data_4L81 # _entry.id 4L81 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.379 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 4L81 pdb_00004l81 10.2210/pdb4l81/pdb NDB NA2556 ? ? RCSB RCSB080297 ? ? WWPDB D_1000080297 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 4L81 _pdbx_database_status.recvd_initial_deposition_date 2013-06-15 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Trausch, J.J.' 1 'Reyes, F.E.' 2 'Edwards, A.L.' 3 'Batey, R.T.' 4 # _citation.id primary _citation.title 'Structural basis for diversity in the SAM clan of riboswitches.' _citation.journal_abbrev Proc.Natl.Acad.Sci.USA _citation.journal_volume 111 _citation.page_first 6624 _citation.page_last 6629 _citation.year 2014 _citation.journal_id_ASTM PNASA6 _citation.country US _citation.journal_id_ISSN 0027-8424 _citation.journal_id_CSD 0040 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 24753586 _citation.pdbx_database_id_DOI 10.1073/pnas.1312918111 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Trausch, J.J.' 1 ? primary 'Xu, Z.' 2 ? primary 'Edwards, A.L.' 3 ? primary 'Reyes, F.E.' 4 ? primary 'Ross, P.E.' 5 ? primary 'Knight, R.' 6 ? primary 'Batey, R.T.' 7 ? # _cell.entry_id 4L81 _cell.length_a 120.930 _cell.length_b 120.930 _cell.length_c 186.560 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 12 _cell.pdbx_unique_axis ? _cell.length_a_esd ? _cell.length_b_esd ? _cell.length_c_esd ? _cell.angle_alpha_esd ? _cell.angle_beta_esd ? _cell.angle_gamma_esd ? # _symmetry.entry_id 4L81 _symmetry.space_group_name_H-M 'P 64 2 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 181 _symmetry.space_group_name_Hall ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'SAM-I/IV variant riboswitch aptamer domain' 31253.779 1 ? ? 'aptamer domain' ? 2 non-polymer syn S-ADENOSYLMETHIONINE 398.437 1 ? ? ? ? 3 non-polymer syn 'COBALT HEXAMMINE(III)' 161.116 9 ? ? ? ? 4 non-polymer syn 'MAGNESIUM ION' 24.305 6 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGAUCACGAGGGGGAGACCCCGGCAACCUGGGACGGACACCCAAGGUGCUCACACCGGAGACGGUGGAUCCGGCCCGAGA GGGCAACGAAGUCCGU ; _entity_poly.pdbx_seq_one_letter_code_can ;GGAUCACGAGGGGGAGACCCCGGCAACCUGGGACGGACACCCAAGGUGCUCACACCGGAGACGGUGGAUCCGGCCCGAGA GGGCAACGAAGUCCGU ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 U n 1 5 C n 1 6 A n 1 7 C n 1 8 G n 1 9 A n 1 10 G n 1 11 G n 1 12 G n 1 13 G n 1 14 G n 1 15 A n 1 16 G n 1 17 A n 1 18 C n 1 19 C n 1 20 C n 1 21 C n 1 22 G n 1 23 G n 1 24 C n 1 25 A n 1 26 A n 1 27 C n 1 28 C n 1 29 U n 1 30 G n 1 31 G n 1 32 G n 1 33 A n 1 34 C n 1 35 G n 1 36 G n 1 37 A n 1 38 C n 1 39 A n 1 40 C n 1 41 C n 1 42 C n 1 43 A n 1 44 A n 1 45 G n 1 46 G n 1 47 U n 1 48 G n 1 49 C n 1 50 U n 1 51 C n 1 52 A n 1 53 C n 1 54 A n 1 55 C n 1 56 C n 1 57 G n 1 58 G n 1 59 A n 1 60 G n 1 61 A n 1 62 C n 1 63 G n 1 64 G n 1 65 U n 1 66 G n 1 67 G n 1 68 A n 1 69 U n 1 70 C n 1 71 C n 1 72 G n 1 73 G n 1 74 C n 1 75 C n 1 76 C n 1 77 G n 1 78 A n 1 79 G n 1 80 A n 1 81 G n 1 82 G n 1 83 G n 1 84 C n 1 85 A n 1 86 A n 1 87 C n 1 88 G n 1 89 A n 1 90 A n 1 91 G n 1 92 U n 1 93 C n 1 94 C n 1 95 G n 1 96 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'in vitro T7 RNA polymerase transcript' # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 4L81 _struct_ref.pdbx_db_accession 4L81 _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ;GGAUCACGAGGGGGAGACCCCGGCAACCUGGGACGGACACCCAAGGUGCUCACACCGGAGACGGUGGAUCCGGCCCGAGA GGGCAACGAAGUCCGU ; _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 4L81 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 96 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 4L81 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 96 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 96 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 NCO non-polymer . 'COBALT HEXAMMINE(III)' ? 'Co H18 N6 3' 161.116 SAM non-polymer . S-ADENOSYLMETHIONINE ? 'C15 H22 N6 O5 S' 398.437 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.entry_id 4L81 _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 303 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 8 _exptl_crystal_grow.pdbx_details ;50 mM Na-cacodylate, pH 8.0, 40 mM magnesium acetate, 300 mM KCl, 7% 2-methyl-2,4-pentanediol (MPD), 1 mM cobalt hexammine, VAPOR DIFFUSION, HANGING DROP, temperature 303K ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.id 1 _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 315' _diffrn_detector.pdbx_collection_date 2011-10-11 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator 'Double crystal, Si(111)' _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.00 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'ALS BEAMLINE 8.2.2' _diffrn_source.pdbx_synchrotron_site ALS _diffrn_source.pdbx_synchrotron_beamline 8.2.2 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 1.00 # _reflns.entry_id 4L81 _reflns.observed_criterion_sigma_I 2.0 _reflns.observed_criterion_sigma_F 2.0 _reflns.d_resolution_low 30 _reflns.d_resolution_high 2.95 _reflns.number_obs 31972 _reflns.number_all 32036 _reflns.percent_possible_obs 99.8 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy ? _reflns.R_free_details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_ordinal 1 _reflns.pdbx_diffrn_id 1 # _reflns_shell.d_res_high 2.95 _reflns_shell.d_res_low 3.06 _reflns_shell.percent_possible_all 99.8 _reflns_shell.Rmerge_I_obs 0.665 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.meanI_over_sigI_obs 2.0 _reflns_shell.pdbx_redundancy 7.52 _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 # _refine.entry_id 4L81 _refine.ls_number_reflns_obs 31286 _refine.ls_number_reflns_all 32113 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.0 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 30 _refine.ls_d_res_high 2.95 _refine.ls_percent_reflns_obs ? _refine.ls_R_factor_obs 0.219 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.219 _refine.ls_R_factor_R_free 0.232 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free 3095 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.details ? _refine.pdbx_starting_model 'PDB ENTRY 2GIS' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values 'Engh & Huber' _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.ls_redundancy_reflns_obs ? _refine.B_iso_min ? _refine.B_iso_max ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_diffrn_id 1 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_analyze.entry_id 4L81 _refine_analyze.Luzzati_coordinate_error_obs 0.41 _refine_analyze.Luzzati_sigma_a_obs 0.63 _refine_analyze.Luzzati_d_res_low_obs ? _refine_analyze.Luzzati_coordinate_error_free ? _refine_analyze.Luzzati_sigma_a_free ? _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.pdbx_Luzzati_d_res_high_obs ? _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 2075 _refine_hist.pdbx_number_atoms_ligand 96 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 2171 _refine_hist.d_res_high 2.95 _refine_hist.d_res_low 30 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_restraint_function _refine_ls_restr.pdbx_refine_id c_bond_d 0.00709 ? ? ? ? 'X-RAY DIFFRACTION' c_angle_deg 1.19 ? ? ? ? 'X-RAY DIFFRACTION' c_dihedral_angle_d 14.7 ? ? ? ? 'X-RAY DIFFRACTION' c_improper_angle_d 1.722 ? ? ? ? 'X-RAY DIFFRACTION' # _struct.entry_id 4L81 _struct.title 'Structure of the SAM-I/IV riboswitch (env87(deltaU92, deltaG93))' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 4L81 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'Riboswitch, Gene regulation, SAM binding, RNA' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 3 ? J N N 3 ? K N N 3 ? L N N 4 ? M N N 4 ? N N N 4 ? O N N 4 ? P N N 4 ? Q N N 4 ? # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A G 1 OP3 ? ? ? 1_555 O MG . MG ? ? A G 1 A MG 114 1_555 ? ? ? ? ? ? ? 2.536 ? ? metalc2 metalc ? ? A G 30 "O2'" ? ? ? 1_555 N MG . MG ? ? A G 30 A MG 113 1_555 ? ? ? ? ? ? ? 2.439 ? ? metalc3 metalc ? ? A G 31 O6 ? ? ? 1_555 M MG . MG ? ? A G 31 A MG 112 1_555 ? ? ? ? ? ? ? 2.801 ? ? metalc4 metalc ? ? A G 58 "O2'" ? ? ? 1_555 P MG . MG ? ? A G 58 A MG 115 1_555 ? ? ? ? ? ? ? 2.630 ? ? metalc5 metalc ? ? A G 73 O6 ? ? ? 1_555 Q MG . MG ? ? A G 73 A MG 116 1_555 ? ? ? ? ? ? ? 2.836 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 71 N3 ? ? A G 1 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 71 O2 ? ? A G 1 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 71 N4 ? ? A G 1 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 70 N3 ? ? A G 2 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 70 O2 ? ? A G 2 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 70 N4 ? ? A G 2 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 69 N3 ? ? A A 3 A U 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 69 O4 ? ? A A 3 A U 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 68 N1 ? ? A U 4 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 68 N6 ? ? A U 4 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 67 N1 ? ? A C 5 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 67 O6 ? ? A C 5 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 67 N2 ? ? A C 5 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 8 A C 24 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog15 hydrog ? ? A A 9 N3 ? ? ? 1_555 A G 23 N2 ? ? A A 9 A G 23 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog16 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 10 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 10 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 10 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 12 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 12 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 12 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 18 O2 ? ? A G 13 A C 18 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog26 hydrog ? ? A G 14 N2 ? ? ? 1_555 A A 17 N7 ? ? A G 14 A A 17 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog27 hydrog ? ? A G 22 N1 ? ? ? 1_555 A U 50 O2 ? ? A G 22 A U 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog28 hydrog ? ? A G 22 O6 ? ? ? 1_555 A U 50 N3 ? ? A G 22 A U 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog29 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 23 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 23 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 23 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 48 N1 ? ? A C 24 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 48 O6 ? ? A C 24 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 48 N2 ? ? A C 24 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A A 26 N3 ? ? ? 1_555 A C 27 N4 ? ? A A 26 A C 27 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog36 hydrog ? ? A C 27 N3 ? ? ? 1_555 A G 46 N1 ? ? A C 27 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 27 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 27 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 27 O2 ? ? ? 1_555 A G 46 N2 ? ? A C 27 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 45 N1 ? ? A C 28 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 45 O6 ? ? A C 28 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 45 N2 ? ? A C 28 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A U 29 N3 ? ? ? 1_555 A A 44 N1 ? ? A U 29 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A U 29 O4 ? ? ? 1_555 A A 44 N6 ? ? A U 29 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 30 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 30 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 30 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 31 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 31 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 31 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 31 N2 ? ? ? 1_555 A A 90 N3 ? ? A G 31 A A 90 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog51 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 32 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 32 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 32 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A A 33 N6 ? ? ? 1_555 A U 96 O4 ? ? A A 33 A U 96 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog55 hydrog ? ? A C 34 N3 ? ? ? 1_555 A G 95 N1 ? ? A C 34 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 34 N4 ? ? ? 1_555 A G 95 O6 ? ? A C 34 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 34 O2 ? ? ? 1_555 A G 95 N2 ? ? A C 34 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 35 N1 ? ? ? 1_555 A C 94 N3 ? ? A G 35 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 35 N2 ? ? ? 1_555 A C 94 O2 ? ? A G 35 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 35 O6 ? ? ? 1_555 A C 94 N4 ? ? A G 35 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 36 N1 ? ? ? 1_555 A C 93 N3 ? ? A G 36 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 36 N2 ? ? ? 1_555 A C 93 O2 ? ? A G 36 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 36 O6 ? ? ? 1_555 A C 93 N4 ? ? A G 36 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A A 37 N1 ? ? ? 1_555 A U 92 N3 ? ? A A 37 A U 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A A 37 N6 ? ? ? 1_555 A U 92 O4 ? ? A A 37 A U 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A C 42 O2 ? ? ? 1_555 A C 87 N4 ? ? A C 42 A C 87 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog67 hydrog ? ? A A 43 N3 ? ? ? 1_555 A A 44 N6 ? ? A A 43 A A 44 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog68 hydrog ? ? A G 45 N2 ? ? ? 1_555 A G 72 N3 ? ? A G 45 A G 72 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog69 hydrog ? ? A G 45 N3 ? ? ? 1_555 A G 72 N2 ? ? A G 45 A G 72 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog70 hydrog ? ? A C 53 N3 ? ? ? 1_555 A G 66 N1 ? ? A C 53 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A C 53 N4 ? ? ? 1_555 A G 66 O6 ? ? A C 53 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 53 O2 ? ? ? 1_555 A G 66 N2 ? ? A C 53 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A A 54 N1 ? ? ? 1_555 A U 65 N3 ? ? A A 54 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A A 54 N6 ? ? ? 1_555 A U 65 O4 ? ? A A 54 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 55 N3 ? ? ? 1_555 A G 64 N1 ? ? A C 55 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A C 55 N4 ? ? ? 1_555 A G 64 O6 ? ? A C 55 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A C 55 O2 ? ? ? 1_555 A G 64 N2 ? ? A C 55 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A C 56 N3 ? ? ? 1_555 A G 63 N1 ? ? A C 56 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 56 N4 ? ? ? 1_555 A G 63 O6 ? ? A C 56 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A C 56 O2 ? ? ? 1_555 A G 63 N2 ? ? A C 56 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A G 57 N1 ? ? ? 1_555 A C 62 N3 ? ? A G 57 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 57 N2 ? ? ? 1_555 A C 62 O2 ? ? A G 57 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 57 O6 ? ? ? 1_555 A C 62 N4 ? ? A G 57 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 58 N2 ? ? ? 1_555 A A 61 N7 ? ? A G 58 A A 61 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog85 hydrog ? ? A G 72 N1 ? ? ? 1_555 A A 85 N1 ? ? A G 72 A A 85 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog86 hydrog ? ? A G 72 O6 ? ? ? 1_555 A A 85 N6 ? ? A G 72 A A 85 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog87 hydrog ? ? A G 73 N1 ? ? ? 1_555 A C 84 N3 ? ? A G 73 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 73 N2 ? ? ? 1_555 A C 84 O2 ? ? A G 73 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A G 73 O6 ? ? ? 1_555 A C 84 N4 ? ? A G 73 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 74 N3 ? ? ? 1_555 A G 83 N1 ? ? A C 74 A G 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 74 N4 ? ? ? 1_555 A G 83 O6 ? ? A C 74 A G 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A C 74 O2 ? ? ? 1_555 A G 83 N2 ? ? A C 74 A G 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A C 75 N3 ? ? ? 1_555 A G 82 N1 ? ? A C 75 A G 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A C 75 N4 ? ? ? 1_555 A G 82 O6 ? ? A C 75 A G 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A C 75 O2 ? ? ? 1_555 A G 82 N2 ? ? A C 75 A G 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 76 N3 ? ? ? 1_555 A G 81 N1 ? ? A C 76 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 76 N4 ? ? ? 1_555 A G 81 O6 ? ? A C 76 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 76 O2 ? ? ? 1_555 A G 81 N2 ? ? A C 76 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A G 77 N2 ? ? ? 1_555 A A 80 N7 ? ? A G 77 A A 80 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A SAM 101 ? 11 'BINDING SITE FOR RESIDUE SAM A 101' AC2 Software A NCO 102 ? 7 'BINDING SITE FOR RESIDUE NCO A 102' AC3 Software A NCO 103 ? 6 'BINDING SITE FOR RESIDUE NCO A 103' AC4 Software A NCO 104 ? 3 'BINDING SITE FOR RESIDUE NCO A 104' AC5 Software A NCO 105 ? 2 'BINDING SITE FOR RESIDUE NCO A 105' AC6 Software A NCO 106 ? 2 'BINDING SITE FOR RESIDUE NCO A 106' AC7 Software A NCO 107 ? 7 'BINDING SITE FOR RESIDUE NCO A 107' AC8 Software A NCO 108 ? 5 'BINDING SITE FOR RESIDUE NCO A 108' AC9 Software A NCO 109 ? 3 'BINDING SITE FOR RESIDUE NCO A 109' BC1 Software A NCO 110 ? 3 'BINDING SITE FOR RESIDUE NCO A 110' BC2 Software A MG 111 ? 2 'BINDING SITE FOR RESIDUE MG A 111' BC3 Software A MG 112 ? 3 'BINDING SITE FOR RESIDUE MG A 112' BC4 Software A MG 113 ? 3 'BINDING SITE FOR RESIDUE MG A 113' BC5 Software A MG 114 ? 1 'BINDING SITE FOR RESIDUE MG A 114' BC6 Software A MG 115 ? 3 'BINDING SITE FOR RESIDUE MG A 115' BC7 Software A MG 116 ? 2 'BINDING SITE FOR RESIDUE MG A 116' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 11 A A 3 ? A A 3 . ? 1_555 ? 2 AC1 11 U A 4 ? U A 4 . ? 1_555 ? 3 AC1 11 C A 5 ? C A 5 . ? 1_555 ? 4 AC1 11 G A 8 ? G A 8 . ? 1_555 ? 5 AC1 11 A A 25 ? A A 25 . ? 1_555 ? 6 AC1 11 C A 27 ? C A 27 . ? 1_555 ? 7 AC1 11 U A 47 ? U A 47 . ? 1_555 ? 8 AC1 11 G A 48 ? G A 48 . ? 1_555 ? 9 AC1 11 C A 49 ? C A 49 . ? 1_555 ? 10 AC1 11 U A 69 ? U A 69 . ? 1_555 ? 11 AC1 11 C A 70 ? C A 70 . ? 1_555 ? 12 AC2 7 G A 32 ? G A 32 . ? 4_545 ? 13 AC2 7 A A 33 ? A A 33 . ? 4_545 ? 14 AC2 7 G A 88 ? G A 88 . ? 1_555 ? 15 AC2 7 A A 89 ? A A 89 . ? 1_555 ? 16 AC2 7 A A 90 ? A A 90 . ? 1_555 ? 17 AC2 7 G A 91 ? G A 91 . ? 4_545 ? 18 AC2 7 G A 91 ? G A 91 . ? 1_555 ? 19 AC3 6 A A 25 ? A A 25 . ? 1_555 ? 20 AC3 6 A A 26 ? A A 26 . ? 1_555 ? 21 AC3 6 A A 43 ? A A 43 . ? 1_555 ? 22 AC3 6 A A 44 ? A A 44 . ? 1_555 ? 23 AC3 6 G A 45 ? G A 45 . ? 1_555 ? 24 AC3 6 G A 46 ? G A 46 . ? 1_555 ? 25 AC4 3 G A 57 ? G A 57 . ? 1_555 ? 26 AC4 3 G A 58 ? G A 58 . ? 1_555 ? 27 AC4 3 G A 60 ? G A 60 . ? 1_555 ? 28 AC5 2 U A 50 ? U A 50 . ? 1_555 ? 29 AC5 2 C A 53 ? C A 53 . ? 1_555 ? 30 AC6 2 G A 82 ? G A 82 . ? 1_555 ? 31 AC6 2 G A 83 ? G A 83 . ? 1_555 ? 32 AC7 7 C A 28 ? C A 28 . ? 1_555 ? 33 AC7 7 U A 29 ? U A 29 . ? 1_555 ? 34 AC7 7 G A 30 ? G A 30 . ? 1_555 ? 35 AC7 7 G A 31 ? G A 31 . ? 1_555 ? 36 AC7 7 C A 41 ? C A 41 . ? 1_555 ? 37 AC7 7 C A 42 ? C A 42 . ? 1_555 ? 38 AC7 7 MG M . ? MG A 112 . ? 1_555 ? 39 AC8 5 C A 21 ? C A 21 . ? 1_555 ? 40 AC8 5 G A 22 ? G A 22 . ? 1_555 ? 41 AC8 5 G A 23 ? G A 23 . ? 1_555 ? 42 AC8 5 C A 49 ? C A 49 . ? 1_555 ? 43 AC8 5 U A 50 ? U A 50 . ? 1_555 ? 44 AC9 3 C A 76 ? C A 76 . ? 1_555 ? 45 AC9 3 G A 77 ? G A 77 . ? 1_555 ? 46 AC9 3 G A 79 ? G A 79 . ? 1_555 ? 47 BC1 3 A A 26 ? A A 26 . ? 1_555 ? 48 BC1 3 C A 42 ? C A 42 . ? 1_555 ? 49 BC1 3 A A 43 ? A A 43 . ? 1_555 ? 50 BC2 2 G A 91 ? G A 91 . ? 4_545 ? 51 BC2 2 G A 91 ? G A 91 . ? 1_555 ? 52 BC3 3 G A 30 ? G A 30 . ? 1_555 ? 53 BC3 3 G A 31 ? G A 31 . ? 1_555 ? 54 BC3 3 NCO H . ? NCO A 107 . ? 1_555 ? 55 BC4 3 G A 30 ? G A 30 . ? 1_555 ? 56 BC4 3 A A 44 ? A A 44 . ? 1_555 ? 57 BC4 3 C A 87 ? C A 87 . ? 1_555 ? 58 BC5 1 G A 1 ? G A 1 . ? 1_555 ? 59 BC6 3 G A 58 ? G A 58 . ? 1_555 ? 60 BC6 3 A A 59 ? A A 59 . ? 1_555 ? 61 BC6 3 G A 60 ? G A 60 . ? 1_555 ? 62 BC7 2 G A 72 ? G A 72 . ? 1_555 ? 63 BC7 2 G A 73 ? G A 73 . ? 1_555 ? # _database_PDB_matrix.entry_id 4L81 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _atom_sites.entry_id 4L81 _atom_sites.fract_transf_matrix[1][1] 0.008269 _atom_sites.fract_transf_matrix[1][2] 0.004774 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.009549 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.005360 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C CO MG N O P S # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 U 4 4 4 U U A . n A 1 5 C 5 5 5 C C A . n A 1 6 A 6 6 6 A A A . n A 1 7 C 7 7 7 C C A . n A 1 8 G 8 8 8 G G A . n A 1 9 A 9 9 9 A A A . n A 1 10 G 10 10 10 G G A . n A 1 11 G 11 11 11 G G A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 C 18 18 18 C C A . n A 1 19 C 19 19 19 C C A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n A 1 22 G 22 22 22 G G A . n A 1 23 G 23 23 23 G G A . n A 1 24 C 24 24 24 C C A . n A 1 25 A 25 25 25 A A A . n A 1 26 A 26 26 26 A A A . n A 1 27 C 27 27 27 C C A . n A 1 28 C 28 28 28 C C A . n A 1 29 U 29 29 29 U U A . n A 1 30 G 30 30 30 G G A . n A 1 31 G 31 31 31 G G A . n A 1 32 G 32 32 32 G G A . n A 1 33 A 33 33 33 A A A . n A 1 34 C 34 34 34 C C A . n A 1 35 G 35 35 35 G G A . n A 1 36 G 36 36 36 G G A . n A 1 37 A 37 37 37 A A A . n A 1 38 C 38 38 38 C C A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 C 41 41 41 C C A . n A 1 42 C 42 42 42 C C A . n A 1 43 A 43 43 43 A A A . n A 1 44 A 44 44 44 A A A . n A 1 45 G 45 45 45 G G A . n A 1 46 G 46 46 46 G G A . n A 1 47 U 47 47 47 U U A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 U 50 50 50 U U A . n A 1 51 C 51 51 51 C C A . n A 1 52 A 52 52 52 A A A . n A 1 53 C 53 53 53 C C A . n A 1 54 A 54 54 54 A A A . n A 1 55 C 55 55 55 C C A . n A 1 56 C 56 56 56 C C A . n A 1 57 G 57 57 57 G G A . n A 1 58 G 58 58 58 G G A . n A 1 59 A 59 59 59 A A A . n A 1 60 G 60 60 60 G G A . n A 1 61 A 61 61 61 A A A . n A 1 62 C 62 62 62 C C A . n A 1 63 G 63 63 63 G G A . n A 1 64 G 64 64 64 G G A . n A 1 65 U 65 65 65 U U A . n A 1 66 G 66 66 66 G G A . n A 1 67 G 67 67 67 G G A . n A 1 68 A 68 68 68 A A A . n A 1 69 U 69 69 69 U U A . n A 1 70 C 70 70 70 C C A . n A 1 71 C 71 71 71 C C A . n A 1 72 G 72 72 72 G G A . n A 1 73 G 73 73 73 G G A . n A 1 74 C 74 74 74 C C A . n A 1 75 C 75 75 75 C C A . n A 1 76 C 76 76 76 C C A . n A 1 77 G 77 77 77 G G A . n A 1 78 A 78 78 78 A A A . n A 1 79 G 79 79 79 G G A . n A 1 80 A 80 80 80 A A A . n A 1 81 G 81 81 81 G G A . n A 1 82 G 82 82 82 G G A . n A 1 83 G 83 83 83 G G A . n A 1 84 C 84 84 84 C C A . n A 1 85 A 85 85 85 A A A . n A 1 86 A 86 86 86 A A A . n A 1 87 C 87 87 87 C C A . n A 1 88 G 88 88 88 G G A . n A 1 89 A 89 89 89 A A A . n A 1 90 A 90 90 90 A A A . n A 1 91 G 91 91 91 G G A . n A 1 92 U 92 92 92 U U A . n A 1 93 C 93 93 93 C C A . n A 1 94 C 94 94 94 C C A . n A 1 95 G 95 95 95 G G A . n A 1 96 U 96 96 96 U U A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 SAM 1 101 101 SAM SAM A . C 3 NCO 1 102 201 NCO NCO A . D 3 NCO 1 103 202 NCO NCO A . E 3 NCO 1 104 203 NCO NCO A . F 3 NCO 1 105 204 NCO NCO A . G 3 NCO 1 106 205 NCO NCO A . H 3 NCO 1 107 206 NCO NCO A . I 3 NCO 1 108 207 NCO NCO A . J 3 NCO 1 109 208 NCO NCO A . K 3 NCO 1 110 210 NCO NCO A . L 4 MG 1 111 301 MG MG A . M 4 MG 1 112 302 MG MG A . N 4 MG 1 113 303 MG MG A . O 4 MG 1 114 304 MG MG A . P 4 MG 1 115 305 MG MG A . Q 4 MG 1 116 306 MG MG A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2014-05-28 2 'Structure model' 1 1 2023-09-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 2 'Structure model' 'Derived calculations' 4 2 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' database_2 4 2 'Structure model' pdbx_initial_refinement_model 5 2 'Structure model' struct_conn 6 2 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' 3 2 'Structure model' '_struct_conn.pdbx_dist_value' 4 2 'Structure model' '_struct_conn.ptnr1_auth_seq_id' 5 2 'Structure model' '_struct_conn.ptnr1_label_atom_id' 6 2 'Structure model' '_struct_conn.ptnr1_label_seq_id' 7 2 'Structure model' '_struct_conn.ptnr2_auth_seq_id' 8 2 'Structure model' '_struct_conn.ptnr2_label_asym_id' 9 2 'Structure model' '_struct_site.pdbx_auth_asym_id' 10 2 'Structure model' '_struct_site.pdbx_auth_comp_id' 11 2 'Structure model' '_struct_site.pdbx_auth_seq_id' # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal HKL-2000 'data collection' . ? 1 CNS refinement . ? 2 CrystalClear 'data reduction' . ? 3 CrystalClear 'data scaling' . ? 4 CNS phasing . ? 5 # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 OP2 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 A _pdbx_validate_close_contact.auth_seq_id_1 89 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 N6 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 NCO _pdbx_validate_close_contact.auth_seq_id_2 102 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 2.19 # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 1 _pdbx_validate_rmsd_bond.auth_atom_id_1 P _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 G _pdbx_validate_rmsd_bond.auth_seq_id_1 1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 OP3 _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 G _pdbx_validate_rmsd_bond.auth_seq_id_2 1 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.528 _pdbx_validate_rmsd_bond.bond_target_value 1.607 _pdbx_validate_rmsd_bond.bond_deviation -0.079 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.012 _pdbx_validate_rmsd_bond.linker_flag N # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 N9 _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 G _pdbx_validate_rmsd_angle.auth_seq_id_1 91 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 G _pdbx_validate_rmsd_angle.auth_seq_id_2 91 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 "C2'" _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 G _pdbx_validate_rmsd_angle.auth_seq_id_3 91 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 121.99 _pdbx_validate_rmsd_angle.angle_target_value 114.00 _pdbx_validate_rmsd_angle.angle_deviation 7.99 _pdbx_validate_rmsd_angle.angle_standard_deviation 1.30 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 G A 32 ? ? 0.064 'SIDE CHAIN' 2 1 U A 47 ? ? 0.087 'SIDE CHAIN' 3 1 G A 88 ? ? 0.056 'SIDE CHAIN' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 MG MG MG N N 111 NCO CO CO N N 112 NCO N1 N N N 113 NCO N2 N N N 114 NCO N3 N N N 115 NCO N4 N N N 116 NCO N5 N N N 117 NCO N6 N N N 118 NCO HN11 H N N 119 NCO HN12 H N N 120 NCO HN13 H N N 121 NCO HN21 H N N 122 NCO HN22 H N N 123 NCO HN23 H N N 124 NCO HN31 H N N 125 NCO HN32 H N N 126 NCO HN33 H N N 127 NCO HN41 H N N 128 NCO HN42 H N N 129 NCO HN43 H N N 130 NCO HN51 H N N 131 NCO HN52 H N N 132 NCO HN53 H N N 133 NCO HN61 H N N 134 NCO HN62 H N N 135 NCO HN63 H N N 136 SAM N N N N 137 SAM CA C N S 138 SAM C C N N 139 SAM O O N N 140 SAM OXT O N N 141 SAM CB C N N 142 SAM CG C N N 143 SAM SD S N S 144 SAM CE C N N 145 SAM "C5'" C N N 146 SAM "C4'" C N S 147 SAM "O4'" O N N 148 SAM "C3'" C N S 149 SAM "O3'" O N N 150 SAM "C2'" C N R 151 SAM "O2'" O N N 152 SAM "C1'" C N R 153 SAM N9 N Y N 154 SAM C8 C Y N 155 SAM N7 N Y N 156 SAM C5 C Y N 157 SAM C6 C Y N 158 SAM N6 N N N 159 SAM N1 N Y N 160 SAM C2 C Y N 161 SAM N3 N Y N 162 SAM C4 C Y N 163 SAM HN1 H N N 164 SAM HN2 H N N 165 SAM HA H N N 166 SAM HB1 H N N 167 SAM HB2 H N N 168 SAM HG1 H N N 169 SAM HG2 H N N 170 SAM HE1 H N N 171 SAM HE2 H N N 172 SAM HE3 H N N 173 SAM "H5'1" H N N 174 SAM "H5'2" H N N 175 SAM "H4'" H N N 176 SAM "H3'" H N N 177 SAM "HO3'" H N N 178 SAM "H2'" H N N 179 SAM "HO2'" H N N 180 SAM "H1'" H N N 181 SAM H8 H N N 182 SAM HN61 H N N 183 SAM HN62 H N N 184 SAM H2 H N N 185 U OP3 O N N 186 U P P N N 187 U OP1 O N N 188 U OP2 O N N 189 U "O5'" O N N 190 U "C5'" C N N 191 U "C4'" C N R 192 U "O4'" O N N 193 U "C3'" C N S 194 U "O3'" O N N 195 U "C2'" C N R 196 U "O2'" O N N 197 U "C1'" C N R 198 U N1 N N N 199 U C2 C N N 200 U O2 O N N 201 U N3 N N N 202 U C4 C N N 203 U O4 O N N 204 U C5 C N N 205 U C6 C N N 206 U HOP3 H N N 207 U HOP2 H N N 208 U "H5'" H N N 209 U "H5''" H N N 210 U "H4'" H N N 211 U "H3'" H N N 212 U "HO3'" H N N 213 U "H2'" H N N 214 U "HO2'" H N N 215 U "H1'" H N N 216 U H3 H N N 217 U H5 H N N 218 U H6 H N N 219 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 NCO CO N1 sing N N 116 NCO CO N2 sing N N 117 NCO CO N3 sing N N 118 NCO CO N4 sing N N 119 NCO CO N5 sing N N 120 NCO CO N6 sing N N 121 NCO N1 HN11 sing N N 122 NCO N1 HN12 sing N N 123 NCO N1 HN13 sing N N 124 NCO N2 HN21 sing N N 125 NCO N2 HN22 sing N N 126 NCO N2 HN23 sing N N 127 NCO N3 HN31 sing N N 128 NCO N3 HN32 sing N N 129 NCO N3 HN33 sing N N 130 NCO N4 HN41 sing N N 131 NCO N4 HN42 sing N N 132 NCO N4 HN43 sing N N 133 NCO N5 HN51 sing N N 134 NCO N5 HN52 sing N N 135 NCO N5 HN53 sing N N 136 NCO N6 HN61 sing N N 137 NCO N6 HN62 sing N N 138 NCO N6 HN63 sing N N 139 SAM N CA sing N N 140 SAM N HN1 sing N N 141 SAM N HN2 sing N N 142 SAM CA C sing N N 143 SAM CA CB sing N N 144 SAM CA HA sing N N 145 SAM C O doub N N 146 SAM C OXT sing N N 147 SAM CB CG sing N N 148 SAM CB HB1 sing N N 149 SAM CB HB2 sing N N 150 SAM CG SD sing N N 151 SAM CG HG1 sing N N 152 SAM CG HG2 sing N N 153 SAM SD CE sing N N 154 SAM SD "C5'" sing N N 155 SAM CE HE1 sing N N 156 SAM CE HE2 sing N N 157 SAM CE HE3 sing N N 158 SAM "C5'" "C4'" sing N N 159 SAM "C5'" "H5'1" sing N N 160 SAM "C5'" "H5'2" sing N N 161 SAM "C4'" "O4'" sing N N 162 SAM "C4'" "C3'" sing N N 163 SAM "C4'" "H4'" sing N N 164 SAM "O4'" "C1'" sing N N 165 SAM "C3'" "O3'" sing N N 166 SAM "C3'" "C2'" sing N N 167 SAM "C3'" "H3'" sing N N 168 SAM "O3'" "HO3'" sing N N 169 SAM "C2'" "O2'" sing N N 170 SAM "C2'" "C1'" sing N N 171 SAM "C2'" "H2'" sing N N 172 SAM "O2'" "HO2'" sing N N 173 SAM "C1'" N9 sing N N 174 SAM "C1'" "H1'" sing N N 175 SAM N9 C8 sing Y N 176 SAM N9 C4 sing Y N 177 SAM C8 N7 doub Y N 178 SAM C8 H8 sing N N 179 SAM N7 C5 sing Y N 180 SAM C5 C6 sing Y N 181 SAM C5 C4 doub Y N 182 SAM C6 N6 sing N N 183 SAM C6 N1 doub Y N 184 SAM N6 HN61 sing N N 185 SAM N6 HN62 sing N N 186 SAM N1 C2 sing Y N 187 SAM C2 N3 doub Y N 188 SAM C2 H2 sing N N 189 SAM N3 C4 sing Y N 190 U OP3 P sing N N 191 U OP3 HOP3 sing N N 192 U P OP1 doub N N 193 U P OP2 sing N N 194 U P "O5'" sing N N 195 U OP2 HOP2 sing N N 196 U "O5'" "C5'" sing N N 197 U "C5'" "C4'" sing N N 198 U "C5'" "H5'" sing N N 199 U "C5'" "H5''" sing N N 200 U "C4'" "O4'" sing N N 201 U "C4'" "C3'" sing N N 202 U "C4'" "H4'" sing N N 203 U "O4'" "C1'" sing N N 204 U "C3'" "O3'" sing N N 205 U "C3'" "C2'" sing N N 206 U "C3'" "H3'" sing N N 207 U "O3'" "HO3'" sing N N 208 U "C2'" "O2'" sing N N 209 U "C2'" "C1'" sing N N 210 U "C2'" "H2'" sing N N 211 U "O2'" "HO2'" sing N N 212 U "C1'" N1 sing N N 213 U "C1'" "H1'" sing N N 214 U N1 C2 sing N N 215 U N1 C6 sing N N 216 U C2 O2 doub N N 217 U C2 N3 sing N N 218 U N3 C4 sing N N 219 U N3 H3 sing N N 220 U C4 O4 doub N N 221 U C4 C5 sing N N 222 U C5 C6 doub N N 223 U C5 H5 sing N N 224 U C6 H6 sing N N 225 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 4L81 'double helix' 4L81 'a-form double helix' 4L81 tetraloop 4L81 'bulge loop' 4L81 'mismatched base pair' 4L81 'triple helix' 4L81 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 71 1_555 -0.567 -0.126 -0.002 -7.709 -8.296 2.654 1 A_G1:C71_A A 1 ? A 71 ? 19 1 1 A G 2 1_555 A C 70 1_555 0.020 -0.185 -0.035 -2.286 -6.377 0.184 2 A_G2:C70_A A 2 ? A 70 ? 19 1 1 A A 3 1_555 A U 69 1_555 -0.487 -0.251 0.104 4.353 -12.170 -0.265 3 A_A3:U69_A A 3 ? A 69 ? 20 1 1 A U 4 1_555 A A 68 1_555 0.217 -0.079 0.223 -8.491 -13.515 3.405 4 A_U4:A68_A A 4 ? A 68 ? 20 1 1 A C 5 1_555 A G 67 1_555 0.219 -0.223 0.048 1.077 -6.186 1.189 5 A_C5:G67_A A 5 ? A 67 ? 19 1 1 A C 53 1_555 A G 66 1_555 0.472 -0.199 0.068 1.118 -7.009 2.174 6 A_C53:G66_A A 53 ? A 66 ? 19 1 1 A A 54 1_555 A U 65 1_555 0.118 -0.056 -0.118 -0.324 -14.275 -3.706 7 A_A54:U65_A A 54 ? A 65 ? 20 1 1 A C 55 1_555 A G 64 1_555 0.234 0.057 0.046 4.155 -17.673 4.790 8 A_C55:G64_A A 55 ? A 64 ? 19 1 1 A C 56 1_555 A G 63 1_555 -0.148 -0.026 0.436 -4.027 -4.333 -0.364 9 A_C56:G63_A A 56 ? A 63 ? 19 1 1 A G 57 1_555 A C 62 1_555 -0.112 0.067 -0.139 3.029 4.492 5.510 10 A_G57:C62_A A 57 ? A 62 ? 19 1 1 A G 58 1_555 A A 61 1_555 6.739 -5.378 1.141 17.963 6.898 -11.737 11 A_G58:A61_A A 58 ? A 61 ? ? ? 1 A A 17 1_555 A G 14 1_555 -7.060 -5.459 0.830 -20.774 -2.818 -17.130 12 A_A17:G14_A A 17 ? A 14 ? ? ? 1 A C 18 1_555 A G 13 1_555 1.299 0.277 0.174 5.402 -1.945 10.019 13 A_C18:G13_A A 18 ? A 13 ? ? 1 1 A C 19 1_555 A G 12 1_555 0.186 -0.203 0.231 -2.018 -6.248 0.679 14 A_C19:G12_A A 19 ? A 12 ? 19 1 1 A C 20 1_555 A G 11 1_555 0.421 -0.326 0.203 -3.311 -3.326 -6.421 15 A_C20:G11_A A 20 ? A 11 ? 19 1 1 A C 21 1_555 A G 10 1_555 -0.186 -0.141 0.045 -3.730 2.757 4.737 16 A_C21:G10_A A 21 ? A 10 ? 19 1 1 A G 22 1_555 A U 50 1_555 -2.601 -0.764 0.049 -5.232 -11.918 -2.636 17 A_G22:U50_A A 22 ? A 50 ? 28 1 1 A G 23 1_555 A C 49 1_555 -0.632 -0.029 -0.015 -8.486 -14.899 4.733 18 A_G23:C49_A A 23 ? A 49 ? 19 1 1 A C 24 1_555 A G 48 1_555 0.213 -0.282 0.424 -14.614 -9.137 -3.016 19 A_C24:G48_A A 24 ? A 48 ? 19 1 1 A C 27 1_555 A G 46 1_555 -0.195 -0.205 -0.412 9.975 -3.742 -2.466 20 A_C27:G46_A A 27 ? A 46 ? 19 1 1 A C 28 1_555 A G 45 1_555 0.080 -0.337 -0.354 8.260 -1.335 0.033 21 A_C28:G45_A A 28 ? A 45 ? 19 1 1 A U 29 1_555 A A 44 1_555 0.164 -0.289 -0.172 -8.976 -8.619 -0.531 22 A_U29:A44_A A 29 ? A 44 ? 20 1 1 A G 30 1_555 A C 42 1_555 -0.668 -0.355 0.044 2.892 -7.819 -4.335 23 A_G30:C42_A A 30 ? A 42 ? 19 1 1 A G 31 1_555 A C 41 1_555 -0.158 -0.371 0.335 6.076 -5.321 -0.921 24 A_G31:C41_A A 31 ? A 41 ? 19 1 1 A G 32 1_555 A C 40 1_555 -0.216 -0.071 -0.015 10.872 -1.161 -0.336 25 A_G32:C40_A A 32 ? A 40 ? 19 1 1 A U 92 1_555 A A 37 1_555 -0.826 -0.481 -0.434 0.787 6.373 -1.628 26 A_U92:A37_A A 92 ? A 37 ? 20 1 1 A C 93 1_555 A G 36 1_555 -0.497 -0.047 0.101 10.551 -11.413 -0.346 27 A_C93:G36_A A 93 ? A 36 ? 19 1 1 A C 94 1_555 A G 35 1_555 0.142 -0.292 -0.409 2.748 -10.933 -6.421 28 A_C94:G35_A A 94 ? A 35 ? 19 1 1 A G 95 1_555 A C 34 1_555 0.272 0.000 0.546 -15.673 -28.424 -0.007 29 A_G95:C34_A A 95 ? A 34 ? 19 1 1 A U 96 1_555 A A 33 1_555 -1.325 1.670 0.485 -30.532 -14.270 -46.758 30 A_U96:A33_A A 96 ? A 33 ? ? ? 1 A G 72 1_555 A A 85 1_555 -0.119 1.585 -0.361 -4.169 -0.185 -20.488 31 A_G72:A85_A A 72 ? A 85 ? 8 1 1 A G 73 1_555 A C 84 1_555 -0.040 -0.105 0.067 5.809 -3.458 -1.545 32 A_G73:C84_A A 73 ? A 84 ? 19 1 1 A C 74 1_555 A G 83 1_555 0.144 -0.037 -0.348 15.471 -13.623 1.178 33 A_C74:G83_A A 74 ? A 83 ? 19 1 1 A C 75 1_555 A G 82 1_555 0.159 -0.124 -0.220 5.819 -6.164 1.238 34 A_C75:G82_A A 75 ? A 82 ? 19 1 1 A C 76 1_555 A G 81 1_555 -0.221 -0.106 -0.223 4.764 -6.945 0.296 35 A_C76:G81_A A 76 ? A 81 ? 19 1 1 A G 77 1_555 A A 80 1_555 7.664 -5.407 0.281 15.275 8.437 -42.337 36 A_G77:A80_A A 77 ? A 80 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 71 1_555 A G 2 1_555 A C 70 1_555 -0.622 -1.554 3.174 -0.994 7.799 33.341 -3.772 0.913 2.768 13.363 1.703 34.230 1 AA_G1G2:C70C71_AA A 1 ? A 71 ? A 2 ? A 70 ? 1 A G 2 1_555 A C 70 1_555 A A 3 1_555 A U 69 1_555 0.477 -1.369 3.051 0.450 9.300 27.499 -4.512 -0.867 2.473 18.890 -0.914 29.004 2 AA_G2A3:U69C70_AA A 2 ? A 70 ? A 3 ? A 69 ? 1 A A 3 1_555 A U 69 1_555 A U 4 1_555 A A 68 1_555 0.405 -1.381 3.712 2.383 16.103 37.016 -3.931 -0.302 2.910 23.992 -3.551 40.322 3 AA_A3U4:A68U69_AA A 3 ? A 69 ? A 4 ? A 68 ? 1 A U 4 1_555 A A 68 1_555 A C 5 1_555 A G 67 1_555 0.368 -1.606 3.044 4.927 5.956 31.801 -3.774 0.109 2.731 10.673 -8.830 32.703 4 AA_U4C5:G67A68_AA A 4 ? A 68 ? A 5 ? A 67 ? 1 A C 5 1_555 A G 67 1_555 A C 53 1_555 A G 66 1_555 -2.139 -1.282 3.272 -1.345 3.072 46.985 -1.855 2.567 3.243 3.848 1.684 47.098 5 AA_C5C53:G66G67_AA A 5 ? A 67 ? A 53 ? A 66 ? 1 A C 53 1_555 A G 66 1_555 A A 54 1_555 A U 65 1_555 -0.828 -1.763 3.297 1.915 6.318 26.787 -5.146 2.176 2.752 13.381 -4.057 27.574 6 AA_C53A54:U65G66_AA A 53 ? A 66 ? A 54 ? A 65 ? 1 A A 54 1_555 A U 65 1_555 A C 55 1_555 A G 64 1_555 0.503 -1.240 3.090 0.261 5.472 34.207 -2.856 -0.809 2.867 9.230 -0.441 34.630 7 AA_A54C55:G64U65_AA A 54 ? A 65 ? A 55 ? A 64 ? 1 A C 55 1_555 A G 64 1_555 A C 56 1_555 A G 63 1_555 -0.133 -1.792 3.340 -3.210 9.688 33.337 -4.393 -0.242 2.729 16.416 5.439 34.822 8 AA_C55C56:G63G64_AA A 55 ? A 64 ? A 56 ? A 63 ? 1 A C 56 1_555 A G 63 1_555 A G 57 1_555 A C 62 1_555 0.663 -2.120 3.032 4.599 4.457 28.628 -5.049 -0.424 2.748 8.874 -9.157 29.321 9 AA_C56G57:C62G63_AA A 56 ? A 63 ? A 57 ? A 62 ? 1 A G 57 1_555 A C 62 1_555 A G 58 1_555 A A 61 1_555 -2.144 -1.236 2.718 -4.816 12.307 53.888 -1.923 2.075 2.569 13.355 5.226 55.367 10 AA_G57G58:A61C62_AA A 57 ? A 62 ? A 58 ? A 61 ? 1 A A 17 1_555 A G 14 1_555 A C 18 1_555 A G 13 1_555 2.635 -0.795 2.659 1.910 5.286 62.819 -0.952 -2.450 2.662 5.061 -1.828 63.044 11 AA_A17C18:G13G14_AA A 17 ? A 14 ? A 18 ? A 13 ? 1 A C 18 1_555 A G 13 1_555 A C 19 1_555 A G 12 1_555 -0.931 -2.358 3.273 -2.566 5.331 23.175 -7.318 1.466 2.754 13.000 6.257 23.909 12 AA_C18C19:G12G13_AA A 18 ? A 13 ? A 19 ? A 12 ? 1 A C 19 1_555 A G 12 1_555 A C 20 1_555 A G 11 1_555 -0.865 -1.924 3.184 -0.656 8.571 34.054 -4.354 1.346 2.652 14.353 1.099 35.091 13 AA_C19C20:G11G12_AA A 19 ? A 12 ? A 20 ? A 11 ? 1 A C 20 1_555 A G 11 1_555 A C 21 1_555 A G 10 1_555 0.960 -1.269 3.239 4.638 4.536 30.076 -3.268 -0.917 3.128 8.616 -8.809 30.752 14 AA_C20C21:G10G11_AA A 20 ? A 11 ? A 21 ? A 10 ? 1 A C 21 1_555 A G 10 1_555 A G 22 1_555 A U 50 1_555 1.454 -1.010 2.964 -0.369 14.501 31.163 -3.627 -2.514 2.268 25.343 0.645 34.298 15 AA_C21G22:U50G10_AA A 21 ? A 10 ? A 22 ? A 50 ? 1 A G 22 1_555 A U 50 1_555 A G 23 1_555 A C 49 1_555 0.222 -1.653 3.415 -1.227 3.608 37.145 -3.068 -0.512 3.237 5.646 1.920 37.333 16 AA_G22G23:C49U50_AA A 22 ? A 50 ? A 23 ? A 49 ? 1 A G 23 1_555 A C 49 1_555 A C 24 1_555 A G 48 1_555 -0.649 -1.272 3.290 -4.082 2.182 41.528 -2.015 0.479 3.268 3.066 5.736 41.773 17 AA_G23C24:G48C49_AA A 23 ? A 49 ? A 24 ? A 48 ? 1 A C 27 1_555 A G 46 1_555 A C 28 1_555 A G 45 1_555 -0.205 -2.314 3.329 -2.056 5.823 32.396 -5.028 0.026 2.888 10.319 3.643 32.964 18 AA_C27C28:G45G46_AA A 27 ? A 46 ? A 28 ? A 45 ? 1 A C 28 1_555 A G 45 1_555 A U 29 1_555 A A 44 1_555 0.482 -2.192 3.546 3.693 11.273 36.358 -4.768 -0.273 2.802 17.503 -5.733 38.182 19 AA_C28U29:A44G45_AA A 28 ? A 45 ? A 29 ? A 44 ? 1 A U 29 1_555 A A 44 1_555 A G 30 1_555 A C 42 1_555 2.065 -1.389 3.353 -10.771 7.607 44.174 -2.381 -3.498 2.549 9.857 13.957 46.006 20 AA_U29G30:C42A44_AA A 29 ? A 44 ? A 30 ? A 42 ? 1 A G 30 1_555 A C 42 1_555 A G 31 1_555 A C 41 1_555 0.325 -1.480 3.180 -3.573 6.110 35.736 -3.159 -0.982 2.852 9.837 5.753 36.408 21 AA_G30G31:C41C42_AA A 30 ? A 42 ? A 31 ? A 41 ? 1 A G 31 1_555 A C 41 1_555 A G 32 1_555 A C 40 1_555 0.912 -2.288 3.139 4.544 3.715 28.490 -5.320 -0.883 2.930 7.449 -9.111 29.076 22 AA_G31G32:C40C41_AA A 31 ? A 41 ? A 32 ? A 40 ? 1 A G 32 1_555 A C 40 1_555 A U 92 1_555 A A 37 1_555 0.543 -0.722 3.793 2.723 -3.365 82.606 -0.450 -0.333 3.828 -2.548 -2.061 82.699 23 AA_G32U92:A37C40_AA A 32 ? A 40 ? A 92 ? A 37 ? 1 A U 92 1_555 A A 37 1_555 A C 93 1_555 A G 36 1_555 -0.626 -1.651 3.193 -10.893 21.653 32.002 -4.581 -0.173 1.872 33.873 17.041 39.953 24 AA_U92C93:G36A37_AA A 92 ? A 37 ? A 93 ? A 36 ? 1 A C 93 1_555 A G 36 1_555 A C 94 1_555 A G 35 1_555 -0.627 -1.712 3.425 2.757 7.312 32.764 -4.130 1.525 2.925 12.738 -4.803 33.658 25 AA_C93C94:G35G36_AA A 93 ? A 36 ? A 94 ? A 35 ? 1 A C 94 1_555 A G 35 1_555 A G 95 1_555 A C 34 1_555 0.850 -1.447 3.559 1.971 15.336 36.750 -3.933 -1.017 2.801 23.110 -2.970 39.766 26 AA_C94G95:C34G35_AA A 94 ? A 35 ? A 95 ? A 34 ? 1 A G 95 1_555 A C 34 1_555 A U 96 1_555 A A 33 1_555 -2.044 -1.998 3.275 1.109 12.522 36.092 -4.474 3.252 2.413 19.498 -1.727 38.150 27 AA_G95U96:A33C34_AA A 95 ? A 34 ? A 96 ? A 33 ? 1 A G 72 1_555 A A 85 1_555 A G 73 1_555 A C 84 1_555 0.981 -1.800 3.146 -6.794 6.468 30.868 -4.253 -2.828 2.462 11.814 12.410 32.228 28 AA_G72G73:C84A85_AA A 72 ? A 85 ? A 73 ? A 84 ? 1 A G 73 1_555 A C 84 1_555 A C 74 1_555 A G 83 1_555 0.349 -1.604 3.118 2.894 0.000 33.828 -2.747 -0.154 3.136 0.000 -4.963 33.948 29 AA_G73C74:G83C84_AA A 73 ? A 84 ? A 74 ? A 83 ? 1 A C 74 1_555 A G 83 1_555 A C 75 1_555 A G 82 1_555 -0.301 -2.105 3.608 -3.839 8.301 29.628 -5.582 -0.194 2.940 15.767 7.291 30.977 30 AA_C74C75:G82G83_AA A 74 ? A 83 ? A 75 ? A 82 ? 1 A C 75 1_555 A G 82 1_555 A C 76 1_555 A G 81 1_555 0.039 -2.075 3.221 1.382 6.550 29.395 -5.218 0.183 2.704 12.701 -2.680 30.131 31 AA_C75C76:G81G82_AA A 75 ? A 82 ? A 76 ? A 81 ? 1 A C 76 1_555 A G 81 1_555 A G 77 1_555 A A 80 1_555 -3.607 -2.156 3.017 -3.711 1.823 57.961 -2.312 3.529 3.159 1.879 3.824 58.096 32 AA_C76G77:A80G81_AA A 76 ? A 81 ? A 77 ? A 80 ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 S-ADENOSYLMETHIONINE SAM 3 'COBALT HEXAMMINE(III)' NCO 4 'MAGNESIUM ION' MG # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 2GIS _pdbx_initial_refinement_model.details 'PDB ENTRY 2GIS' #