data_4LVX # _entry.id 4LVX # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 4LVX pdb_00004lvx 10.2210/pdb4lvx/pdb NDB NA2641 ? ? RCSB RCSB081152 ? ? WWPDB D_1000081152 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2014-03-19 2 'Structure model' 1 1 2024-02-28 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 2 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' database_2 4 2 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' 3 2 'Structure model' '_struct_site.pdbx_auth_asym_id' 4 2 'Structure model' '_struct_site.pdbx_auth_comp_id' 5 2 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 4LVX _pdbx_database_status.recvd_initial_deposition_date 2013-07-26 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 3SD3 . unspecified PDB 4LVV . unspecified PDB 4LVW . unspecified PDB 4LVY . unspecified PDB 4LVZ . unspecified PDB 4LW0 . unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Trausch, J.J.' 1 'Batey, R.T.' 2 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'A Disconnect between High-Affinity Binding and Efficient Regulation by Antifolates and Purines in the Tetrahydrofolate Riboswitch.' Chem.Biol. 21 205 216 2014 CBOLE2 UK 1074-5521 2050 ? 24388757 10.1016/j.chembiol.2013.11.012 1 'The structure of a tetrahydrofolate-sensing riboswitch reveals two ligand binding sites in a single aptamer.' Structure 19 1413 1423 2011 STRUE6 UK 0969-2126 2005 ? 21906956 10.1016/j.str.2011.06.019 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Trausch, J.J.' 1 ? primary 'Batey, R.T.' 2 ? 1 'Trausch, J.J.' 3 ? 1 'Ceres, P.' 4 ? 1 'Reyes, F.E.' 5 ? 1 'Batey, R.T.' 6 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'THF riboswitch' 28849.145 1 ? ? ? ? 2 non-polymer syn 5,6,7,8-TETRAHYDROBIOPTERIN 241.247 2 ? ? ? ? 3 water nat water 18.015 168 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCA UCCGCUCCA ; _entity_poly.pdbx_seq_one_letter_code_can ;GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCA UCCGCUCCA ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 5,6,7,8-TETRAHYDROBIOPTERIN H4B 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 A n 1 6 G n 1 7 U n 1 8 A n 1 9 G n 1 10 A n 1 11 U n 1 12 G n 1 13 A n 1 14 U n 1 15 U n 1 16 C n 1 17 G n 1 18 C n 1 19 G n 1 20 U n 1 21 U n 1 22 A n 1 23 A n 1 24 G n 1 25 U n 1 26 G n 1 27 U n 1 28 G n 1 29 U n 1 30 G n 1 31 U n 1 32 G n 1 33 A n 1 34 A n 1 35 U n 1 36 G n 1 37 G n 1 38 G n 1 39 A n 1 40 U n 1 41 G n 1 42 U n 1 43 C n 1 44 G n 1 45 U n 1 46 C n 1 47 A n 1 48 C n 1 49 A n 1 50 C n 1 51 A n 1 52 A n 1 53 C n 1 54 G n 1 55 A n 1 56 A n 1 57 G n 1 58 C n 1 59 G n 1 60 A n 1 61 G n 1 62 A n 1 63 G n 1 64 C n 1 65 G n 1 66 C n 1 67 G n 1 68 G n 1 69 U n 1 70 G n 1 71 A n 1 72 A n 1 73 U n 1 74 C n 1 75 A n 1 76 U n 1 77 U n 1 78 G n 1 79 C n 1 80 A n 1 81 U n 1 82 C n 1 83 C n 1 84 G n 1 85 C n 1 86 U n 1 87 C n 1 88 C n 1 89 A n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'T7 in vitro transcribed' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 H4B non-polymer . 5,6,7,8-TETRAHYDROBIOPTERIN ? 'C9 H15 N5 O3' 241.247 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 U 11 11 11 U U A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 U 14 14 14 U U A . n A 1 15 U 15 15 15 U U A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 U 21 21 21 U U A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 G 24 24 24 G G A . n A 1 25 U 25 25 25 U U A . n A 1 26 G 26 26 26 G G A . n A 1 27 U 27 27 27 U U A . n A 1 28 G 28 28 28 G G A . n A 1 29 U 29 29 29 U U A . n A 1 30 G 30 30 30 G G A . n A 1 31 U 31 31 31 U U A . n A 1 32 G 32 32 32 G G A . n A 1 33 A 33 33 33 A A A . n A 1 34 A 34 34 34 A A A . n A 1 35 U 35 35 35 U U A . n A 1 36 G 36 36 36 G G A . n A 1 37 G 37 37 37 G G A . n A 1 38 G 38 38 38 G G A . n A 1 39 A 39 39 39 A A A . n A 1 40 U 40 40 40 U U A . n A 1 41 G 41 41 41 G G A . n A 1 42 U 42 42 42 U U A . n A 1 43 C 43 43 43 C C A . n A 1 44 G 44 44 44 G G A . n A 1 45 U 45 45 45 U U A . n A 1 46 C 46 46 46 C C A . n A 1 47 A 47 47 47 A A A . n A 1 48 C 48 48 48 C C A . n A 1 49 A 49 49 49 A A A . n A 1 50 C 50 50 50 C C A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 C 53 53 53 C C A . n A 1 54 G 54 54 54 G G A . n A 1 55 A 55 55 55 A A A . n A 1 56 A 56 56 56 A A A . n A 1 57 G 57 57 57 G G A . n A 1 58 C 58 58 58 C C A . n A 1 59 G 59 59 59 G G A . n A 1 60 A 60 60 60 A A A . n A 1 61 G 61 61 61 G G A . n A 1 62 A 62 62 62 A A A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 G 65 65 65 G G A . n A 1 66 C 66 66 66 C C A . n A 1 67 G 67 67 67 G G A . n A 1 68 G 68 68 68 G G A . n A 1 69 U 69 69 69 U U A . n A 1 70 G 70 70 70 G G A . n A 1 71 A 71 71 71 A A A . n A 1 72 A 72 72 72 A A A . n A 1 73 U 73 73 73 U U A . n A 1 74 C 74 74 74 C C A . n A 1 75 A 75 75 75 A A A . n A 1 76 U 76 76 76 U U A . n A 1 77 U 77 77 77 U U A . n A 1 78 G 78 78 78 G G A . n A 1 79 C 79 79 79 C C A . n A 1 80 A 80 80 80 A A A . n A 1 81 U 81 81 81 U U A . n A 1 82 C 82 82 82 C C A . n A 1 83 C 83 83 83 C C A . n A 1 84 G 84 84 84 G G A . n A 1 85 C 85 85 85 C C A . n A 1 86 U 86 86 86 U U A . n A 1 87 C 87 87 87 C C A . n A 1 88 C 88 88 88 C C A . n A 1 89 A 89 89 89 A A A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 H4B 1 101 101 H4B H4B A . C 2 H4B 1 102 102 H4B H4B A . D 3 HOH 1 201 201 HOH HOH A . D 3 HOH 2 202 202 HOH HOH A . D 3 HOH 3 203 203 HOH HOH A . D 3 HOH 4 204 204 HOH HOH A . D 3 HOH 5 205 205 HOH HOH A . D 3 HOH 6 206 206 HOH HOH A . D 3 HOH 7 207 207 HOH HOH A . D 3 HOH 8 208 208 HOH HOH A . D 3 HOH 9 209 209 HOH HOH A . D 3 HOH 10 210 210 HOH HOH A . D 3 HOH 11 211 211 HOH HOH A . D 3 HOH 12 212 212 HOH HOH A . D 3 HOH 13 213 214 HOH HOH A . D 3 HOH 14 214 215 HOH HOH A . D 3 HOH 15 215 216 HOH HOH A . D 3 HOH 16 216 217 HOH HOH A . D 3 HOH 17 217 218 HOH HOH A . D 3 HOH 18 218 219 HOH HOH A . D 3 HOH 19 219 220 HOH HOH A . D 3 HOH 20 220 221 HOH HOH A . D 3 HOH 21 221 222 HOH HOH A . D 3 HOH 22 222 223 HOH HOH A . D 3 HOH 23 223 224 HOH HOH A . D 3 HOH 24 224 225 HOH HOH A . D 3 HOH 25 225 226 HOH HOH A . D 3 HOH 26 226 227 HOH HOH A . D 3 HOH 27 227 228 HOH HOH A . D 3 HOH 28 228 229 HOH HOH A . D 3 HOH 29 229 230 HOH HOH A . D 3 HOH 30 230 231 HOH HOH A . D 3 HOH 31 231 232 HOH HOH A . D 3 HOH 32 232 233 HOH HOH A . D 3 HOH 33 233 234 HOH HOH A . D 3 HOH 34 234 235 HOH HOH A . D 3 HOH 35 235 236 HOH HOH A . D 3 HOH 36 236 237 HOH HOH A . D 3 HOH 37 237 238 HOH HOH A . D 3 HOH 38 238 239 HOH HOH A . D 3 HOH 39 239 240 HOH HOH A . D 3 HOH 40 240 241 HOH HOH A . D 3 HOH 41 241 242 HOH HOH A . D 3 HOH 42 242 243 HOH HOH A . D 3 HOH 43 243 244 HOH HOH A . D 3 HOH 44 244 245 HOH HOH A . D 3 HOH 45 245 246 HOH HOH A . D 3 HOH 46 246 247 HOH HOH A . D 3 HOH 47 247 248 HOH HOH A . D 3 HOH 48 248 249 HOH HOH A . D 3 HOH 49 249 250 HOH HOH A . D 3 HOH 50 250 251 HOH HOH A . D 3 HOH 51 251 252 HOH HOH A . D 3 HOH 52 252 253 HOH HOH A . D 3 HOH 53 253 254 HOH HOH A . D 3 HOH 54 254 255 HOH HOH A . D 3 HOH 55 255 256 HOH HOH A . D 3 HOH 56 256 257 HOH HOH A . D 3 HOH 57 257 259 HOH HOH A . D 3 HOH 58 258 260 HOH HOH A . D 3 HOH 59 259 261 HOH HOH A . D 3 HOH 60 260 262 HOH HOH A . D 3 HOH 61 261 263 HOH HOH A . D 3 HOH 62 262 264 HOH HOH A . D 3 HOH 63 263 265 HOH HOH A . D 3 HOH 64 264 266 HOH HOH A . D 3 HOH 65 265 267 HOH HOH A . D 3 HOH 66 266 268 HOH HOH A . D 3 HOH 67 267 269 HOH HOH A . D 3 HOH 68 268 270 HOH HOH A . D 3 HOH 69 269 271 HOH HOH A . D 3 HOH 70 270 272 HOH HOH A . D 3 HOH 71 271 273 HOH HOH A . D 3 HOH 72 272 274 HOH HOH A . D 3 HOH 73 273 275 HOH HOH A . D 3 HOH 74 274 276 HOH HOH A . D 3 HOH 75 275 277 HOH HOH A . D 3 HOH 76 276 278 HOH HOH A . D 3 HOH 77 277 279 HOH HOH A . D 3 HOH 78 278 280 HOH HOH A . D 3 HOH 79 279 281 HOH HOH A . D 3 HOH 80 280 282 HOH HOH A . D 3 HOH 81 281 283 HOH HOH A . D 3 HOH 82 282 284 HOH HOH A . D 3 HOH 83 283 285 HOH HOH A . D 3 HOH 84 284 286 HOH HOH A . D 3 HOH 85 285 287 HOH HOH A . D 3 HOH 86 286 288 HOH HOH A . D 3 HOH 87 287 289 HOH HOH A . D 3 HOH 88 288 290 HOH HOH A . D 3 HOH 89 289 291 HOH HOH A . D 3 HOH 90 290 292 HOH HOH A . D 3 HOH 91 291 293 HOH HOH A . D 3 HOH 92 292 294 HOH HOH A . D 3 HOH 93 293 295 HOH HOH A . D 3 HOH 94 294 296 HOH HOH A . D 3 HOH 95 295 297 HOH HOH A . D 3 HOH 96 296 298 HOH HOH A . D 3 HOH 97 297 299 HOH HOH A . D 3 HOH 98 298 300 HOH HOH A . D 3 HOH 99 299 301 HOH HOH A . D 3 HOH 100 300 302 HOH HOH A . D 3 HOH 101 301 303 HOH HOH A . D 3 HOH 102 302 304 HOH HOH A . D 3 HOH 103 303 305 HOH HOH A . D 3 HOH 104 304 306 HOH HOH A . D 3 HOH 105 305 307 HOH HOH A . D 3 HOH 106 306 308 HOH HOH A . D 3 HOH 107 307 309 HOH HOH A . D 3 HOH 108 308 310 HOH HOH A . D 3 HOH 109 309 311 HOH HOH A . D 3 HOH 110 310 312 HOH HOH A . D 3 HOH 111 311 313 HOH HOH A . D 3 HOH 112 312 314 HOH HOH A . D 3 HOH 113 313 315 HOH HOH A . D 3 HOH 114 314 316 HOH HOH A . D 3 HOH 115 315 317 HOH HOH A . D 3 HOH 116 316 318 HOH HOH A . D 3 HOH 117 317 319 HOH HOH A . D 3 HOH 118 318 320 HOH HOH A . D 3 HOH 119 319 321 HOH HOH A . D 3 HOH 120 320 322 HOH HOH A . D 3 HOH 121 321 323 HOH HOH A . D 3 HOH 122 322 324 HOH HOH A . D 3 HOH 123 323 325 HOH HOH A . D 3 HOH 124 324 326 HOH HOH A . D 3 HOH 125 325 327 HOH HOH A . D 3 HOH 126 326 328 HOH HOH A . D 3 HOH 127 327 329 HOH HOH A . D 3 HOH 128 328 330 HOH HOH A . D 3 HOH 129 329 331 HOH HOH A . D 3 HOH 130 330 332 HOH HOH A . D 3 HOH 131 331 333 HOH HOH A . D 3 HOH 132 332 334 HOH HOH A . D 3 HOH 133 333 335 HOH HOH A . D 3 HOH 134 334 336 HOH HOH A . D 3 HOH 135 335 337 HOH HOH A . D 3 HOH 136 336 338 HOH HOH A . D 3 HOH 137 337 339 HOH HOH A . D 3 HOH 138 338 340 HOH HOH A . D 3 HOH 139 339 341 HOH HOH A . D 3 HOH 140 340 342 HOH HOH A . D 3 HOH 141 341 343 HOH HOH A . D 3 HOH 142 342 344 HOH HOH A . D 3 HOH 143 343 345 HOH HOH A . D 3 HOH 144 344 346 HOH HOH A . D 3 HOH 145 345 347 HOH HOH A . D 3 HOH 146 346 348 HOH HOH A . D 3 HOH 147 347 349 HOH HOH A . D 3 HOH 148 348 350 HOH HOH A . D 3 HOH 149 349 351 HOH HOH A . D 3 HOH 150 350 352 HOH HOH A . D 3 HOH 151 351 353 HOH HOH A . D 3 HOH 152 352 354 HOH HOH A . D 3 HOH 153 353 355 HOH HOH A . D 3 HOH 154 354 356 HOH HOH A . D 3 HOH 155 355 357 HOH HOH A . D 3 HOH 156 356 358 HOH HOH A . D 3 HOH 157 357 359 HOH HOH A . D 3 HOH 158 358 360 HOH HOH A . D 3 HOH 159 359 361 HOH HOH A . D 3 HOH 160 360 362 HOH HOH A . D 3 HOH 161 361 363 HOH HOH A . D 3 HOH 162 362 364 HOH HOH A . D 3 HOH 163 363 365 HOH HOH A . D 3 HOH 164 364 366 HOH HOH A . D 3 HOH 165 365 367 HOH HOH A . D 3 HOH 166 366 368 HOH HOH A . D 3 HOH 167 367 369 HOH HOH A . D 3 HOH 168 368 370 HOH HOH A . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal BOS 'data collection' . ? 1 PHASER phasing . ? 2 PHENIX refinement '(phenix.refine: 1.8_1069)' ? 3 MOSFLM 'data reduction' . ? 4 SCALA 'data scaling' . ? 5 # _cell.entry_id 4LVX _cell.length_a 26.990 _cell.length_b 68.620 _cell.length_c 158.060 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 4 _cell.pdbx_unique_axis ? _cell.length_a_esd ? _cell.length_b_esd ? _cell.length_c_esd ? _cell.angle_alpha_esd ? _cell.angle_beta_esd ? _cell.angle_gamma_esd ? # _symmetry.entry_id 4LVX _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall ? # _exptl.entry_id 4LVX _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.54 _exptl_crystal.density_percent_sol 51.51 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 303 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.pdbx_details ;2,4-methyl-pentanediol, spermine, sodium cacodylate, sodium chloride, dithiothreitol, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 303K ; # _diffrn.id 1 _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 315r' _diffrn_detector.pdbx_collection_date 2013-01-19 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.1051 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'ALS BEAMLINE 5.0.2' _diffrn_source.pdbx_synchrotron_site ALS _diffrn_source.pdbx_synchrotron_beamline 5.0.2 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 1.1051 # _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.entry_id 4LVX _reflns.observed_criterion_sigma_I 5.5 _reflns.observed_criterion_sigma_F 5.5 _reflns.d_resolution_low 52.69 _reflns.d_resolution_high 1.90 _reflns.number_obs ? _reflns.number_all 24030 _reflns.percent_possible_obs 99.4 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 5.7 _reflns.R_free_details ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? # _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_ordinal 1 _reflns_shell.d_res_high 1.90 _reflns_shell.d_res_low 2.00 _reflns_shell.percent_possible_all 99.5 _reflns_shell.Rmerge_I_obs 0.221 _reflns_shell.pdbx_Rsym_value 0.109 _reflns_shell.meanI_over_sigI_obs 5.5 _reflns_shell.pdbx_redundancy 4.9 _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 4LVX _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 23940 _refine.ls_number_reflns_all 24030 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 28.751 _refine.ls_d_res_high 1.900 _refine.ls_percent_reflns_obs 99.16 _refine.ls_R_factor_obs 0.2215 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2204 _refine.ls_R_factor_R_free 0.2401 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 5.01 _refine.ls_number_reflns_R_free 1199 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML 0.24 _refine.pdbx_overall_phase_error 30.35 _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1913 _refine_hist.pdbx_number_atoms_ligand 34 _refine_hist.number_atoms_solvent 168 _refine_hist.number_atoms_total 2115 _refine_hist.d_res_high 1.900 _refine_hist.d_res_low 28.751 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function f_bond_d 0.004 ? ? 2178 'X-RAY DIFFRACTION' ? f_angle_d 0.977 ? ? 3392 'X-RAY DIFFRACTION' ? f_dihedral_angle_d 11.967 ? ? 1075 'X-RAY DIFFRACTION' ? f_chiral_restr 0.044 ? ? 451 'X-RAY DIFFRACTION' ? f_plane_restr 0.007 ? ? 91 'X-RAY DIFFRACTION' ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_R_work _refine_ls_shell.R_factor_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_all _refine_ls_shell.R_factor_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.number_reflns_obs 'X-RAY DIFFRACTION' . 1.9000 1.9761 2445 0.3085 99.00 0.3597 . . 128 . . . . 'X-RAY DIFFRACTION' . 1.9761 2.0660 2495 0.2831 100.00 0.3531 . . 133 . . . . 'X-RAY DIFFRACTION' . 2.0660 2.1749 2484 0.2690 100.00 0.2873 . . 130 . . . . 'X-RAY DIFFRACTION' . 2.1749 2.3111 2523 0.2664 100.00 0.2885 . . 133 . . . . 'X-RAY DIFFRACTION' . 2.3111 2.4894 2521 0.2729 100.00 0.3257 . . 133 . . . . 'X-RAY DIFFRACTION' . 2.4894 2.7398 2547 0.2703 100.00 0.2824 . . 133 . . . . 'X-RAY DIFFRACTION' . 2.7398 3.1358 2519 0.2435 100.00 0.2846 . . 134 . . . . 'X-RAY DIFFRACTION' . 3.1358 3.9492 2588 0.1923 99.00 0.2222 . . 136 . . . . 'X-RAY DIFFRACTION' . 3.9492 28.7544 2619 0.1857 95.00 0.1789 . . 139 . . . . # _database_PDB_matrix.entry_id 4LVX _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 4LVX _struct.title 'Structure of the THF riboswitch bound to tetrahydrobiopterin' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 4LVX _struct_keywords.pdbx_keywords RNA _struct_keywords.text ;Aptamers, Nucleotide, Bacillus subtilis, Bacterial Proteins, Base Sequence, Binding Sites, Calorimetry, Folic Acid, Gene Expression Regulation, Bacterial, Guanine, Leucovorin, Ligands, Magnesium, Molecular Sequence Data, Nucleic Acid Conformation, Point Mutation, Protein Binding, Protein Structure, Secondary, RNA, Riboswitch, S-Adenosylmethionine, Streptococcus mutans, Terminator Regions, Genetic, Tetrahydrofolates, Thermodynamics, Transcription, three-way junction, pseudoknot, regulation, ncRNA, tetrahydrobiopterin binding, mRNA ; # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 4LVX _struct_ref.pdbx_db_accession 4LVX _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ;GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCA UCCGCUCCA ; _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 4LVX _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 89 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 4LVX _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 89 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 89 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 88 N3 ? ? A G 1 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 88 O2 ? ? A G 1 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 88 N4 ? ? A G 1 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 87 N3 ? ? A G 2 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 87 O2 ? ? A G 2 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 87 N4 ? ? A G 2 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 86 N3 ? ? A A 3 A U 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 86 O4 ? ? A A 3 A U 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 85 N3 ? ? A G 4 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 85 O2 ? ? A G 4 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 85 N4 ? ? A G 4 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A G 84 N1 ? ? A A 5 A G 84 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A G 84 O6 ? ? A A 5 A G 84 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog14 hydrog ? ? A G 6 N2 ? ? ? 1_555 A G 37 O6 ? ? A G 6 A G 37 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog15 hydrog ? ? A A 8 N3 ? ? ? 1_555 A G 44 N2 ? ? A A 8 A G 44 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog16 hydrog ? ? A A 8 N7 ? ? ? 1_555 A G 78 N2 ? ? A A 8 A G 78 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog17 hydrog ? ? A G 9 N1 ? ? ? 1_555 A U 77 O2 ? ? A G 9 A U 77 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog18 hydrog ? ? A G 9 O6 ? ? ? 1_555 A U 77 N3 ? ? A G 9 A U 77 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 76 N3 ? ? A A 10 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 76 O4 ? ? A A 10 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 75 N1 ? ? A U 11 A A 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 75 N6 ? ? A U 11 A A 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 74 N3 ? ? A G 12 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 74 O2 ? ? A G 12 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 74 N4 ? ? A G 12 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 73 N3 ? ? A A 13 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 73 O4 ? ? A A 13 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 72 N1 ? ? A U 14 A A 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 72 N6 ? ? A U 14 A A 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 71 N1 ? ? A U 15 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 71 N6 ? ? A U 15 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 70 N1 ? ? A C 16 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 70 O6 ? ? A C 16 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 70 N2 ? ? A C 16 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 69 O2 ? ? A G 17 A U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 69 N3 ? ? A G 17 A U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog37 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 67 N1 ? ? A C 18 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 67 O6 ? ? A C 18 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 67 N2 ? ? A C 18 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 19 N2 ? ? ? 1_555 A A 22 N1 ? ? A G 19 A A 22 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog41 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 66 N3 ? ? A G 19 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 66 O2 ? ? A G 19 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 66 N4 ? ? A G 19 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 20 N3 ? ? ? 1_555 A G 65 O6 ? ? A U 20 A G 65 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A U 20 O2 ? ? ? 1_555 A G 65 N1 ? ? A U 20 A G 65 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog46 hydrog ? ? A A 23 N6 ? ? ? 1_555 A A 55 N1 ? ? A A 23 A A 55 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog47 hydrog ? ? A A 23 N7 ? ? ? 1_555 A A 55 N6 ? ? A A 23 A A 55 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog48 hydrog ? ? A A 23 N1 ? ? ? 1_555 A G 67 N2 ? ? A A 23 A G 67 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog49 hydrog ? ? A G 24 O6 ? ? ? 1_555 A G 54 N1 ? ? A G 24 A G 54 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog50 hydrog ? ? A G 26 N1 ? ? ? 1_555 A A 52 N1 ? ? A G 26 A A 52 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog51 hydrog ? ? A G 26 O6 ? ? ? 1_555 A A 52 N6 ? ? A G 26 A A 52 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog52 hydrog ? ? A U 27 N3 ? ? ? 1_555 A A 51 N1 ? ? A U 27 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A U 27 O4 ? ? ? 1_555 A A 51 N6 ? ? A U 27 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 50 N3 ? ? A G 28 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 50 O2 ? ? A G 28 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 50 N4 ? ? A G 28 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A U 29 N3 ? ? ? 1_555 A A 49 N1 ? ? A U 29 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A U 29 O4 ? ? ? 1_555 A A 49 N6 ? ? A U 29 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 30 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 30 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 30 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A U 31 N3 ? ? ? 1_555 A A 47 N1 ? ? A U 31 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A U 31 O4 ? ? ? 1_555 A A 47 N6 ? ? A U 31 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 46 N3 ? ? A G 32 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 46 O2 ? ? A G 32 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 46 N4 ? ? A G 32 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A A 33 N1 ? ? ? 1_555 A U 45 N3 ? ? A A 33 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A A 33 N6 ? ? ? 1_555 A U 45 O4 ? ? A A 33 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A A 34 N1 ? ? ? 1_555 A G 44 N1 ? ? A A 34 A G 44 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog70 hydrog ? ? A A 34 N6 ? ? ? 1_555 A G 44 O6 ? ? A A 34 A G 44 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog71 hydrog ? ? A U 35 N3 ? ? ? 1_555 A U 42 O4 ? ? A U 35 A U 42 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog72 hydrog ? ? A G 37 N1 ? ? ? 1_555 A C 83 N3 ? ? A G 37 A C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A G 37 N2 ? ? ? 1_555 A C 83 O2 ? ? A G 37 A C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A G 37 O6 ? ? ? 1_555 A C 83 N4 ? ? A G 37 A C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A G 38 N1 ? ? ? 1_555 A C 82 N3 ? ? A G 38 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A G 38 N2 ? ? ? 1_555 A C 82 O2 ? ? A G 38 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 38 O6 ? ? ? 1_555 A C 82 N4 ? ? A G 38 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A A 39 N1 ? ? ? 1_555 A U 81 N3 ? ? A A 39 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A A 39 N6 ? ? ? 1_555 A U 81 O4 ? ? A A 39 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A U 40 N3 ? ? ? 1_555 A A 80 N1 ? ? A U 40 A A 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A U 40 O4 ? ? ? 1_555 A A 80 N6 ? ? A U 40 A A 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 79 N3 ? ? A G 41 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 79 O2 ? ? A G 41 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 79 N4 ? ? A G 41 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A A 56 N3 ? ? ? 1_555 A G 65 N2 ? ? A A 56 A G 65 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog86 hydrog ? ? A G 57 N1 ? ? ? 1_555 A C 64 N3 ? ? A G 57 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A G 57 N2 ? ? ? 1_555 A C 64 O2 ? ? A G 57 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 57 O6 ? ? ? 1_555 A C 64 N4 ? ? A G 57 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 58 N3 ? ? ? 1_555 A G 63 N1 ? ? A C 58 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 58 N4 ? ? ? 1_555 A G 63 O6 ? ? A C 58 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 58 O2 ? ? ? 1_555 A G 63 N2 ? ? A C 58 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 59 N2 ? ? ? 1_555 A A 62 N7 ? ? A G 59 A A 62 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A H4B 101 ? 5 'BINDING SITE FOR RESIDUE H4B A 101' AC2 Software A H4B 102 ? 8 'BINDING SITE FOR RESIDUE H4B A 102' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 5 U A 25 ? U A 25 . ? 1_555 ? 2 AC1 5 G A 26 ? G A 26 . ? 1_555 ? 3 AC1 5 C A 53 ? C A 53 . ? 1_555 ? 4 AC1 5 G A 54 ? G A 54 . ? 1_555 ? 5 AC1 5 G A 68 ? G A 68 . ? 1_555 ? 6 AC2 8 U A 7 ? U A 7 . ? 1_555 ? 7 AC2 8 A A 8 ? A A 8 . ? 1_555 ? 8 AC2 8 U A 35 ? U A 35 . ? 1_555 ? 9 AC2 8 U A 42 ? U A 42 . ? 1_555 ? 10 AC2 8 G A 44 ? G A 44 . ? 1_555 ? 11 AC2 8 G A 78 ? G A 78 . ? 1_555 ? 12 AC2 8 C A 79 ? C A 79 . ? 1_555 ? 13 AC2 8 HOH D . ? HOH A 290 . ? 1_555 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 OP2 A C 85 ? ? O A HOH 332 ? ? 2.08 2 1 OP2 A G 36 ? ? O A HOH 207 ? ? 2.17 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 C _pdbx_validate_rmsd_angle.auth_seq_id_1 79 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 C _pdbx_validate_rmsd_angle.auth_seq_id_2 79 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 N1 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 C _pdbx_validate_rmsd_angle.auth_seq_id_3 79 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 112.80 _pdbx_validate_rmsd_angle.angle_target_value 108.50 _pdbx_validate_rmsd_angle.angle_deviation 4.30 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.70 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 H4B N1 N Y N 111 H4B C2 C Y N 112 H4B N2 N N N 113 H4B N3 N Y N 114 H4B C4 C Y N 115 H4B O4 O N N 116 H4B C4A C Y N 117 H4B C8A C Y N 118 H4B N5 N N N 119 H4B N8 N N N 120 H4B C6 C N R 121 H4B C7 C N N 122 H4B C9 C N R 123 H4B O9 O N N 124 H4B C10 C N S 125 H4B C11 C N N 126 H4B O10 O N N 127 H4B HN21 H N N 128 H4B HN22 H N N 129 H4B HN3 H N N 130 H4B HN5 H N N 131 H4B HN8 H N N 132 H4B H6 H N N 133 H4B H71 H N N 134 H4B H72 H N N 135 H4B H9 H N N 136 H4B HO9 H N N 137 H4B H10 H N N 138 H4B H111 H N N 139 H4B H112 H N N 140 H4B H113 H N N 141 H4B HO0 H N N 142 HOH O O N N 143 HOH H1 H N N 144 HOH H2 H N N 145 U OP3 O N N 146 U P P N N 147 U OP1 O N N 148 U OP2 O N N 149 U "O5'" O N N 150 U "C5'" C N N 151 U "C4'" C N R 152 U "O4'" O N N 153 U "C3'" C N S 154 U "O3'" O N N 155 U "C2'" C N R 156 U "O2'" O N N 157 U "C1'" C N R 158 U N1 N N N 159 U C2 C N N 160 U O2 O N N 161 U N3 N N N 162 U C4 C N N 163 U O4 O N N 164 U C5 C N N 165 U C6 C N N 166 U HOP3 H N N 167 U HOP2 H N N 168 U "H5'" H N N 169 U "H5''" H N N 170 U "H4'" H N N 171 U "H3'" H N N 172 U "HO3'" H N N 173 U "H2'" H N N 174 U "HO2'" H N N 175 U "H1'" H N N 176 U H3 H N N 177 U H5 H N N 178 U H6 H N N 179 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 H4B N1 C2 doub Y N 116 H4B N1 C8A sing Y N 117 H4B C2 N2 sing N N 118 H4B C2 N3 sing Y N 119 H4B N2 HN21 sing N N 120 H4B N2 HN22 sing N N 121 H4B N3 C4 sing Y N 122 H4B N3 HN3 sing N N 123 H4B C4 O4 doub N N 124 H4B C4 C4A sing Y N 125 H4B C4A C8A doub Y N 126 H4B C4A N5 sing N N 127 H4B C8A N8 sing N N 128 H4B N5 C6 sing N N 129 H4B N5 HN5 sing N N 130 H4B N8 C7 sing N N 131 H4B N8 HN8 sing N N 132 H4B C6 C7 sing N N 133 H4B C6 C9 sing N N 134 H4B C6 H6 sing N N 135 H4B C7 H71 sing N N 136 H4B C7 H72 sing N N 137 H4B C9 O9 sing N N 138 H4B C9 C10 sing N N 139 H4B C9 H9 sing N N 140 H4B O9 HO9 sing N N 141 H4B C10 C11 sing N N 142 H4B C10 O10 sing N N 143 H4B C10 H10 sing N N 144 H4B C11 H111 sing N N 145 H4B C11 H112 sing N N 146 H4B C11 H113 sing N N 147 H4B O10 HO0 sing N N 148 HOH O H1 sing N N 149 HOH O H2 sing N N 150 U OP3 P sing N N 151 U OP3 HOP3 sing N N 152 U P OP1 doub N N 153 U P OP2 sing N N 154 U P "O5'" sing N N 155 U OP2 HOP2 sing N N 156 U "O5'" "C5'" sing N N 157 U "C5'" "C4'" sing N N 158 U "C5'" "H5'" sing N N 159 U "C5'" "H5''" sing N N 160 U "C4'" "O4'" sing N N 161 U "C4'" "C3'" sing N N 162 U "C4'" "H4'" sing N N 163 U "O4'" "C1'" sing N N 164 U "C3'" "O3'" sing N N 165 U "C3'" "C2'" sing N N 166 U "C3'" "H3'" sing N N 167 U "O3'" "HO3'" sing N N 168 U "C2'" "O2'" sing N N 169 U "C2'" "C1'" sing N N 170 U "C2'" "H2'" sing N N 171 U "O2'" "HO2'" sing N N 172 U "C1'" N1 sing N N 173 U "C1'" "H1'" sing N N 174 U N1 C2 sing N N 175 U N1 C6 sing N N 176 U C2 O2 doub N N 177 U C2 N3 sing N N 178 U N3 C4 sing N N 179 U N3 H3 sing N N 180 U C4 O4 doub N N 181 U C4 C5 sing N N 182 U C5 C6 doub N N 183 U C5 H5 sing N N 184 U C6 H6 sing N N 185 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 4LVX 'double helix' 4LVX 'a-form double helix' 4LVX 'bulge loop' 4LVX 'mismatched base pair' 4LVX 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 88 1_555 -0.614 -0.180 -0.102 -4.642 -5.348 -2.745 1 A_G1:C88_A A 1 ? A 88 ? 19 1 1 A G 2 1_555 A C 87 1_555 -0.357 -0.123 -0.495 -11.762 -15.476 5.442 2 A_G2:C87_A A 2 ? A 87 ? 19 1 1 A A 3 1_555 A U 86 1_555 -0.134 -0.522 -0.079 -4.350 -15.032 -2.977 3 A_A3:U86_A A 3 ? A 86 ? 20 1 1 A G 4 1_555 A C 85 1_555 -0.336 -0.258 -0.110 -14.286 -19.707 -3.937 4 A_G4:C85_A A 4 ? A 85 ? 19 1 1 A A 5 1_555 A G 84 1_555 0.200 1.477 -0.269 -17.087 -10.945 -14.987 5 A_A5:G84_A A 5 ? A 84 ? 8 1 1 A G 37 1_555 A C 83 1_555 -0.488 -0.163 -0.257 -10.205 -8.676 2.878 6 A_G37:C83_A A 37 ? A 83 ? 19 1 1 A G 38 1_555 A C 82 1_555 -0.309 -0.261 -0.304 -11.358 -5.092 0.391 7 A_G38:C82_A A 38 ? A 82 ? 19 1 1 A A 39 1_555 A U 81 1_555 0.242 -0.212 -0.096 -7.105 -5.751 -0.668 8 A_A39:U81_A A 39 ? A 81 ? 20 1 1 A U 40 1_555 A A 80 1_555 0.162 -0.166 0.121 -14.030 -19.147 6.658 9 A_U40:A80_A A 40 ? A 80 ? 20 1 1 A G 41 1_555 A C 79 1_555 -0.230 0.002 -0.494 -38.280 -12.065 0.700 10 A_G41:C79_A A 41 ? A 79 ? 19 1 1 A U 42 1_555 A U 35 1_555 -3.815 -0.294 -0.254 10.034 -3.435 -100.038 11 A_U42:U35_A A 42 ? A 35 ? ? 4 1 A G 44 1_555 A A 34 1_555 -0.184 1.487 -0.356 3.476 -15.547 -21.802 12 A_G44:A34_A A 44 ? A 34 ? 8 1 1 A U 45 1_555 A A 33 1_555 0.058 -0.096 -0.054 4.344 -10.571 -2.424 13 A_U45:A33_A A 45 ? A 33 ? 20 1 1 A C 46 1_555 A G 32 1_555 0.055 -0.234 0.080 3.765 -11.202 -1.164 14 A_C46:G32_A A 46 ? A 32 ? 19 1 1 A A 47 1_555 A U 31 1_555 -0.005 -0.093 -0.006 4.072 -12.093 2.909 15 A_A47:U31_A A 47 ? A 31 ? 20 1 1 A C 48 1_555 A G 30 1_555 0.212 -0.087 0.008 14.085 -18.192 -0.159 16 A_C48:G30_A A 48 ? A 30 ? 19 1 1 A A 49 1_555 A U 29 1_555 0.122 -0.175 -0.012 6.350 -15.179 -0.242 17 A_A49:U29_A A 49 ? A 29 ? 20 1 1 A C 50 1_555 A G 28 1_555 0.264 -0.314 -0.335 8.538 -18.634 2.997 18 A_C50:G28_A A 50 ? A 28 ? 19 1 1 A A 51 1_555 A U 27 1_555 0.034 -0.019 -0.205 -10.113 -13.668 2.887 19 A_A51:U27_A A 51 ? A 27 ? 20 1 1 A A 52 1_555 A G 26 1_555 0.069 1.471 -0.551 -9.703 -14.680 -12.448 20 A_A52:G26_A A 52 ? A 26 ? 8 1 1 A C 18 1_555 A G 67 1_555 0.114 -0.090 0.020 3.667 -13.749 -2.234 21 A_C18:G67_A A 18 ? A 67 ? 19 1 1 A A 23 1_555 A A 55 1_555 -4.087 1.699 -0.325 -13.462 -8.718 -116.438 22 A_A23:A55_A A 23 ? A 55 ? 5 4 1 A G 24 1_555 A G 54 1_555 -3.870 0.938 0.561 11.620 -9.157 -59.895 23 A_G24:G54_A A 24 ? A 54 ? ? 1 1 A G 19 1_555 A C 66 1_555 -0.209 -0.168 0.122 -7.205 -26.963 0.309 24 A_G19:C66_A A 19 ? A 66 ? 19 1 1 A U 20 1_555 A G 65 1_555 2.051 -0.513 0.190 -6.216 -14.716 -9.890 25 A_U20:G65_A A 20 ? A 65 ? 28 1 1 A G 57 1_555 A C 64 1_555 -0.277 -0.090 -0.050 -8.672 -7.969 0.739 26 A_G57:C64_A A 57 ? A 64 ? 19 1 1 A C 58 1_555 A G 63 1_555 0.239 -0.140 -0.086 3.588 -4.131 -0.581 27 A_C58:G63_A A 58 ? A 63 ? 19 1 1 A G 59 1_555 A A 62 1_555 8.092 -4.838 0.170 8.928 -6.262 -55.605 28 A_G59:A62_A A 59 ? A 62 ? ? ? 1 A A 8 1_555 A G 78 1_555 -7.162 -5.006 0.222 -14.832 0.074 -22.443 29 A_A8:G78_A A 8 ? A 78 ? ? 10 1 A G 9 1_555 A U 77 1_555 -2.578 -0.720 -0.047 0.736 -2.926 0.463 30 A_G9:U77_A A 9 ? A 77 ? 28 1 1 A A 10 1_555 A U 76 1_555 0.303 -0.133 -0.029 2.646 -11.728 4.388 31 A_A10:U76_A A 10 ? A 76 ? 20 1 1 A U 11 1_555 A A 75 1_555 -0.160 -0.113 -0.049 3.082 -12.716 -9.569 32 A_U11:A75_A A 11 ? A 75 ? 20 1 1 A G 12 1_555 A C 74 1_555 -0.032 -0.430 0.282 -7.160 -15.213 -4.720 33 A_G12:C74_A A 12 ? A 74 ? 19 1 1 A A 13 1_555 A U 73 1_555 0.372 -0.413 0.079 -3.953 -14.784 3.244 34 A_A13:U73_A A 13 ? A 73 ? 20 1 1 A U 14 1_555 A A 72 1_555 -0.347 -0.211 0.296 -11.222 -20.548 0.844 35 A_U14:A72_A A 14 ? A 72 ? 20 1 1 A U 15 1_555 A A 71 1_555 0.101 -0.059 0.245 -4.887 -15.962 4.220 36 A_U15:A71_A A 15 ? A 71 ? 20 1 1 A C 16 1_555 A G 70 1_555 0.266 -0.077 0.065 4.548 -5.983 -0.977 37 A_C16:G70_A A 16 ? A 70 ? 19 1 1 A G 17 1_555 A U 69 1_555 -2.285 -0.598 -0.086 -0.275 -11.010 0.191 38 A_G17:U69_A A 17 ? A 69 ? 28 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 88 1_555 A G 2 1_555 A C 87 1_555 -0.093 -1.710 3.529 2.866 5.217 36.147 -3.468 0.558 3.243 8.338 -4.580 36.618 1 AA_G1G2:C87C88_AA A 1 ? A 88 ? A 2 ? A 87 ? 1 A G 2 1_555 A C 87 1_555 A A 3 1_555 A U 86 1_555 0.004 -1.429 3.097 -1.105 4.816 30.576 -3.526 -0.203 2.843 9.058 2.078 30.963 2 AA_G2A3:U86C87_AA A 2 ? A 87 ? A 3 ? A 86 ? 1 A A 3 1_555 A U 86 1_555 A G 4 1_555 A C 85 1_555 0.446 -1.752 3.428 3.446 9.360 32.955 -4.401 -0.225 2.868 16.048 -5.908 34.392 3 AA_A3G4:C85U86_AA A 3 ? A 86 ? A 4 ? A 85 ? 1 A G 4 1_555 A C 85 1_555 A A 5 1_555 A G 84 1_555 -0.837 -1.527 3.222 5.169 3.097 36.746 -2.783 1.964 2.948 4.872 -8.132 37.220 4 AA_G4A5:G84C85_AA A 4 ? A 85 ? A 5 ? A 84 ? 1 A A 5 1_555 A G 84 1_555 A G 37 1_555 A C 83 1_555 -1.827 -3.337 3.442 10.953 5.568 48.374 -4.344 2.923 2.620 6.670 -13.121 49.819 5 AA_A5G37:C83G84_AA A 5 ? A 84 ? A 37 ? A 83 ? 1 A G 37 1_555 A C 83 1_555 A G 38 1_555 A C 82 1_555 -0.777 -1.775 3.262 -2.591 6.156 35.076 -3.752 0.908 2.966 10.101 4.252 35.686 6 AA_G37G38:C82C83_AA A 37 ? A 83 ? A 38 ? A 82 ? 1 A G 38 1_555 A C 82 1_555 A A 39 1_555 A U 81 1_555 -0.751 -1.783 3.098 -1.354 10.653 28.444 -5.239 1.201 2.327 20.769 2.639 30.365 7 AA_G38A39:U81C82_AA A 38 ? A 82 ? A 39 ? A 81 ? 1 A A 39 1_555 A U 81 1_555 A U 40 1_555 A A 80 1_555 1.168 -1.532 3.423 2.165 16.288 32.219 -4.678 -1.594 2.463 27.249 -3.623 36.068 8 AA_A39U40:A80U81_AA A 39 ? A 81 ? A 40 ? A 80 ? 1 A U 40 1_555 A A 80 1_555 A G 41 1_555 A C 79 1_555 1.579 -0.769 3.729 15.858 13.152 41.336 -2.347 -0.378 3.680 17.394 -20.972 45.984 9 AA_U40G41:C79A80_AA A 40 ? A 80 ? A 41 ? A 79 ? 1 A G 41 1_555 A C 79 1_555 A U 42 1_555 A U 35 1_555 -2.901 1.351 2.946 -16.376 8.258 44.965 0.950 2.153 3.899 10.305 20.436 48.381 10 AA_G41U42:U35C79_AA A 41 ? A 79 ? A 42 ? A 35 ? 1 A U 42 1_555 A U 35 1_555 A G 44 1_555 A A 34 1_555 1.799 -2.621 3.348 -2.616 -0.628 61.688 -2.524 -1.877 3.301 -0.612 2.550 61.741 11 AA_U42G44:A34U35_AA A 42 ? A 35 ? A 44 ? A 34 ? 1 A G 44 1_555 A A 34 1_555 A U 45 1_555 A A 33 1_555 0.955 -1.905 3.170 -3.924 1.165 34.468 -3.363 -2.169 2.983 1.957 6.593 34.702 12 AA_G44U45:A33A34_AA A 44 ? A 34 ? A 45 ? A 33 ? 1 A U 45 1_555 A A 33 1_555 A C 46 1_555 A G 32 1_555 0.469 -1.868 3.316 -1.356 1.243 34.165 -3.372 -1.010 3.227 2.114 2.306 34.213 13 AA_U45C46:G32A33_AA A 45 ? A 33 ? A 46 ? A 32 ? 1 A C 46 1_555 A G 32 1_555 A A 47 1_555 A U 31 1_555 -0.718 -1.489 3.189 0.468 5.127 29.913 -3.811 1.461 2.889 9.840 -0.899 30.343 14 AA_C46A47:U31G32_AA A 46 ? A 32 ? A 47 ? A 31 ? 1 A A 47 1_555 A U 31 1_555 A C 48 1_555 A G 30 1_555 0.135 -1.273 3.063 -0.007 4.453 32.555 -2.945 -0.240 2.868 7.897 0.013 32.850 15 AA_A47C48:G30U31_AA A 47 ? A 31 ? A 48 ? A 30 ? 1 A C 48 1_555 A G 30 1_555 A A 49 1_555 A U 29 1_555 -0.526 -1.413 3.416 0.011 11.699 32.928 -4.085 0.879 2.769 19.875 -0.019 34.890 16 AA_C48A49:U29G30_AA A 48 ? A 30 ? A 49 ? A 29 ? 1 A A 49 1_555 A U 29 1_555 A C 50 1_555 A G 28 1_555 0.361 -1.202 3.201 2.770 9.317 31.134 -3.656 -0.193 2.757 16.851 -5.010 32.581 17 AA_A49C50:G28U29_AA A 49 ? A 29 ? A 50 ? A 28 ? 1 A C 50 1_555 A G 28 1_555 A A 51 1_555 A U 27 1_555 0.327 -1.812 3.695 0.655 15.768 31.765 -5.329 -0.440 2.547 26.837 -1.115 35.378 18 AA_C50A51:U27G28_AA A 50 ? A 28 ? A 51 ? A 27 ? 1 A A 51 1_555 A U 27 1_555 A A 52 1_555 A G 26 1_555 -0.879 -1.986 3.247 4.051 5.539 32.221 -4.379 2.192 2.749 9.841 -7.197 32.925 19 AA_A51A52:G26U27_AA A 51 ? A 27 ? A 52 ? A 26 ? 1 A C 18 1_555 A G 67 1_555 A A 23 1_555 A A 55 1_555 -0.574 1.232 6.830 38.194 -136.557 33.844 3.473 1.092 0.816 -81.131 -22.692 143.511 20 AA_C18A23:A55G67_AA A 18 ? A 67 ? A 23 ? A 55 ? 1 A A 23 1_555 A A 55 1_555 A G 24 1_555 A G 54 1_555 3.094 -2.150 2.904 -6.765 -2.114 34.474 -3.300 -5.946 2.396 -3.521 11.267 35.173 21 AA_A23G24:G54A55_AA A 23 ? A 55 ? A 24 ? A 54 ? 1 A G 19 1_555 A C 66 1_555 A U 20 1_555 A G 65 1_555 -0.328 -1.042 3.097 0.794 3.799 45.924 -1.635 0.483 3.000 4.859 -1.016 46.079 22 AA_G19U20:G65C66_AA A 19 ? A 66 ? A 20 ? A 65 ? 1 A U 20 1_555 A G 65 1_555 A G 57 1_555 A C 64 1_555 -1.823 -2.234 3.104 2.905 6.993 32.805 -4.837 3.556 2.424 12.179 -5.060 33.645 23 AA_U20G57:C64G65_AA A 20 ? A 65 ? A 57 ? A 64 ? 1 A G 57 1_555 A C 64 1_555 A C 58 1_555 A G 63 1_555 0.888 -2.219 3.088 1.814 -1.424 25.808 -4.566 -1.493 3.257 -3.180 -4.051 25.909 24 AA_G57C58:G63C64_AA A 57 ? A 64 ? A 58 ? A 63 ? 1 A C 58 1_555 A G 63 1_555 A G 59 1_555 A A 62 1_555 -4.920 -1.989 3.249 -1.778 1.964 54.761 -2.278 5.237 3.327 2.134 1.931 54.820 25 AA_C58G59:A62G63_AA A 58 ? A 63 ? A 59 ? A 62 ? 1 A A 8 1_555 A G 78 1_555 A G 9 1_555 A U 77 1_555 2.206 -1.561 2.906 0.460 5.699 43.353 -2.567 -2.925 2.712 7.674 -0.620 43.710 26 AA_A8G9:U77G78_AA A 8 ? A 78 ? A 9 ? A 77 ? 1 A G 9 1_555 A U 77 1_555 A A 10 1_555 A U 76 1_555 -0.488 -1.546 3.231 -2.387 4.254 41.830 -2.578 0.440 3.089 5.934 3.330 42.101 27 AA_G9A10:U76U77_AA A 9 ? A 77 ? A 10 ? A 76 ? 1 A A 10 1_555 A U 76 1_555 A U 11 1_555 A A 75 1_555 -0.601 -1.433 3.175 0.413 6.568 31.561 -3.666 1.151 2.820 11.913 -0.749 32.223 28 AA_A10U11:A75U76_AA A 10 ? A 76 ? A 11 ? A 75 ? 1 A U 11 1_555 A A 75 1_555 A G 12 1_555 A C 74 1_555 0.257 -1.601 3.298 -0.741 15.678 33.300 -4.482 -0.500 2.331 25.661 1.213 36.718 29 AA_U11G12:C74A75_AA A 11 ? A 75 ? A 12 ? A 74 ? 1 A G 12 1_555 A C 74 1_555 A A 13 1_555 A U 73 1_555 -0.270 -1.553 3.229 2.273 3.586 36.118 -2.969 0.738 3.044 5.759 -3.651 36.359 30 AA_G12A13:U73C74_AA A 12 ? A 74 ? A 13 ? A 73 ? 1 A A 13 1_555 A U 73 1_555 A U 14 1_555 A A 72 1_555 -0.040 -1.127 3.449 -0.505 12.569 25.773 -5.066 -0.031 2.625 26.277 1.055 28.632 31 AA_A13U14:A72U73_AA A 13 ? A 73 ? A 14 ? A 72 ? 1 A U 14 1_555 A A 72 1_555 A U 15 1_555 A A 71 1_555 0.639 -0.951 2.984 1.191 7.420 36.010 -2.405 -0.869 2.760 11.844 -1.901 36.760 32 AA_U14U15:A71A72_AA A 14 ? A 72 ? A 15 ? A 71 ? 1 A U 15 1_555 A A 71 1_555 A C 16 1_555 A G 70 1_555 -0.341 -0.962 3.064 -0.446 3.274 31.492 -2.320 0.549 2.955 6.012 0.820 31.660 33 AA_U15C16:G70A71_AA A 15 ? A 71 ? A 16 ? A 70 ? 1 A C 16 1_555 A G 70 1_555 A G 17 1_555 A U 69 1_555 1.827 -2.401 3.258 3.545 7.121 20.858 -8.665 -3.498 2.578 18.811 -9.363 22.308 34 AA_C16G17:U69G70_AA A 16 ? A 70 ? A 17 ? A 69 ? # _atom_sites.entry_id 4LVX _atom_sites.fract_transf_matrix[1][1] 0.037051 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.014573 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.006327 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_