details 'HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS' _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values 'MAXIMUM LIKELIHOOD' _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free 0.567 _refine.overall_SU_ML 0.477 _refine.pdbx_overall_phase_error ? _refine.overall_SU_B 26.447 _refine.overall_SU_R_Cruickshank_DPI ? _refine.ls_redundancy_reflns_obs ? _refine.B_iso_min ? _refine.B_iso_max ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_diffrn_id 1 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 2556 _refine_hist.pdbx_number_atoms_ligand 29 _refine_hist.number_atoms_solvent 8 _refine_hist.number_atoms_total 2593 _refine_hist.d_res_high 3.02 _refine_hist.d_res_low 24.68 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_restraint_function _refine_ls_restr.pdbx_refine_id r_bond_refined_d 0.006 0.011 ? 2895 ? 'X-RAY DIFFRACTION' r_bond_other_d 0.004 0.020 ? 1193 ? 'X-RAY DIFFRACTION' r_angle_refined_deg 1.552 1.290 ? 4511 ? 'X-RAY DIFFRACTION' r_angle_other_deg 1.595 3.000 ? 2887 ? 'X-RAY DIFFRACTION' r_dihedral_angle_1_deg ? ? ? ? ? 'X-RAY DIFFRACTION' r_dihedral_angle_2_deg ? ? ? ? ? 'X-RAY DIFFRACTION' r_dihedral_angle_3_deg ? ? ? ? ? 'X-RAY DIFFRACTION' r_dihedral_angle_4_deg ? ? ? ? ? 'X-RAY DIFFRACTION' r_chiral_restr 0.109 0.200 ? 482 ? 'X-RAY DIFFRACTION' r_gen_planes_refined 0.008 0.020 ? 1467 ? 'X-RAY DIFFRACTION' r_gen_planes_other 0.001 0.020 ? 663 ? 'X-RAY DIFFRACTION' r_nbd_refined ? ? ? ? ? 'X-RAY DIFFRACTION' r_nbd_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_nbtor_refined ? ? ? ? ? 'X-RAY DIFFRACTION' r_nbtor_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_xyhbond_nbd_refined ? ? ? ? ? 'X-RAY DIFFRACTION' r_xyhbond_nbd_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_metal_ion_refined ? ? ? ? ? 'X-RAY DIFFRACTION' r_metal_ion_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_symmetry_vdw_refined ? ? ? ? ? 'X-RAY DIFFRACTION' r_symmetry_vdw_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_symmetry_hbond_refined ? ? ? ? ? 'X-RAY DIFFRACTION' r_symmetry_hbond_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_symmetry_metal_ion_refined ? ? ? ? ? 'X-RAY DIFFRACTION' r_symmetry_metal_ion_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_mcbond_it ? ? ? ? ? 'X-RAY DIFFRACTION' r_mcbond_other ? ? ? ? ? 'X-RAY DIFFRACTION' r_mcangle_it ? ? ? ? ? 'X-RAY DIFFRACTION' r_scbond_it ? ? ? ? ? 'X-RAY DIFFRACTION' r_scangle_it ? ? ? ? ? 'X-RAY DIFFRACTION' r_rigid_bond_restr ? ? ? ? ? 'X-RAY DIFFRACTION' r_sphericity_free ? ? ? ? ? 'X-RAY DIFFRACTION' r_sphericity_bonded ? ? ? ? ? 'X-RAY DIFFRACTION' # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.pdbx_total_number_of_bins_used 20 _refine_ls_shell.d_res_high 3.015 _refine_ls_shell.d_res_low 3.093 _refine_ls_shell.number_reflns_R_work 507 _refine_ls_shell.R_factor_R_work 0.388 _refine_ls_shell.percent_reflns_obs 89.98 _refine_ls_shell.R_factor_R_free 0.428 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.number_reflns_R_free 59 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.redundancy_reflns_obs ? # _database_PDB_matrix.entry_id 4KQY _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 4KQY _struct.title 'Bacillus subtilis yitJ S box/SAM-I riboswitch' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 4KQY _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'Gene regulation, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 4 ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code CP003695 _struct_ref.pdbx_db_accession CP003695.1 _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GUUCUUAUCAAGAGAAGCAGAGGGACUGGCCCGACGAAGCUUCAGCAACCGGUGUAAUGGCGAUCAGCCAUGACCAAGGU GCUAAAUCCAGCAAGCUCGAACAGCUUGGAAGAUAAGAAC ; _struct_ref.pdbx_align_begin 2894635 _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 4KQY _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 119 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession CP003695.1 _struct_ref_seq.db_align_beg 2894635 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 2894754 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 0 _struct_ref_seq.pdbx_auth_seq_align_end 118 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 4KQY ? A ? ? GB CP003695.1 U 2894698 deletion ? 1 1 4KQY A A 64 ? GB CP003695.1 C 2894699 conflict 63 2 # loop_ _pdbx_struct_assembly.id _pdbx_struct_assembly.details _pdbx_struct_assembly.method_details _pdbx_struct_assembly.oligomeric_details _pdbx_struct_assembly.oligomeric_count 1 author_defined_assembly ? monomeric 1 2 software_defined_assembly PISA dimeric 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 2 'ABSA (A^2)' 1730 ? 2 MORE -47 ? 2 'SSA (A^2)' 37440 ? # loop_ _pdbx_struct_assembly_gen.assembly_id _pdbx_struct_assembly_gen.oper_expression _pdbx_struct_assembly_gen.asym_id_list 1 1 A,B,C,D,E 2 1,2 A,B,C,D,E # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 4_555 y,x,-z -0.5000000000 0.8660254038 0.0000000000 0.0000000000 0.8660254038 0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A A 11 OP2 ? ? ? 1_555 C MG . MG ? ? A A 10 A MG 202 1_555 ? ? ? ? ? ? ? 2.250 ? ? metalc2 metalc ? ? A G 24 OP2 ? ? ? 1_555 D MG . MG ? ? A G 23 A MG 203 1_555 ? ? ? ? ? ? ? 2.715 ? ? metalc3 metalc ? ? A C 26 OP1 ? ? ? 1_555 D MG . MG ? ? A C 25 A MG 203 1_555 ? ? ? ? ? ? ? 2.543 ? ? metalc4 metalc ? ? A U 86 OP2 ? ? ? 1_555 C MG . MG ? ? A U 85 A MG 202 1_555 ? ? ? ? ? ? ? 2.308 ? ? hydrog1 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 119 O2 ? ? A G 0 A C 118 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog2 hydrog ? ? A U 2 N3 ? ? ? 1_555 A A 118 N1 ? ? A U 1 A A 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A U 2 O4 ? ? ? 1_555 A A 118 N6 ? ? A U 1 A A 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 117 N1 ? ? A U 2 A A 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 117 N6 ? ? A U 2 A A 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 116 N1 ? ? A C 3 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 116 O6 ? ? A C 3 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 116 N2 ? ? A C 3 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 115 N1 ? ? A U 4 A A 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 115 N6 ? ? A U 4 A A 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 114 N1 ? ? A U 5 A A 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 114 N6 ? ? A U 5 A A 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 113 N3 ? ? A A 6 A U 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 113 O4 ? ? A A 6 A U 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 112 N1 ? ? A U 7 A A 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 112 N6 ? ? A U 7 A A 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 111 N1 ? ? A C 8 A G 110 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 111 O6 ? ? A C 8 A G 110 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 111 N2 ? ? A C 8 A G 110 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 46 O2 ? ? A G 11 A C 45 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog21 hydrog ? ? A A 13 N3 ? ? ? 1_555 A G 45 N2 ? ? A A 12 A G 44 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog22 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 43 N3 ? ? A G 13 A C 42 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog23 hydrog ? ? A A 16 N6 ? ? ? 1_555 A U 41 O4 ? ? A A 15 A U 40 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog24 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 16 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 16 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 16 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 39 N2 ? ? A C 17 A G 38 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog28 hydrog ? ? A A 19 N3 ? ? ? 1_555 A A 38 N6 ? ? A A 18 A A 37 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog29 hydrog ? ? A G 20 N2 ? ? ? 1_555 A A 37 N7 ? ? A G 19 A A 36 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog30 hydrog ? ? A A 21 N6 ? ? ? 1_555 A G 36 N3 ? ? A A 20 A G 35 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog31 hydrog ? ? A G 22 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 21 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 22 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 21 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 22 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 21 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 22 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 22 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 22 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 23 A C 29 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog38 hydrog ? ? A G 24 N3 ? ? ? 1_555 A A 84 N6 ? ? A G 23 A A 83 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog39 hydrog ? ? A A 25 N6 ? ? ? 1_555 A A 110 N3 ? ? A A 24 A A 109 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog40 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 90 N2 ? ? A C 25 A G 89 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog41 hydrog ? ? A U 27 N3 ? ? ? 1_555 A A 89 N1 ? ? A U 26 A A 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A U 27 O4 ? ? ? 1_555 A A 89 N6 ? ? A U 26 A A 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 88 N3 ? ? A G 27 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 88 O2 ? ? A G 27 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 88 N4 ? ? A G 27 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 29 N1 ? ? ? 1_555 A C 87 N3 ? ? A G 28 A C 86 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog47 hydrog ? ? A C 31 O2 ? ? ? 1_555 A A 83 N6 ? ? A C 30 A A 82 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog48 hydrog ? ? A A 44 N1 ? ? ? 1_555 A U 82 N3 ? ? A A 43 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A A 44 N6 ? ? ? 1_555 A U 82 O4 ? ? A A 43 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 45 N1 ? ? ? 1_555 A C 81 N3 ? ? A G 44 A C 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 45 N2 ? ? ? 1_555 A C 81 O2 ? ? A G 44 A C 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 45 O6 ? ? ? 1_555 A C 81 N4 ? ? A G 44 A C 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 46 N3 ? ? ? 1_555 A G 80 N1 ? ? A C 45 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 46 N4 ? ? ? 1_555 A G 80 O6 ? ? A C 45 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 46 O2 ? ? ? 1_555 A G 80 N2 ? ? A C 45 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A A 48 N3 ? ? ? 1_555 A C 49 N4 ? ? A A 47 A C 48 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog57 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 78 N1 ? ? A C 48 A G 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 78 O6 ? ? A C 48 A G 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 78 N2 ? ? A C 48 A G 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 50 N4 ? ? ? 1_555 A A 75 N1 ? ? A C 49 A A 74 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog61 hydrog ? ? A C 50 N3 ? ? ? 1_555 A G 77 N1 ? ? A C 49 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 50 N4 ? ? ? 1_555 A G 77 O6 ? ? A C 49 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 50 O2 ? ? ? 1_555 A G 77 N2 ? ? A C 49 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 51 N1 ? ? ? 1_555 A C 74 N3 ? ? A G 50 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 51 N2 ? ? ? 1_555 A C 74 O2 ? ? A G 50 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 51 O6 ? ? ? 1_555 A C 74 N4 ? ? A G 50 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 52 N1 ? ? ? 1_555 A C 73 N3 ? ? A G 51 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 52 N2 ? ? ? 1_555 A C 73 O2 ? ? A G 51 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 52 O6 ? ? ? 1_555 A C 73 N4 ? ? A G 51 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A U 53 N3 ? ? ? 1_555 A A 72 N1 ? ? A U 52 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A U 53 O4 ? ? ? 1_555 A A 72 N6 ? ? A U 52 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A G 54 N1 ? ? ? 1_555 A G 71 O6 ? ? A G 53 A G 70 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog73 hydrog ? ? A A 57 N1 ? ? ? 1_555 A U 70 N3 ? ? A A 56 A U 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A A 57 N6 ? ? ? 1_555 A U 70 O4 ? ? A A 56 A U 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A U 58 N3 ? ? ? 1_555 A A 69 N1 ? ? A U 57 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A U 58 O4 ? ? ? 1_555 A A 69 N6 ? ? A U 57 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 59 N1 ? ? ? 1_555 A C 68 N3 ? ? A G 58 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A G 59 N2 ? ? ? 1_555 A C 68 O2 ? ? A G 58 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 59 O6 ? ? ? 1_555 A C 68 N4 ? ? A G 58 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 60 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 59 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A G 60 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 59 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 60 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 59 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 61 O2 ? ? ? 1_555 A G 66 N2 ? ? A C 60 A G 65 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog84 hydrog ? ? A G 62 N2 ? ? ? 1_555 A A 65 N7 ? ? A G 61 A A 64 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog85 hydrog ? ? A A 76 N6 ? ? ? 1_555 A G 80 O6 ? ? A A 75 A G 79 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog86 hydrog ? ? A U 86 N3 ? ? ? 1_555 A A 110 N1 ? ? A U 85 A A 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A U 86 O4 ? ? ? 1_555 A A 110 N6 ? ? A U 85 A A 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A C 91 N3 ? ? ? 1_555 A G 107 N1 ? ? A C 90 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 91 N4 ? ? ? 1_555 A G 107 O6 ? ? A C 90 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 91 O2 ? ? ? 1_555 A G 107 N2 ? ? A C 90 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A A 92 N1 ? ? ? 1_555 A U 106 N3 ? ? A A 91 A U 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A A 92 N6 ? ? ? 1_555 A U 106 O4 ? ? A A 91 A U 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A A 93 N6 ? ? ? 1_555 A U 105 O4 ? ? A A 92 A U 104 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog94 hydrog ? ? A G 94 N1 ? ? ? 1_555 A C 104 N3 ? ? A G 93 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A G 94 N2 ? ? ? 1_555 A C 104 O2 ? ? A G 93 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A G 94 O6 ? ? ? 1_555 A C 104 N4 ? ? A G 93 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 95 N3 ? ? ? 1_555 A G 103 N1 ? ? A C 94 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 95 N4 ? ? ? 1_555 A G 103 O6 ? ? A C 94 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 95 O2 ? ? ? 1_555 A G 103 N2 ? ? A C 94 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP2 ? A A 11 ? A A 10 ? 1_555 MG ? C MG . ? A MG 202 ? 1_555 OP2 ? A U 86 ? A U 85 ? 1_555 90.5 ? 2 OP2 ? A G 24 ? A G 23 ? 1_555 MG ? D MG . ? A MG 203 ? 1_555 OP1 ? A C 26 ? A C 25 ? 1_555 103.3 ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A SAM 201 ? 12 'BINDING SITE FOR RESIDUE SAM A 201' AC2 Software A MG 202 ? 2 'BINDING SITE FOR RESIDUE MG A 202' AC3 Software A MG 203 ? 3 'BINDING SITE FOR RESIDUE MG A 203' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 12 A A 7 ? A A 6 . ? 1_555 ? 2 AC1 12 U A 8 ? U A 7 . ? 1_555 ? 3 AC1 12 G A 12 ? G A 11 . ? 1_555 ? 4 AC1 12 A A 47 ? A A 46 . ? 1_555 ? 5 AC1 12 A A 48 ? A A 47 . ? 1_555 ? 6 AC1 12 C A 49 ? C A 48 . ? 1_555 ? 7 AC1 12 U A 79 ? U A 78 . ? 1_555 ? 8 AC1 12 G A 80 ? G A 79 . ? 1_555 ? 9 AC1 12 C A 81 ? C A 80 . ? 1_555 ? 10 AC1 12 A A 112 ? A A 111 . ? 1_555 ? 11 AC1 12 U A 113 ? U A 112 . ? 1_555 ? 12 AC1 12 A A 114 ? A A 113 . ? 1_555 ? 13 AC2 2 A A 11 ? A A 10 . ? 1_555 ? 14 AC2 2 U A 86 ? U A 85 . ? 1_555 ? 15 AC3 3 G A 24 ? G A 23 . ? 1_555 ? 16 AC3 3 A A 25 ? A A 24 . ? 1_555 ? 17 AC3 3 C A 26 ? C A 25 . ? 1_555 ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 O2 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 C _pdbx_validate_close_contact.auth_seq_id_1 48 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 "O2'" _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 A _pdbx_validate_close_contact.auth_seq_id_2 113 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 2.11 # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 "O2'" _pdbx_validate_symm_contact.auth_asym_id_1 A _pdbx_validate_symm_contact.auth_comp_id_1 U _pdbx_validate_symm_contact.auth_seq_id_1 52 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 "O2'" _pdbx_validate_symm_contact.auth_asym_id_2 A _pdbx_validate_symm_contact.auth_comp_id_2 G _pdbx_validate_symm_contact.auth_seq_id_2 65 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 6_455 _pdbx_validate_symm_contact.dist 2.04 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O5'" A G 76 ? ? P A G 76 ? ? OP1 A G 76 ? ? 97.88 105.70 -7.82 0.90 N 2 1 "O5'" A C 80 ? ? P A C 80 ? ? OP1 A C 80 ? ? 118.09 110.70 7.39 1.20 N 3 1 "O5'" A A 82 ? ? P A A 82 ? ? OP1 A A 82 ? ? 99.65 105.70 -6.05 0.90 N 4 1 "O5'" A A 88 ? ? P A A 88 ? ? OP1 A A 88 ? ? 118.02 110.70 7.32 1.20 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 MG MG MG N N 114 SAM N N N N 115 SAM CA C N S 116 SAM C C N N 117 SAM O O N N 118 SAM OXT O N N 119 SAM CB C N N 120 SAM CG C N N 121 SAM SD S N S 122 SAM CE C N N 123 SAM "C5'" C N N 124 SAM "C4'" C N S 125 SAM "O4'" O N N 126 SAM "C3'" C N S 127 SAM "O3'" O N N 128 SAM "C2'" C N R 129 SAM "O2'" O N N 130 SAM "C1'" C N R 131 SAM N9 N Y N 132 SAM C8 C Y N 133 SAM N7 N Y N 134 SAM C5 C Y N 135 SAM C6 C Y N 136 SAM N6 N N N 137 SAM N1 N Y N 138 SAM C2 C Y N 139 SAM N3 N Y N 140 SAM C4 C Y N 141 SAM HN1 H N N 142 SAM HN2 H N N 143 SAM HA H N N 144 SAM HB1 H N N 145 SAM HB2 H N N 146 SAM HG1 H N N 147 SAM HG2 H N N 148 SAM HE1 H N N 149 SAM HE2 H N N 150 SAM HE3 H N N 151 SAM "H5'1" H N N 152 SAM "H5'2" H N N 153 SAM "H4'" H N N 154 SAM "H3'" H N N 155 SAM "HO3'" H N N 156 SAM "H2'" H N N 157 SAM "HO2'" H N N 158 SAM "H1'" H N N 159 SAM H8 H N N 160 SAM HN61 H N N 161 SAM HN62 H N N 162 SAM H2 H N N 163 U OP3 O N N 164 U P P N N 165 U OP1 O N N 166 U OP2 O N N 167 U "O5'" O N N 168 U "C5'" C N N 169 U "C4'" C N R 170 U "O4'" O N N 171 U "C3'" C N S 172 U "O3'" O N N 173 U "C2'" C N R 174 U "O2'" O N N 175 U "C1'" C N R 176 U N1 N N N 177 U C2 C N N 178 U O2 O N N 179 U N3 N N N 180 U C4 C N N 181 U O4 O N N 182 U C5 C N N 183 U C6 C N N 184 U HOP3 H N N 185 U HOP2 H N N 186 U "H5'" H N N 187 U "H5''" H N N 188 U "H4'" H N N 189 U "H3'" H N N 190 U "HO3'" H N N 191 U "H2'" H N N 192 U "HO2'" H N N 193 U "H1'" H N N 194 U H3 H N N 195 U H5 H N N 196 U H6 H N N 197 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 SAM N CA sing N N 118 SAM N HN1 sing N N 119 SAM N HN2 sing N N 120 SAM CA C sing N N 121 SAM CA CB sing N N 122 SAM CA HA sing N N 123 SAM C O doub N N 124 SAM C OXT sing N N 125 SAM CB CG sing N N 126 SAM CB HB1 sing N N 127 SAM CB HB2 sing N N 128 SAM CG SD sing N N 129 SAM CG HG1 sing N N 130 SAM CG HG2 sing N N 131 SAM SD CE sing N N 132 SAM SD "C5'" sing N N 133 SAM CE HE1 sing N N 134 SAM CE HE2 sing N N 135 SAM CE HE3 sing N N 136 SAM "C5'" "C4'" sing N N 137 SAM "C5'" "H5'1" sing N N 138 SAM "C5'" "H5'2" sing N N 139 SAM "C4'" "O4'" sing N N 140 SAM "C4'" "C3'" sing N N 141 SAM "C4'" "H4'" sing N N 142 SAM "O4'" "C1'" sing N N 143 SAM "C3'" "O3'" sing N N 144 SAM "C3'" "C2'" sing N N 145 SAM "C3'" "H3'" sing N N 146 SAM "O3'" "HO3'" sing N N 147 SAM "C2'" "O2'" sing N N 148 SAM "C2'" "C1'" sing N N 149 SAM "C2'" "H2'" sing N N 150 SAM "O2'" "HO2'" sing N N 151 SAM "C1'" N9 sing N N 152 SAM "C1'" "H1'" sing N N 153 SAM N9 C8 sing Y N 154 SAM N9 C4 sing Y N 155 SAM C8 N7 doub Y N 156 SAM C8 H8 sing N N 157 SAM N7 C5 sing Y N 158 SAM C5 C6 sing Y N 159 SAM C5 C4 doub Y N 160 SAM C6 N6 sing N N 161 SAM C6 N1 doub Y N 162 SAM N6 HN61 sing N N 163 SAM N6 HN62 sing N N 164 SAM N1 C2 sing Y N 165 SAM C2 N3 doub Y N 166 SAM C2 H2 sing N N 167 SAM N3 C4 sing Y N 168 U OP3 P sing N N 169 U OP3 HOP3 sing N N 170 U P OP1 doub N N 171 U P OP2 sing N N 172 U P "O5'" sing N N 173 U OP2 HOP2 sing N N 174 U "O5'" "C5'" sing N N 175 U "C5'" "C4'" sing N N 176 U "C5'" "H5'" sing N N 177 U "C5'" "H5''" sing N N 178 U "C4'" "O4'" sing N N 179 U "C4'" "C3'" sing N N 180 U "C4'" "H4'" sing N N 181 U "O4'" "C1'" sing N N 182 U "C3'" "O3'" sing N N 183 U "C3'" "C2'" sing N N 184 U "C3'" "H3'" sing N N 185 U "O3'" "HO3'" sing N N 186 U "C2'" "O2'" sing N N 187 U "C2'" "C1'" sing N N 188 U "C2'" "H2'" sing N N 189 U "O2'" "HO2'" sing N N 190 U "C1'" N1 sing N N 191 U "C1'" "H1'" sing N N 192 U N1 C2 sing N N 193 U N1 C6 sing N N 194 U C2 O2 doub N N 195 U C2 N3 sing N N 196 U N3 C4 sing N N 197 U N3 H3 sing N N 198 U C4 O4 doub N N 199 U C4 C5 sing N N 200 U C5 C6 doub N N 201 U C5 H5 sing N N 202 U C6 H6 sing N N 203 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 4KQY 'double helix' 4KQY 'a-form double helix' 4KQY 'hairpin loop' 4KQY tetraloop 4KQY 'bulge loop' 4KQY 'mismatched base pair' 4KQY 'triple helix' 4KQY 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 119 1_555 1.229 0.618 -1.026 -7.940 13.411 14.817 1 A_G0:C118_A A 0 ? A 118 ? ? 1 1 A U 2 1_555 A A 118 1_555 0.145 -0.105 -1.337 1.891 -27.406 -9.662 2 A_U1:A117_A A 1 ? A 117 ? 20 1 1 A U 3 1_555 A A 117 1_555 -0.817 -0.194 0.537 -6.915 -6.142 -5.502 3 A_U2:A116_A A 2 ? A 116 ? 20 1 1 A C 4 1_555 A G 116 1_555 -0.043 -0.012 0.723 -3.212 -17.187 -2.629 4 A_C3:G115_A A 3 ? A 115 ? 19 1 1 A U 5 1_555 A A 115 1_555 -0.186 -0.104 0.499 -9.955 -24.716 0.911 5 A_U4:A114_A A 4 ? A 114 ? 20 1 1 A U 6 1_555 A A 114 1_555 -0.537 0.022 0.216 -3.351 -20.207 6.469 6 A_U5:A113_A A 5 ? A 113 ? 20 1 1 A A 7 1_555 A U 113 1_555 -0.113 -0.013 0.081 3.574 -7.136 -2.533 7 A_A6:U112_A A 6 ? A 112 ? 20 1 1 A U 8 1_555 A A 112 1_555 -0.687 -0.334 0.275 -4.446 -14.945 -9.048 8 A_U7:A111_A A 7 ? A 111 ? 20 1 1 A C 9 1_555 A G 111 1_555 -0.134 -0.297 0.617 -2.457 -4.679 0.250 9 A_C8:G110_A A 8 ? A 110 ? 19 1 1 A U 86 1_555 A A 110 1_555 -0.751 -0.131 0.250 -9.690 -10.312 -4.934 10 A_U85:A109_A A 85 ? A 109 ? 20 1 1 A G 36 1_555 A A 21 1_555 7.413 -3.342 0.088 21.137 14.733 10.511 11 A_G35:A20_A A 35 ? A 20 ? ? ? 1 A A 37 1_555 A G 20 1_555 -7.136 -4.831 -0.270 -24.763 9.018 -11.400 12 A_A36:G19_A A 36 ? A 19 ? ? ? 1 A A 38 1_555 A A 19 1_555 -6.689 -2.115 -0.232 1.606 -8.283 7.361 13 A_A37:A18_A A 37 ? A 18 ? ? ? 1 A G 39 1_555 A C 18 1_555 0.909 0.267 -0.090 -6.203 -14.924 6.243 14 A_G38:C17_A A 38 ? A 17 ? ? 1 1 A C 40 1_555 A G 17 1_555 0.973 -0.329 -0.056 0.458 -17.869 1.141 15 A_C39:G16_A A 39 ? A 16 ? 19 1 1 A U 41 1_555 A A 16 1_555 1.156 -0.012 1.199 -4.799 -3.307 -14.041 16 A_U40:A15_A A 40 ? A 15 ? ? ? 1 A C 43 1_555 A G 14 1_555 0.679 0.320 0.645 -17.826 1.897 10.809 17 A_C42:G13_A A 42 ? A 13 ? ? 1 1 A A 44 1_555 A U 82 1_555 -0.298 0.369 -0.178 -10.351 -12.475 2.396 18 A_A43:U81_A A 43 ? A 81 ? 20 1 1 A G 45 1_555 A C 81 1_555 -0.762 -0.176 -0.148 -14.411 -17.542 8.719 19 A_G44:C80_A A 44 ? A 80 ? 19 1 1 A C 46 1_555 A G 80 1_555 0.782 -0.172 0.129 -8.995 -18.835 7.588 20 A_C45:G79_A A 45 ? A 79 ? 19 1 1 A G 22 1_555 A C 32 1_555 0.167 -0.364 -0.610 -10.539 5.617 1.945 21 A_G21:C31_A A 21 ? A 31 ? 19 1 1 A G 23 1_555 A C 31 1_555 0.460 0.032 0.163 2.427 -5.287 -7.466 22 A_G22:C30_A A 22 ? A 30 ? 19 1 1 A G 24 1_555 A C 30 1_555 0.665 0.463 0.179 2.347 -7.282 7.508 23 A_G23:C29_A A 23 ? A 29 ? ? 1 1 A C 87 1_555 A G 29 1_555 0.244 0.236 -1.101 18.160 -27.403 -4.407 24 A_C86:G28_A A 86 ? A 28 ? ? 1 1 A C 88 1_555 A G 28 1_555 0.659 -0.584 0.517 -3.721 -8.387 -5.071 25 A_C87:G27_A A 87 ? A 27 ? 19 1 1 A A 89 1_555 A U 27 1_555 0.303 -0.628 0.930 2.790 -17.778 -6.281 26 A_A88:U26_A A 88 ? A 26 ? 20 1 1 A G 90 1_555 A C 26 1_555 0.788 0.702 0.170 -12.369 -33.923 6.292 27 A_G89:C25_A A 89 ? A 25 ? ? ? 1 A C 49 1_555 A G 78 1_555 -0.084 0.343 -0.740 18.350 -0.582 -1.679 28 A_C48:G77_A A 48 ? A 77 ? 19 1 1 A C 50 1_555 A G 77 1_555 -0.091 0.094 -0.343 -0.979 -8.622 9.418 29 A_C49:G76_A A 49 ? A 76 ? 19 1 1 A G 51 1_555 A C 74 1_555 0.307 -0.259 0.184 -8.500 -6.055 -9.993 30 A_G50:C73_A A 50 ? A 73 ? 19 1 1 A G 52 1_555 A C 73 1_555 0.668 0.176 -0.132 -1.625 -11.234 3.660 31 A_G51:C72_A A 51 ? A 72 ? 19 1 1 A U 53 1_555 A A 72 1_555 -1.324 -0.332 0.763 -1.366 -1.170 -5.822 32 A_U52:A71_A A 52 ? A 71 ? 20 1 1 A G 54 1_555 A G 71 1_555 3.068 1.377 -0.498 27.882 22.061 -41.442 33 A_G53:G70_A A 53 ? A 70 ? ? 1 1 A A 57 1_555 A U 70 1_555 0.711 0.005 0.209 -12.722 -3.371 -1.452 34 A_A56:U69_A A 56 ? A 69 ? 20 1 1 A U 58 1_555 A A 69 1_555 -0.202 0.103 -0.517 -1.800 -12.049 7.204 35 A_U57:A68_A A 57 ? A 68 ? 20 1 1 A G 59 1_555 A C 68 1_555 -0.902 -0.119 -0.326 -1.575 -5.760 13.151 36 A_G58:C67_A A 58 ? A 67 ? 19 1 1 A G 60 1_555 A C 67 1_555 0.633 0.089 -0.919 -24.571 -19.278 -5.679 37 A_G59:C66_A A 59 ? A 66 ? 19 1 1 A C 61 1_555 A G 66 1_555 -0.286 0.911 0.204 -12.062 -5.103 14.614 38 A_C60:G65_A A 60 ? A 65 ? ? ? 1 A G 62 1_555 A A 65 1_555 7.347 -5.578 1.276 11.202 -19.535 -21.655 39 A_G61:A64_A A 61 ? A 64 ? ? ? 1 A C 91 1_555 A G 107 1_555 0.253 -0.461 0.021 1.656 -26.441 3.978 40 A_C90:G106_A A 90 ? A 106 ? 19 1 1 A A 92 1_555 A U 106 1_555 1.060 -0.117 -0.099 -3.830 -9.173 3.321 41 A_A91:U105_A A 91 ? A 105 ? 20 1 1 A A 93 1_555 A U 105 1_555 -0.167 0.279 1.637 12.229 6.793 -2.258 42 A_A92:U104_A A 92 ? A 104 ? ? ? 1 A G 94 1_555 A C 104 1_555 0.920 0.182 0.199 1.628 -21.220 2.552 43 A_G93:C103_A A 93 ? A 103 ? 19 1 1 A C 95 1_555 A G 103 1_555 -0.441 -0.380 -0.070 7.989 -23.284 -1.096 44 A_C94:G102_A A 94 ? A 102 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 119 1_555 A U 2 1_555 A A 118 1_555 -0.215 -1.237 3.011 4.172 21.195 27.712 -4.611 0.860 1.638 37.816 -7.444 35.006 1 AA_G0U1:A117C118_AA A 0 ? A 118 ? A 1 ? A 117 ? 1 A U 2 1_555 A A 118 1_555 A U 3 1_555 A A 117 1_555 0.183 -1.200 3.621 -15.260 15.641 26.278 -4.569 -2.770 2.189 28.873 28.170 34.053 2 AA_U1U2:A116A117_AA A 1 ? A 117 ? A 2 ? A 116 ? 1 A U 3 1_555 A A 117 1_555 A C 4 1_555 A G 116 1_555 -0.553 -1.605 3.122 -3.886 3.790 38.107 -2.878 0.386 2.994 5.769 5.915 38.477 3 AA_U2C3:G115A116_AA A 2 ? A 116 ? A 3 ? A 115 ? 1 A C 4 1_555 A G 116 1_555 A U 5 1_555 A A 115 1_555 0.088 -1.419 3.284 2.778 8.093 27.882 -4.493 0.400 2.767 16.316 -5.599 29.141 4 AA_C3U4:A114G115_AA A 3 ? A 115 ? A 4 ? A 114 ? 1 A U 5 1_555 A A 115 1_555 A U 6 1_555 A A 114 1_555 0.544 -0.867 3.088 0.921 7.976 35.059 -2.451 -0.762 2.842 13.030 -1.505 35.939 5 AA_U4U5:A113A114_AA A 4 ? A 114 ? A 5 ? A 113 ? 1 A U 6 1_555 A A 114 1_555 A A 7 1_555 A U 113 1_555 -0.504 -1.270 3.095 -2.411 7.381 30.635 -3.577 0.519 2.752 13.695 4.473 31.581 6 AA_U5A6:U112A113_AA A 5 ? A 113 ? A 6 ? A 112 ? 1 A A 7 1_555 A U 113 1_555 A U 8 1_555 A A 112 1_555 -0.029 -1.535 3.608 -1.914 17.736 29.342 -5.353 -0.247 2.328 31.603 3.410 34.237 7 AA_A6U7:A111U112_AA A 6 ? A 112 ? A 7 ? A 111 ? 1 A U 8 1_555 A A 112 1_555 A C 9 1_555 A G 111 1_555 0.285 -1.432 3.270 -2.069 7.600 37.245 -3.121 -0.688 2.913 11.739 3.196 38.040 8 AA_U7C8:G110A111_AA A 7 ? A 111 ? A 8 ? A 110 ? 1 A C 9 1_555 A G 111 1_555 A U 86 1_555 A A 110 1_555 -1.067 -2.319 3.077 -3.816 8.774 34.155 -4.935 1.264 2.524 14.586 6.343 35.432 9 AA_C8U85:A109G110_AA A 8 ? A 110 ? A 85 ? A 109 ? 1 A G 36 1_555 A A 21 1_555 A A 37 1_555 A G 20 1_555 -0.793 -1.766 3.942 -0.390 7.759 -14.046 -1.235 -3.223 4.285 -29.008 -1.457 -16.042 10 AA_G35A36:G19A20_AA A 35 ? A 20 ? A 36 ? A 19 ? 1 A A 37 1_555 A G 20 1_555 A A 38 1_555 A A 19 1_555 0.159 -0.500 3.433 -12.338 2.315 34.758 -1.116 -1.988 3.159 3.728 19.869 36.890 11 AA_A36A37:A18G19_AA A 36 ? A 19 ? A 37 ? A 18 ? 1 A A 38 1_555 A A 19 1_555 A G 39 1_555 A C 18 1_555 -0.134 -0.265 3.704 -4.952 7.673 62.213 -0.644 -0.123 3.652 7.383 4.766 62.813 12 AA_A37G38:C17A18_AA A 37 ? A 18 ? A 38 ? A 17 ? 1 A G 39 1_555 A C 18 1_555 A C 40 1_555 A G 17 1_555 -0.472 -0.730 3.094 3.536 5.134 31.139 -2.203 1.460 2.871 9.445 -6.505 31.742 13 AA_G38C39:G16C17_AA A 38 ? A 17 ? A 39 ? A 16 ? 1 A C 40 1_555 A G 17 1_555 A U 41 1_555 A A 16 1_555 -0.265 -3.099 3.169 -6.633 9.893 34.443 -6.135 -0.362 2.235 16.122 10.809 36.385 14 AA_C39U40:A15G16_AA A 39 ? A 16 ? A 40 ? A 15 ? 1 A U 41 1_555 A A 16 1_555 A C 43 1_555 A G 14 1_555 1.486 -3.161 6.485 10.417 7.983 62.350 -3.687 -0.513 6.234 7.621 -9.944 63.580 15 AA_U40C42:G13A15_AA A 40 ? A 15 ? A 42 ? A 13 ? 1 A C 43 1_555 A G 14 1_555 A A 44 1_555 A U 82 1_555 0.204 -1.836 2.841 4.803 9.443 29.881 -4.744 0.327 2.180 17.630 -8.967 31.663 16 AA_C42A43:U81G13_AA A 42 ? A 13 ? A 43 ? A 81 ? 1 A A 44 1_555 A U 82 1_555 A G 45 1_555 A C 81 1_555 0.645 -1.926 3.352 -2.920 6.457 28.541 -5.114 -1.869 2.780 12.849 5.811 29.390 17 AA_A43G44:C80U81_AA A 43 ? A 81 ? A 44 ? A 80 ? 1 A G 45 1_555 A C 81 1_555 A C 46 1_555 A G 80 1_555 -0.454 -0.491 3.236 -0.852 -6.888 47.627 -0.061 0.490 3.280 -8.477 1.049 48.101 18 AA_G44C45:G79C80_AA A 44 ? A 80 ? A 45 ? A 79 ? 1 A G 22 1_555 A C 32 1_555 A G 23 1_555 A C 31 1_555 -0.316 -2.337 3.093 -0.073 -7.674 27.171 -2.927 0.631 3.606 -15.935 0.152 28.214 19 AA_G21G22:C30C31_AA A 21 ? A 31 ? A 22 ? A 30 ? 1 A G 23 1_555 A C 31 1_555 A G 24 1_555 A C 30 1_555 0.664 -2.016 3.514 3.583 -0.663 29.050 -3.833 -0.466 3.612 -1.316 -7.108 29.273 20 AA_G22G23:C29C30_AA A 22 ? A 30 ? A 23 ? A 29 ? 1 A G 24 1_555 A C 30 1_555 A C 87 1_555 A G 29 1_555 -3.182 -0.347 2.845 5.921 3.227 51.311 -0.576 3.973 2.464 3.708 -6.804 51.723 21 AA_G23C86:G28C29_AA A 23 ? A 29 ? A 86 ? A 28 ? 1 A C 87 1_555 A G 29 1_555 A C 88 1_555 A G 28 1_555 -0.720 -1.445 3.940 -9.391 12.375 36.048 -3.888 -0.239 3.364 18.951 14.382 39.151 22 AA_C86C87:G27G28_AA A 86 ? A 28 ? A 87 ? A 27 ? 1 A C 88 1_555 A G 28 1_555 A A 89 1_555 A U 27 1_555 0.075 -1.660 2.506 -1.465 11.648 33.992 -3.835 -0.266 1.851 19.227 2.419 35.906 23 AA_C87A88:U26G27_AA A 87 ? A 27 ? A 88 ? A 26 ? 1 A A 89 1_555 A U 27 1_555 A G 90 1_555 A C 26 1_555 0.487 -1.213 3.817 12.755 1.635 39.988 -1.898 0.896 3.744 2.320 -18.094 41.924 24 AA_A88G89:C25U26_AA A 88 ? A 26 ? A 89 ? A 25 ? 1 A C 49 1_555 A G 78 1_555 A C 50 1_555 A G 77 1_555 1.568 -2.205 3.630 -1.365 16.322 39.755 -4.610 -2.279 2.524 22.862 1.912 42.870 25 AA_C48C49:G76G77_AA A 48 ? A 77 ? A 49 ? A 76 ? 1 A C 50 1_555 A G 77 1_555 A G 51 1_555 A C 74 1_555 4.714 -2.282 4.926 -29.811 3.599 70.305 -1.996 -4.972 2.913 2.994 24.798 75.683 26 AA_C49G50:C73G76_AA A 49 ? A 76 ? A 50 ? A 73 ? 1 A G 51 1_555 A C 74 1_555 A G 52 1_555 A C 73 1_555 -0.268 -2.301 3.012 6.261 9.164 32.031 -5.163 1.288 2.199 16.018 -10.945 33.851 27 AA_G50G51:C72C73_AA A 50 ? A 73 ? A 51 ? A 72 ? 1 A G 52 1_555 A C 73 1_555 A U 53 1_555 A A 72 1_555 -0.131 -1.622 3.264 -6.805 8.070 21.451 -6.339 -1.724 2.431 20.182 17.019 23.880 28 AA_G51U52:A71C72_AA A 51 ? A 72 ? A 52 ? A 71 ? 1 A U 53 1_555 A A 72 1_555 A G 54 1_555 A G 71 1_555 1.105 -0.499 2.885 12.765 14.292 25.054 -3.401 0.176 2.527 28.260 -25.241 31.448 29 AA_U52G53:G70A71_AA A 52 ? A 71 ? A 53 ? A 70 ? 1 A A 57 1_555 A U 70 1_555 A U 58 1_555 A A 69 1_555 0.529 -1.649 3.148 9.063 11.572 22.479 -6.187 0.919 2.121 26.369 -20.653 26.806 30 AA_A56U57:A68U69_AA A 56 ? A 69 ? A 57 ? A 68 ? 1 A U 58 1_555 A A 69 1_555 A G 59 1_555 A C 68 1_555 0.553 -1.278 3.405 -5.929 9.129 28.841 -4.135 -2.163 2.720 17.559 11.403 30.786 31 AA_U57G58:C67A68_AA A 57 ? A 68 ? A 58 ? A 67 ? 1 A G 59 1_555 A C 68 1_555 A G 60 1_555 A C 67 1_555 -0.949 -2.109 3.829 -0.091 13.764 37.917 -4.726 1.368 2.923 20.381 0.134 40.252 32 AA_G58G59:C66C67_AA A 58 ? A 67 ? A 59 ? A 66 ? 1 A G 60 1_555 A C 67 1_555 A C 61 1_555 A G 66 1_555 0.416 -1.223 3.117 -6.912 -7.130 25.127 -0.822 -2.633 3.118 -15.633 15.154 26.989 33 AA_G59C60:G65C66_AA A 59 ? A 66 ? A 60 ? A 65 ? 1 A C 61 1_555 A G 66 1_555 A G 62 1_555 A A 65 1_555 -2.708 -1.003 2.633 -3.709 11.390 55.043 -1.583 2.704 2.559 12.163 3.961 56.232 34 AA_C60G61:A64G65_AA A 60 ? A 65 ? A 61 ? A 64 ? 1 A C 91 1_555 A G 107 1_555 A A 92 1_555 A U 106 1_555 -0.235 -1.303 3.541 2.335 4.335 28.723 -3.586 1.003 3.284 8.658 -4.663 29.133 35 AA_C90A91:U105G106_AA A 90 ? A 106 ? A 91 ? A 105 ? 1 A A 92 1_555 A U 106 1_555 A A 93 1_555 A U 105 1_555 -0.127 -2.310 2.645 -11.092 -1.076 27.841 -4.286 -1.660 2.591 -2.132 21.970 29.947 36 AA_A91A92:U104U105_AA A 91 ? A 105 ? A 92 ? A 104 ? 1 A A 93 1_555 A U 105 1_555 A G 94 1_555 A C 104 1_555 0.340 -2.174 3.511 14.305 4.864 37.315 -3.751 1.226 3.135 7.249 -21.319 40.156 37 AA_A92G93:C103U104_AA A 92 ? A 104 ? A 93 ? A 103 ? 1 A G 94 1_555 A C 104 1_555 A C 95 1_555 A G 103 1_555 -1.049 -1.163 2.872 -2.076 11.416 23.193 -5.165 1.872 2.153 26.382 4.798 25.898 38 AA_G93C94:G102C103_AA A 93 ? A 103 ? A 94 ? A 102 ? # _atom_sites.entry_id 4KQY _atom_sites.fract_transf_matrix[1][1] 0.017026 _atom_sites.fract_transf_matrix[1][2] 0.009830 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] -0.000000 _atom_sites.fract_transf_matrix[2][2] 0.019661 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] -0.000000 _atom_sites.fract_transf_matrix[3][3] 0.004900 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C MG N O P S # loop_ #