data_4LVW # _entry.id 4LVW # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 4LVW pdb_00004lvw 10.2210/pdb4lvw/pdb NDB NA2640 ? ? RCSB RCSB081151 ? ? WWPDB D_1000081151 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2014-03-19 2 'Structure model' 1 1 2024-02-28 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 2 'Structure model' 'Derived calculations' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' database_2 4 2 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' 3 2 'Structure model' '_struct_site.pdbx_auth_asym_id' 4 2 'Structure model' '_struct_site.pdbx_auth_comp_id' 5 2 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 4LVW _pdbx_database_status.recvd_initial_deposition_date 2013-07-26 _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.SG_entry ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.details _pdbx_database_related.content_type PDB 3SD3 . unspecified PDB 4LVV . unspecified PDB 4LVX . unspecified PDB 4LVY . unspecified PDB 4LVZ . unspecified PDB 4LW0 . unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Trausch, J.J.' 1 'Batey, R.T.' 2 # loop_ _citation.id _citation.title _citation.journal_abbrev _citation.journal_volume _citation.page_first _citation.page_last _citation.year _citation.journal_id_ASTM _citation.country _citation.journal_id_ISSN _citation.journal_id_CSD _citation.book_publisher _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_DOI primary 'A Disconnect between High-Affinity Binding and Efficient Regulation by Antifolates and Purines in the Tetrahydrofolate Riboswitch.' Chem.Biol. 21 205 216 2014 CBOLE2 UK 1074-5521 2050 ? 24388757 10.1016/j.chembiol.2013.11.012 1 'The structure of a tetrahydrofolate-sensing riboswitch reveals two ligand binding sites in a single aptamer.' Structure 19 1413 1423 2011 STRUE6 UK 0969-2126 2005 ? 21906956 10.1016/j.str.2011.06.019 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Trausch, J.J.' 1 ? primary 'Batey, R.T.' 2 ? 1 'Trausch, J.J.' 3 ? 1 'Ceres, P.' 4 ? 1 'Reyes, F.E.' 5 ? 1 'Batey, R.T.' 6 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'THF riboswitch' 28849.145 1 ? ? ? ? 2 non-polymer syn 7-DEAZAGUANINE 150.138 2 ? ? ? ? 3 water nat water 18.015 223 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCA UCCGCUCCA ; _entity_poly.pdbx_seq_one_letter_code_can ;GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCA UCCGCUCCA ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 7-DEAZAGUANINE 7DG 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 A n 1 6 G n 1 7 U n 1 8 A n 1 9 G n 1 10 A n 1 11 U n 1 12 G n 1 13 A n 1 14 U n 1 15 U n 1 16 C n 1 17 G n 1 18 C n 1 19 G n 1 20 U n 1 21 U n 1 22 A n 1 23 A n 1 24 G n 1 25 U n 1 26 G n 1 27 U n 1 28 G n 1 29 U n 1 30 G n 1 31 U n 1 32 G n 1 33 A n 1 34 A n 1 35 U n 1 36 G n 1 37 G n 1 38 G n 1 39 A n 1 40 U n 1 41 G n 1 42 U n 1 43 C n 1 44 G n 1 45 U n 1 46 C n 1 47 A n 1 48 C n 1 49 A n 1 50 C n 1 51 A n 1 52 A n 1 53 C n 1 54 G n 1 55 A n 1 56 A n 1 57 G n 1 58 C n 1 59 G n 1 60 A n 1 61 G n 1 62 A n 1 63 G n 1 64 C n 1 65 G n 1 66 C n 1 67 G n 1 68 G n 1 69 U n 1 70 G n 1 71 A n 1 72 A n 1 73 U n 1 74 C n 1 75 A n 1 76 U n 1 77 U n 1 78 G n 1 79 C n 1 80 A n 1 81 U n 1 82 C n 1 83 C n 1 84 G n 1 85 C n 1 86 U n 1 87 C n 1 88 C n 1 89 A n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific ? _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id ? _pdbx_entity_src_syn.details 'T7 in vitro transcribed' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 7DG non-polymer . 7-DEAZAGUANINE ? 'C6 H6 N4 O' 150.138 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 A 10 10 10 A A A . n A 1 11 U 11 11 11 U U A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 U 14 14 14 U U A . n A 1 15 U 15 15 15 U U A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 U 21 21 21 U U A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 G 24 24 24 G G A . n A 1 25 U 25 25 25 U U A . n A 1 26 G 26 26 26 G G A . n A 1 27 U 27 27 27 U U A . n A 1 28 G 28 28 28 G G A . n A 1 29 U 29 29 29 U U A . n A 1 30 G 30 30 30 G G A . n A 1 31 U 31 31 31 U U A . n A 1 32 G 32 32 32 G G A . n A 1 33 A 33 33 33 A A A . n A 1 34 A 34 34 34 A A A . n A 1 35 U 35 35 35 U U A . n A 1 36 G 36 36 36 G G A . n A 1 37 G 37 37 37 G G A . n A 1 38 G 38 38 38 G G A . n A 1 39 A 39 39 39 A A A . n A 1 40 U 40 40 40 U U A . n A 1 41 G 41 41 41 G G A . n A 1 42 U 42 42 42 U U A . n A 1 43 C 43 43 43 C C A . n A 1 44 G 44 44 44 G G A . n A 1 45 U 45 45 45 U U A . n A 1 46 C 46 46 46 C C A . n A 1 47 A 47 47 47 A A A . n A 1 48 C 48 48 48 C C A . n A 1 49 A 49 49 49 A A A . n A 1 50 C 50 50 50 C C A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 C 53 53 53 C C A . n A 1 54 G 54 54 54 G G A . n A 1 55 A 55 55 55 A A A . n A 1 56 A 56 56 56 A A A . n A 1 57 G 57 57 57 G G A . n A 1 58 C 58 58 58 C C A . n A 1 59 G 59 59 59 G G A . n A 1 60 A 60 60 60 A A A . n A 1 61 G 61 61 61 G G A . n A 1 62 A 62 62 62 A A A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 G 65 65 65 G G A . n A 1 66 C 66 66 66 C C A . n A 1 67 G 67 67 67 G G A . n A 1 68 G 68 68 68 G G A . n A 1 69 U 69 69 69 U U A . n A 1 70 G 70 70 70 G G A . n A 1 71 A 71 71 71 A A A . n A 1 72 A 72 72 72 A A A . n A 1 73 U 73 73 73 U U A . n A 1 74 C 74 74 74 C C A . n A 1 75 A 75 75 75 A A A . n A 1 76 U 76 76 76 U U A . n A 1 77 U 77 77 77 U U A . n A 1 78 G 78 78 78 G G A . n A 1 79 C 79 79 79 C C A . n A 1 80 A 80 80 80 A A A . n A 1 81 U 81 81 81 U U A . n A 1 82 C 82 82 82 C C A . n A 1 83 C 83 83 83 C C A . n A 1 84 G 84 84 84 G G A . n A 1 85 C 85 85 85 C C A . n A 1 86 U 86 86 86 U U A . n A 1 87 C 87 87 87 C C A . n A 1 88 C 88 88 88 C C A . n A 1 89 A 89 89 89 A A A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 7DG 1 101 101 7DG 7DG A . C 2 7DG 1 102 102 7DG 7DG A . D 3 HOH 1 201 201 HOH HOH A . D 3 HOH 2 202 202 HOH HOH A . D 3 HOH 3 203 203 HOH HOH A . D 3 HOH 4 204 204 HOH HOH A . D 3 HOH 5 205 205 HOH HOH A . D 3 HOH 6 206 206 HOH HOH A . D 3 HOH 7 207 207 HOH HOH A . D 3 HOH 8 208 208 HOH HOH A . D 3 HOH 9 209 209 HOH HOH A . D 3 HOH 10 210 210 HOH HOH A . D 3 HOH 11 211 211 HOH HOH A . D 3 HOH 12 212 212 HOH HOH A . D 3 HOH 13 213 213 HOH HOH A . D 3 HOH 14 214 214 HOH HOH A . D 3 HOH 15 215 215 HOH HOH A . D 3 HOH 16 216 216 HOH HOH A . D 3 HOH 17 217 217 HOH HOH A . D 3 HOH 18 218 218 HOH HOH A . D 3 HOH 19 219 219 HOH HOH A . D 3 HOH 20 220 220 HOH HOH A . D 3 HOH 21 221 221 HOH HOH A . D 3 HOH 22 222 222 HOH HOH A . D 3 HOH 23 223 223 HOH HOH A . D 3 HOH 24 224 224 HOH HOH A . D 3 HOH 25 225 225 HOH HOH A . D 3 HOH 26 226 226 HOH HOH A . D 3 HOH 27 227 227 HOH HOH A . D 3 HOH 28 228 228 HOH HOH A . D 3 HOH 29 229 229 HOH HOH A . D 3 HOH 30 230 230 HOH HOH A . D 3 HOH 31 231 231 HOH HOH A . D 3 HOH 32 232 232 HOH HOH A . D 3 HOH 33 233 233 HOH HOH A . D 3 HOH 34 234 234 HOH HOH A . D 3 HOH 35 235 235 HOH HOH A . D 3 HOH 36 236 236 HOH HOH A . D 3 HOH 37 237 237 HOH HOH A . D 3 HOH 38 238 238 HOH HOH A . D 3 HOH 39 239 239 HOH HOH A . D 3 HOH 40 240 240 HOH HOH A . D 3 HOH 41 241 241 HOH HOH A . D 3 HOH 42 242 242 HOH HOH A . D 3 HOH 43 243 243 HOH HOH A . D 3 HOH 44 244 244 HOH HOH A . D 3 HOH 45 245 245 HOH HOH A . D 3 HOH 46 246 246 HOH HOH A . D 3 HOH 47 247 247 HOH HOH A . D 3 HOH 48 248 248 HOH HOH A . D 3 HOH 49 249 249 HOH HOH A . D 3 HOH 50 250 250 HOH HOH A . D 3 HOH 51 251 251 HOH HOH A . D 3 HOH 52 252 252 HOH HOH A . D 3 HOH 53 253 253 HOH HOH A . D 3 HOH 54 254 254 HOH HOH A . D 3 HOH 55 255 255 HOH HOH A . D 3 HOH 56 256 256 HOH HOH A . D 3 HOH 57 257 257 HOH HOH A . D 3 HOH 58 258 258 HOH HOH A . D 3 HOH 59 259 259 HOH HOH A . D 3 HOH 60 260 260 HOH HOH A . D 3 HOH 61 261 261 HOH HOH A . D 3 HOH 62 262 262 HOH HOH A . D 3 HOH 63 263 263 HOH HOH A . D 3 HOH 64 264 264 HOH HOH A . D 3 HOH 65 265 265 HOH HOH A . D 3 HOH 66 266 266 HOH HOH A . D 3 HOH 67 267 267 HOH HOH A . D 3 HOH 68 268 268 HOH HOH A . D 3 HOH 69 269 269 HOH HOH A . D 3 HOH 70 270 270 HOH HOH A . D 3 HOH 71 271 271 HOH HOH A . D 3 HOH 72 272 272 HOH HOH A . D 3 HOH 73 273 273 HOH HOH A . D 3 HOH 74 274 274 HOH HOH A . D 3 HOH 75 275 275 HOH HOH A . D 3 HOH 76 276 276 HOH HOH A . D 3 HOH 77 277 277 HOH HOH A . D 3 HOH 78 278 278 HOH HOH A . D 3 HOH 79 279 279 HOH HOH A . D 3 HOH 80 280 280 HOH HOH A . D 3 HOH 81 281 281 HOH HOH A . D 3 HOH 82 282 282 HOH HOH A . D 3 HOH 83 283 283 HOH HOH A . D 3 HOH 84 284 284 HOH HOH A . D 3 HOH 85 285 285 HOH HOH A . D 3 HOH 86 286 286 HOH HOH A . D 3 HOH 87 287 287 HOH HOH A . D 3 HOH 88 288 288 HOH HOH A . D 3 HOH 89 289 289 HOH HOH A . D 3 HOH 90 290 290 HOH HOH A . D 3 HOH 91 291 291 HOH HOH A . D 3 HOH 92 292 292 HOH HOH A . D 3 HOH 93 293 293 HOH HOH A . D 3 HOH 94 294 294 HOH HOH A . D 3 HOH 95 295 295 HOH HOH A . D 3 HOH 96 296 296 HOH HOH A . D 3 HOH 97 297 297 HOH HOH A . D 3 HOH 98 298 298 HOH HOH A . D 3 HOH 99 299 299 HOH HOH A . D 3 HOH 100 300 300 HOH HOH A . D 3 HOH 101 301 301 HOH HOH A . D 3 HOH 102 302 302 HOH HOH A . D 3 HOH 103 303 303 HOH HOH A . D 3 HOH 104 304 304 HOH HOH A . D 3 HOH 105 305 305 HOH HOH A . D 3 HOH 106 306 306 HOH HOH A . D 3 HOH 107 307 307 HOH HOH A . D 3 HOH 108 308 308 HOH HOH A . D 3 HOH 109 309 309 HOH HOH A . D 3 HOH 110 310 310 HOH HOH A . D 3 HOH 111 311 311 HOH HOH A . D 3 HOH 112 312 312 HOH HOH A . D 3 HOH 113 313 313 HOH HOH A . D 3 HOH 114 314 314 HOH HOH A . D 3 HOH 115 315 315 HOH HOH A . D 3 HOH 116 316 316 HOH HOH A . D 3 HOH 117 317 317 HOH HOH A . D 3 HOH 118 318 318 HOH HOH A . D 3 HOH 119 319 319 HOH HOH A . D 3 HOH 120 320 320 HOH HOH A . D 3 HOH 121 321 321 HOH HOH A . D 3 HOH 122 322 322 HOH HOH A . D 3 HOH 123 323 323 HOH HOH A . D 3 HOH 124 324 324 HOH HOH A . D 3 HOH 125 325 325 HOH HOH A . D 3 HOH 126 326 326 HOH HOH A . D 3 HOH 127 327 327 HOH HOH A . D 3 HOH 128 328 328 HOH HOH A . D 3 HOH 129 329 329 HOH HOH A . D 3 HOH 130 330 330 HOH HOH A . D 3 HOH 131 331 331 HOH HOH A . D 3 HOH 132 332 332 HOH HOH A . D 3 HOH 133 333 333 HOH HOH A . D 3 HOH 134 334 334 HOH HOH A . D 3 HOH 135 335 335 HOH HOH A . D 3 HOH 136 336 336 HOH HOH A . D 3 HOH 137 337 337 HOH HOH A . D 3 HOH 138 338 338 HOH HOH A . D 3 HOH 139 339 339 HOH HOH A . D 3 HOH 140 340 340 HOH HOH A . D 3 HOH 141 341 341 HOH HOH A . D 3 HOH 142 342 342 HOH HOH A . D 3 HOH 143 343 343 HOH HOH A . D 3 HOH 144 344 344 HOH HOH A . D 3 HOH 145 345 345 HOH HOH A . D 3 HOH 146 346 346 HOH HOH A . D 3 HOH 147 347 347 HOH HOH A . D 3 HOH 148 348 348 HOH HOH A . D 3 HOH 149 349 349 HOH HOH A . D 3 HOH 150 350 350 HOH HOH A . D 3 HOH 151 351 351 HOH HOH A . D 3 HOH 152 352 352 HOH HOH A . D 3 HOH 153 353 353 HOH HOH A . D 3 HOH 154 354 354 HOH HOH A . D 3 HOH 155 355 355 HOH HOH A . D 3 HOH 156 356 356 HOH HOH A . D 3 HOH 157 357 357 HOH HOH A . D 3 HOH 158 358 358 HOH HOH A . D 3 HOH 159 359 359 HOH HOH A . D 3 HOH 160 360 360 HOH HOH A . D 3 HOH 161 361 361 HOH HOH A . D 3 HOH 162 362 362 HOH HOH A . D 3 HOH 163 363 363 HOH HOH A . D 3 HOH 164 364 364 HOH HOH A . D 3 HOH 165 365 365 HOH HOH A . D 3 HOH 166 366 366 HOH HOH A . D 3 HOH 167 367 367 HOH HOH A . D 3 HOH 168 368 368 HOH HOH A . D 3 HOH 169 369 369 HOH HOH A . D 3 HOH 170 370 370 HOH HOH A . D 3 HOH 171 371 371 HOH HOH A . D 3 HOH 172 372 372 HOH HOH A . D 3 HOH 173 373 373 HOH HOH A . D 3 HOH 174 374 374 HOH HOH A . D 3 HOH 175 375 375 HOH HOH A . D 3 HOH 176 376 376 HOH HOH A . D 3 HOH 177 377 377 HOH HOH A . D 3 HOH 178 378 378 HOH HOH A . D 3 HOH 179 379 379 HOH HOH A . D 3 HOH 180 380 380 HOH HOH A . D 3 HOH 181 381 381 HOH HOH A . D 3 HOH 182 382 382 HOH HOH A . D 3 HOH 183 383 383 HOH HOH A . D 3 HOH 184 384 384 HOH HOH A . D 3 HOH 185 385 385 HOH HOH A . D 3 HOH 186 386 386 HOH HOH A . D 3 HOH 187 387 387 HOH HOH A . D 3 HOH 188 388 388 HOH HOH A . D 3 HOH 189 389 389 HOH HOH A . D 3 HOH 190 390 390 HOH HOH A . D 3 HOH 191 391 391 HOH HOH A . D 3 HOH 192 392 392 HOH HOH A . D 3 HOH 193 393 393 HOH HOH A . D 3 HOH 194 394 394 HOH HOH A . D 3 HOH 195 395 395 HOH HOH A . D 3 HOH 196 396 396 HOH HOH A . D 3 HOH 197 397 397 HOH HOH A . D 3 HOH 198 398 398 HOH HOH A . D 3 HOH 199 399 399 HOH HOH A . D 3 HOH 200 400 400 HOH HOH A . D 3 HOH 201 401 401 HOH HOH A . D 3 HOH 202 402 402 HOH HOH A . D 3 HOH 203 403 403 HOH HOH A . D 3 HOH 204 404 404 HOH HOH A . D 3 HOH 205 405 405 HOH HOH A . D 3 HOH 206 406 406 HOH HOH A . D 3 HOH 207 407 407 HOH HOH A . D 3 HOH 208 408 408 HOH HOH A . D 3 HOH 209 409 409 HOH HOH A . D 3 HOH 210 410 410 HOH HOH A . D 3 HOH 211 411 411 HOH HOH A . D 3 HOH 212 412 412 HOH HOH A . D 3 HOH 213 413 413 HOH HOH A . D 3 HOH 214 414 414 HOH HOH A . D 3 HOH 215 415 415 HOH HOH A . D 3 HOH 216 416 416 HOH HOH A . D 3 HOH 217 417 417 HOH HOH A . D 3 HOH 218 418 418 HOH HOH A . D 3 HOH 219 419 419 HOH HOH A . D 3 HOH 220 420 420 HOH HOH A . D 3 HOH 221 421 421 HOH HOH A . D 3 HOH 222 422 422 HOH HOH A . D 3 HOH 223 423 423 HOH HOH A . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal BOS 'data collection' . ? 1 PHASER phasing . ? 2 PHENIX refinement '(phenix.refine: 1.8_1069)' ? 3 MOSFLM 'data reduction' . ? 4 SCALA 'data scaling' . ? 5 # _cell.entry_id 4LVW _cell.length_a 26.780 _cell.length_b 68.480 _cell.length_c 156.500 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 4 _cell.pdbx_unique_axis ? _cell.length_a_esd ? _cell.length_b_esd ? _cell.length_c_esd ? _cell.angle_alpha_esd ? _cell.angle_beta_esd ? _cell.angle_gamma_esd ? # _symmetry.entry_id 4LVW _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall ? # _exptl.entry_id 4LVW _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.49 _exptl_crystal.density_percent_sol 50.54 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.preparation ? # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.temp 303 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.pdbx_details ;2,4-methyl-pentanediol, spermine, sodium cacodylate, sodium chloride, dithiothreitol, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 303K ; # _diffrn.id 1 _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector CCD _diffrn_detector.type 'ADSC QUANTUM 315r' _diffrn_detector.pdbx_collection_date 2013-01-19 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.1051 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'ALS BEAMLINE 5.0.2' _diffrn_source.pdbx_synchrotron_site ALS _diffrn_source.pdbx_synchrotron_beamline 5.0.2 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_wavelength_list 1.1051 # _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.entry_id 4LVW _reflns.observed_criterion_sigma_I 1.7 _reflns.observed_criterion_sigma_F 1.7 _reflns.d_resolution_low 41.50 _reflns.d_resolution_high 1.768 _reflns.number_obs ? _reflns.number_all 28064 _reflns.percent_possible_obs 96.3 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI ? _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 3.5 _reflns.R_free_details ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? # _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_ordinal 1 _reflns_shell.d_res_high 1.768 _reflns_shell.d_res_low 1.86 _reflns_shell.percent_possible_all 90.7 _reflns_shell.Rmerge_I_obs 0.471 _reflns_shell.pdbx_Rsym_value 0.387 _reflns_shell.meanI_over_sigI_obs 1.7 _reflns_shell.pdbx_redundancy 3.2 _reflns_shell.percent_possible_obs ? _reflns_shell.number_unique_all ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_unique_obs ? _reflns_shell.pdbx_chi_squared ? # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 4LVW _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 27957 _refine.ls_number_reflns_all 28064 _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 28.625 _refine.ls_d_res_high 1.768 _refine.ls_percent_reflns_obs 95.60 _refine.ls_R_factor_obs 0.2111 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2095 _refine.ls_R_factor_R_free 0.2397 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 5.00 _refine.ls_number_reflns_R_free 1399 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML 0.21 _refine.pdbx_overall_phase_error 28.59 _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.ls_redundancy_reflns_obs ? _refine.overall_SU_R_free ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1913 _refine_hist.pdbx_number_atoms_ligand 22 _refine_hist.number_atoms_solvent 223 _refine_hist.number_atoms_total 2158 _refine_hist.d_res_high 1.768 _refine_hist.d_res_low 28.625 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function f_bond_d 0.004 ? ? 2166 'X-RAY DIFFRACTION' ? f_angle_d 0.966 ? ? 3374 'X-RAY DIFFRACTION' ? f_dihedral_angle_d 12.167 ? ? 1065 'X-RAY DIFFRACTION' ? f_chiral_restr 0.044 ? ? 445 'X-RAY DIFFRACTION' ? f_plane_restr 0.007 ? ? 91 'X-RAY DIFFRACTION' ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_R_work _refine_ls_shell.R_factor_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_all _refine_ls_shell.R_factor_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.number_reflns_obs 'X-RAY DIFFRACTION' . 1.7680 1.8312 2374 0.2881 88.00 0.3272 . . 125 . . . . 'X-RAY DIFFRACTION' . 1.8312 1.9045 2590 0.2876 94.00 0.2917 . . 136 . . . . 'X-RAY DIFFRACTION' . 1.9045 1.9911 2597 0.3115 96.00 0.3998 . . 137 . . . . 'X-RAY DIFFRACTION' . 1.9911 2.0961 2678 0.2644 98.00 0.3245 . . 141 . . . . 'X-RAY DIFFRACTION' . 2.0961 2.2274 2721 0.2566 98.00 0.3237 . . 143 . . . . 'X-RAY DIFFRACTION' . 2.2274 2.3993 2664 0.2575 98.00 0.2686 . . 141 . . . . 'X-RAY DIFFRACTION' . 2.3993 2.6406 2771 0.2508 99.00 0.2876 . . 145 . . . . 'X-RAY DIFFRACTION' . 2.6406 3.0223 2742 0.2337 99.00 0.2647 . . 145 . . . . 'X-RAY DIFFRACTION' . 3.0223 3.8064 2783 0.1758 98.00 0.1968 . . 146 . . . . 'X-RAY DIFFRACTION' . 3.8064 28.6286 2638 0.1652 89.00 0.1905 . . 140 . . . . # _database_PDB_matrix.entry_id 4LVW _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 4LVW _struct.title 'Structure of the THF riboswitch bound to 7-deazaguanine' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 4LVW _struct_keywords.pdbx_keywords RNA _struct_keywords.text ;Aptamers, Nucleotide, Bacillus subtilis, Bacterial Proteins, Base Sequence, Binding Sites, Calorimetry, Folic Acid, Gene Expression Regulation, Bacterial, Guanine, Leucovorin, Ligands, Magnesium, Molecular Sequence Data, Nucleic Acid Conformation, Point Mutation, Protein Binding, Protein Structure, Secondary, RNA, Riboswitch, S-Adenosylmethionine, Streptococcus mutans, Terminator Regions, Genetic, Tetrahydrofolates, Thermodynamics, Transcription, three-way junction, pseudoknot, regulation, ncRNA, mRNA ; # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 4LVW _struct_ref.pdbx_db_accession 4LVW _struct_ref.entity_id 1 _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_seq_one_letter_code ;GGAGAGUAGAUGAUUCGCGUUAAGUGUGUGUGAAUGGGAUGUCGUCACACAACGAAGCGAGAGCGCGGUGAAUCAUUGCA UCCGCUCCA ; _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 4LVW _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 89 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 4LVW _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 89 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 89 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 _struct_biol.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 88 N3 ? ? A G 1 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 88 O2 ? ? A G 1 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 88 N4 ? ? A G 1 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 87 N3 ? ? A G 2 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 87 O2 ? ? A G 2 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 87 N4 ? ? A G 2 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 86 N3 ? ? A A 3 A U 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 86 O4 ? ? A A 3 A U 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 85 N3 ? ? A G 4 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 85 O2 ? ? A G 4 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 85 N4 ? ? A G 4 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A G 84 N1 ? ? A A 5 A G 84 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A G 84 O6 ? ? A A 5 A G 84 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog14 hydrog ? ? A G 6 N2 ? ? ? 1_555 A G 37 O6 ? ? A G 6 A G 37 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog15 hydrog ? ? A A 8 N3 ? ? ? 1_555 A G 44 N2 ? ? A A 8 A G 44 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog16 hydrog ? ? A A 8 N7 ? ? ? 1_555 A G 78 N2 ? ? A A 8 A G 78 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog17 hydrog ? ? A G 9 N1 ? ? ? 1_555 A U 77 O2 ? ? A G 9 A U 77 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog18 hydrog ? ? A G 9 O6 ? ? ? 1_555 A U 77 N3 ? ? A G 9 A U 77 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 76 N3 ? ? A A 10 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 76 O4 ? ? A A 10 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 75 N1 ? ? A U 11 A A 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 75 N6 ? ? A U 11 A A 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 74 N3 ? ? A G 12 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 74 O2 ? ? A G 12 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 74 N4 ? ? A G 12 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 73 N3 ? ? A A 13 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 73 O4 ? ? A A 13 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 72 N1 ? ? A U 14 A A 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 72 N6 ? ? A U 14 A A 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 71 N1 ? ? A U 15 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 71 N6 ? ? A U 15 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 70 N1 ? ? A C 16 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 70 O6 ? ? A C 16 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 70 N2 ? ? A C 16 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 69 O2 ? ? A G 17 A U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A G 17 O6 ? ? ? 1_555 A U 69 N3 ? ? A G 17 A U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog37 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 67 N1 ? ? A C 18 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 67 O6 ? ? A C 18 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 67 N2 ? ? A C 18 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 19 N2 ? ? ? 1_555 A A 22 N1 ? ? A G 19 A A 22 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog41 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 66 N3 ? ? A G 19 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 66 O2 ? ? A G 19 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 66 N4 ? ? A G 19 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 20 N3 ? ? ? 1_555 A G 65 O6 ? ? A U 20 A G 65 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A U 20 O2 ? ? ? 1_555 A G 65 N1 ? ? A U 20 A G 65 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog46 hydrog ? ? A A 23 N6 ? ? ? 1_555 A A 55 N1 ? ? A A 23 A A 55 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog47 hydrog ? ? A A 23 N7 ? ? ? 1_555 A A 55 N6 ? ? A A 23 A A 55 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog48 hydrog ? ? A A 23 N1 ? ? ? 1_555 A G 67 N2 ? ? A A 23 A G 67 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog49 hydrog ? ? A G 24 O6 ? ? ? 1_555 A G 54 N1 ? ? A G 24 A G 54 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog50 hydrog ? ? A G 26 N1 ? ? ? 1_555 A A 52 N1 ? ? A G 26 A A 52 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog51 hydrog ? ? A G 26 O6 ? ? ? 1_555 A A 52 N6 ? ? A G 26 A A 52 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog52 hydrog ? ? A U 27 N3 ? ? ? 1_555 A A 51 N1 ? ? A U 27 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A U 27 O4 ? ? ? 1_555 A A 51 N6 ? ? A U 27 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 50 N3 ? ? A G 28 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 50 O2 ? ? A G 28 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 50 N4 ? ? A G 28 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A U 29 N3 ? ? ? 1_555 A A 49 N1 ? ? A U 29 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A U 29 O4 ? ? ? 1_555 A A 49 N6 ? ? A U 29 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 30 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 30 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 30 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A U 31 N3 ? ? ? 1_555 A A 47 N1 ? ? A U 31 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A U 31 O4 ? ? ? 1_555 A A 47 N6 ? ? A U 31 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 46 N3 ? ? A G 32 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 46 O2 ? ? A G 32 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 46 N4 ? ? A G 32 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A A 33 N1 ? ? ? 1_555 A U 45 N3 ? ? A A 33 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A A 33 N6 ? ? ? 1_555 A U 45 O4 ? ? A A 33 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A A 34 N1 ? ? ? 1_555 A G 44 N1 ? ? A A 34 A G 44 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog70 hydrog ? ? A A 34 N6 ? ? ? 1_555 A G 44 O6 ? ? A A 34 A G 44 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog71 hydrog ? ? A U 35 N3 ? ? ? 1_555 A U 42 O4 ? ? A U 35 A U 42 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog72 hydrog ? ? A G 37 N1 ? ? ? 1_555 A C 83 N3 ? ? A G 37 A C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A G 37 N2 ? ? ? 1_555 A C 83 O2 ? ? A G 37 A C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A G 37 O6 ? ? ? 1_555 A C 83 N4 ? ? A G 37 A C 83 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A G 38 N1 ? ? ? 1_555 A C 82 N3 ? ? A G 38 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A G 38 N2 ? ? ? 1_555 A C 82 O2 ? ? A G 38 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 38 O6 ? ? ? 1_555 A C 82 N4 ? ? A G 38 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A A 39 N1 ? ? ? 1_555 A U 81 N3 ? ? A A 39 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A A 39 N6 ? ? ? 1_555 A U 81 O4 ? ? A A 39 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A U 40 N3 ? ? ? 1_555 A A 80 N1 ? ? A U 40 A A 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A U 40 O4 ? ? ? 1_555 A A 80 N6 ? ? A U 40 A A 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 79 N3 ? ? A G 41 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 79 O2 ? ? A G 41 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 79 N4 ? ? A G 41 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A A 56 N3 ? ? ? 1_555 A G 65 N2 ? ? A A 56 A G 65 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog86 hydrog ? ? A G 57 N1 ? ? ? 1_555 A C 64 N3 ? ? A G 57 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A G 57 N2 ? ? ? 1_555 A C 64 O2 ? ? A G 57 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 57 O6 ? ? ? 1_555 A C 64 N4 ? ? A G 57 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 58 N3 ? ? ? 1_555 A G 63 N1 ? ? A C 58 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 58 N4 ? ? ? 1_555 A G 63 O6 ? ? A C 58 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 58 O2 ? ? ? 1_555 A G 63 N2 ? ? A C 58 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 59 N2 ? ? ? 1_555 A A 62 N7 ? ? A G 59 A A 62 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A 7DG 101 ? 7 'BINDING SITE FOR RESIDUE 7DG A 101' AC2 Software A 7DG 102 ? 5 'BINDING SITE FOR RESIDUE 7DG A 102' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 7 U A 7 ? U A 7 . ? 1_555 ? 2 AC1 7 A A 8 ? A A 8 . ? 1_555 ? 3 AC1 7 U A 35 ? U A 35 . ? 1_555 ? 4 AC1 7 U A 42 ? U A 42 . ? 1_555 ? 5 AC1 7 G A 44 ? G A 44 . ? 1_555 ? 6 AC1 7 G A 78 ? G A 78 . ? 1_555 ? 7 AC1 7 C A 79 ? C A 79 . ? 1_555 ? 8 AC2 5 U A 25 ? U A 25 . ? 1_555 ? 9 AC2 5 G A 26 ? G A 26 . ? 1_555 ? 10 AC2 5 C A 53 ? C A 53 . ? 1_555 ? 11 AC2 5 G A 54 ? G A 54 . ? 1_555 ? 12 AC2 5 G A 68 ? G A 68 . ? 1_555 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 OP2 A G 32 ? ? O A HOH 293 ? ? 2.15 2 1 OP1 A G 36 ? ? O A HOH 407 ? ? 2.17 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 C _pdbx_validate_rmsd_angle.auth_seq_id_1 79 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 C _pdbx_validate_rmsd_angle.auth_seq_id_2 79 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 N1 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 C _pdbx_validate_rmsd_angle.auth_seq_id_3 79 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 113.42 _pdbx_validate_rmsd_angle.angle_target_value 108.50 _pdbx_validate_rmsd_angle.angle_deviation 4.92 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.70 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 7DG N9 N N N 1 7DG C8 C N N 2 7DG C7 C N N 3 7DG C5 C N N 4 7DG C6 C N N 5 7DG O6 O N N 6 7DG N1 N N N 7 7DG C2 C N N 8 7DG N2 N N N 9 7DG N3 N N N 10 7DG C4 C N N 11 7DG H8 H N N 12 7DG H71 H N N 13 7DG H72 H N N 14 7DG HN1 H N N 15 7DG HN21 H N N 16 7DG HN22 H N N 17 A OP3 O N N 18 A P P N N 19 A OP1 O N N 20 A OP2 O N N 21 A "O5'" O N N 22 A "C5'" C N N 23 A "C4'" C N R 24 A "O4'" O N N 25 A "C3'" C N S 26 A "O3'" O N N 27 A "C2'" C N R 28 A "O2'" O N N 29 A "C1'" C N R 30 A N9 N Y N 31 A C8 C Y N 32 A N7 N Y N 33 A C5 C Y N 34 A C6 C Y N 35 A N6 N N N 36 A N1 N Y N 37 A C2 C Y N 38 A N3 N Y N 39 A C4 C Y N 40 A HOP3 H N N 41 A HOP2 H N N 42 A "H5'" H N N 43 A "H5''" H N N 44 A "H4'" H N N 45 A "H3'" H N N 46 A "HO3'" H N N 47 A "H2'" H N N 48 A "HO2'" H N N 49 A "H1'" H N N 50 A H8 H N N 51 A H61 H N N 52 A H62 H N N 53 A H2 H N N 54 C OP3 O N N 55 C P P N N 56 C OP1 O N N 57 C OP2 O N N 58 C "O5'" O N N 59 C "C5'" C N N 60 C "C4'" C N R 61 C "O4'" O N N 62 C "C3'" C N S 63 C "O3'" O N N 64 C "C2'" C N R 65 C "O2'" O N N 66 C "C1'" C N R 67 C N1 N N N 68 C C2 C N N 69 C O2 O N N 70 C N3 N N N 71 C C4 C N N 72 C N4 N N N 73 C C5 C N N 74 C C6 C N N 75 C HOP3 H N N 76 C HOP2 H N N 77 C "H5'" H N N 78 C "H5''" H N N 79 C "H4'" H N N 80 C "H3'" H N N 81 C "HO3'" H N N 82 C "H2'" H N N 83 C "HO2'" H N N 84 C "H1'" H N N 85 C H41 H N N 86 C H42 H N N 87 C H5 H N N 88 C H6 H N N 89 G OP3 O N N 90 G P P N N 91 G OP1 O N N 92 G OP2 O N N 93 G "O5'" O N N 94 G "C5'" C N N 95 G "C4'" C N R 96 G "O4'" O N N 97 G "C3'" C N S 98 G "O3'" O N N 99 G "C2'" C N R 100 G "O2'" O N N 101 G "C1'" C N R 102 G N9 N Y N 103 G C8 C Y N 104 G N7 N Y N 105 G C5 C Y N 106 G C6 C N N 107 G O6 O N N 108 G N1 N N N 109 G C2 C N N 110 G N2 N N N 111 G N3 N N N 112 G C4 C Y N 113 G HOP3 H N N 114 G HOP2 H N N 115 G "H5'" H N N 116 G "H5''" H N N 117 G "H4'" H N N 118 G "H3'" H N N 119 G "HO3'" H N N 120 G "H2'" H N N 121 G "HO2'" H N N 122 G "H1'" H N N 123 G H8 H N N 124 G H1 H N N 125 G H21 H N N 126 G H22 H N N 127 HOH O O N N 128 HOH H1 H N N 129 HOH H2 H N N 130 U OP3 O N N 131 U P P N N 132 U OP1 O N N 133 U OP2 O N N 134 U "O5'" O N N 135 U "C5'" C N N 136 U "C4'" C N R 137 U "O4'" O N N 138 U "C3'" C N S 139 U "O3'" O N N 140 U "C2'" C N R 141 U "O2'" O N N 142 U "C1'" C N R 143 U N1 N N N 144 U C2 C N N 145 U O2 O N N 146 U N3 N N N 147 U C4 C N N 148 U O4 O N N 149 U C5 C N N 150 U C6 C N N 151 U HOP3 H N N 152 U HOP2 H N N 153 U "H5'" H N N 154 U "H5''" H N N 155 U "H4'" H N N 156 U "H3'" H N N 157 U "HO3'" H N N 158 U "H2'" H N N 159 U "HO2'" H N N 160 U "H1'" H N N 161 U H3 H N N 162 U H5 H N N 163 U H6 H N N 164 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 7DG N9 C8 doub N N 1 7DG N9 C4 sing N N 2 7DG C8 C7 sing N N 3 7DG C8 H8 sing N N 4 7DG C7 C5 sing N N 5 7DG C7 H71 sing N N 6 7DG C7 H72 sing N N 7 7DG C5 C6 sing N N 8 7DG C5 C4 doub N N 9 7DG C6 O6 doub N N 10 7DG C6 N1 sing N N 11 7DG N1 C2 sing N N 12 7DG N1 HN1 sing N N 13 7DG C2 N2 sing N N 14 7DG C2 N3 doub N N 15 7DG N2 HN21 sing N N 16 7DG N2 HN22 sing N N 17 7DG N3 C4 sing N N 18 A OP3 P sing N N 19 A OP3 HOP3 sing N N 20 A P OP1 doub N N 21 A P OP2 sing N N 22 A P "O5'" sing N N 23 A OP2 HOP2 sing N N 24 A "O5'" "C5'" sing N N 25 A "C5'" "C4'" sing N N 26 A "C5'" "H5'" sing N N 27 A "C5'" "H5''" sing N N 28 A "C4'" "O4'" sing N N 29 A "C4'" "C3'" sing N N 30 A "C4'" "H4'" sing N N 31 A "O4'" "C1'" sing N N 32 A "C3'" "O3'" sing N N 33 A "C3'" "C2'" sing N N 34 A "C3'" "H3'" sing N N 35 A "O3'" "HO3'" sing N N 36 A "C2'" "O2'" sing N N 37 A "C2'" "C1'" sing N N 38 A "C2'" "H2'" sing N N 39 A "O2'" "HO2'" sing N N 40 A "C1'" N9 sing N N 41 A "C1'" "H1'" sing N N 42 A N9 C8 sing Y N 43 A N9 C4 sing Y N 44 A C8 N7 doub Y N 45 A C8 H8 sing N N 46 A N7 C5 sing Y N 47 A C5 C6 sing Y N 48 A C5 C4 doub Y N 49 A C6 N6 sing N N 50 A C6 N1 doub Y N 51 A N6 H61 sing N N 52 A N6 H62 sing N N 53 A N1 C2 sing Y N 54 A C2 N3 doub Y N 55 A C2 H2 sing N N 56 A N3 C4 sing Y N 57 C OP3 P sing N N 58 C OP3 HOP3 sing N N 59 C P OP1 doub N N 60 C P OP2 sing N N 61 C P "O5'" sing N N 62 C OP2 HOP2 sing N N 63 C "O5'" "C5'" sing N N 64 C "C5'" "C4'" sing N N 65 C "C5'" "H5'" sing N N 66 C "C5'" "H5''" sing N N 67 C "C4'" "O4'" sing N N 68 C "C4'" "C3'" sing N N 69 C "C4'" "H4'" sing N N 70 C "O4'" "C1'" sing N N 71 C "C3'" "O3'" sing N N 72 C "C3'" "C2'" sing N N 73 C "C3'" "H3'" sing N N 74 C "O3'" "HO3'" sing N N 75 C "C2'" "O2'" sing N N 76 C "C2'" "C1'" sing N N 77 C "C2'" "H2'" sing N N 78 C "O2'" "HO2'" sing N N 79 C "C1'" N1 sing N N 80 C "C1'" "H1'" sing N N 81 C N1 C2 sing N N 82 C N1 C6 sing N N 83 C C2 O2 doub N N 84 C C2 N3 sing N N 85 C N3 C4 doub N N 86 C C4 N4 sing N N 87 C C4 C5 sing N N 88 C N4 H41 sing N N 89 C N4 H42 sing N N 90 C C5 C6 doub N N 91 C C5 H5 sing N N 92 C C6 H6 sing N N 93 G OP3 P sing N N 94 G OP3 HOP3 sing N N 95 G P OP1 doub N N 96 G P OP2 sing N N 97 G P "O5'" sing N N 98 G OP2 HOP2 sing N N 99 G "O5'" "C5'" sing N N 100 G "C5'" "C4'" sing N N 101 G "C5'" "H5'" sing N N 102 G "C5'" "H5''" sing N N 103 G "C4'" "O4'" sing N N 104 G "C4'" "C3'" sing N N 105 G "C4'" "H4'" sing N N 106 G "O4'" "C1'" sing N N 107 G "C3'" "O3'" sing N N 108 G "C3'" "C2'" sing N N 109 G "C3'" "H3'" sing N N 110 G "O3'" "HO3'" sing N N 111 G "C2'" "O2'" sing N N 112 G "C2'" "C1'" sing N N 113 G "C2'" "H2'" sing N N 114 G "O2'" "HO2'" sing N N 115 G "C1'" N9 sing N N 116 G "C1'" "H1'" sing N N 117 G N9 C8 sing Y N 118 G N9 C4 sing Y N 119 G C8 N7 doub Y N 120 G C8 H8 sing N N 121 G N7 C5 sing Y N 122 G C5 C6 sing N N 123 G C5 C4 doub Y N 124 G C6 O6 doub N N 125 G C6 N1 sing N N 126 G N1 C2 sing N N 127 G N1 H1 sing N N 128 G C2 N2 sing N N 129 G C2 N3 doub N N 130 G N2 H21 sing N N 131 G N2 H22 sing N N 132 G N3 C4 sing N N 133 HOH O H1 sing N N 134 HOH O H2 sing N N 135 U OP3 P sing N N 136 U OP3 HOP3 sing N N 137 U P OP1 doub N N 138 U P OP2 sing N N 139 U P "O5'" sing N N 140 U OP2 HOP2 sing N N 141 U "O5'" "C5'" sing N N 142 U "C5'" "C4'" sing N N 143 U "C5'" "H5'" sing N N 144 U "C5'" "H5''" sing N N 145 U "C4'" "O4'" sing N N 146 U "C4'" "C3'" sing N N 147 U "C4'" "H4'" sing N N 148 U "O4'" "C1'" sing N N 149 U "C3'" "O3'" sing N N 150 U "C3'" "C2'" sing N N 151 U "C3'" "H3'" sing N N 152 U "O3'" "HO3'" sing N N 153 U "C2'" "O2'" sing N N 154 U "C2'" "C1'" sing N N 155 U "C2'" "H2'" sing N N 156 U "O2'" "HO2'" sing N N 157 U "C1'" N1 sing N N 158 U "C1'" "H1'" sing N N 159 U N1 C2 sing N N 160 U N1 C6 sing N N 161 U C2 O2 doub N N 162 U C2 N3 sing N N 163 U N3 C4 sing N N 164 U N3 H3 sing N N 165 U C4 O4 doub N N 166 U C4 C5 sing N N 167 U C5 C6 doub N N 168 U C5 H5 sing N N 169 U C6 H6 sing N N 170 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 4LVW 'double helix' 4LVW 'a-form double helix' 4LVW 'bulge loop' 4LVW 'mismatched base pair' 4LVW 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 88 1_555 -0.378 -0.243 -0.169 -3.587 -3.856 -6.120 1 A_G1:C88_A A 1 ? A 88 ? 19 1 1 A G 2 1_555 A C 87 1_555 -0.249 -0.133 -0.417 -10.080 -13.992 2.349 2 A_G2:C87_A A 2 ? A 87 ? 19 1 1 A A 3 1_555 A U 86 1_555 0.086 -0.053 -0.237 -8.701 -15.901 -0.286 3 A_A3:U86_A A 3 ? A 86 ? 20 1 1 A G 4 1_555 A C 85 1_555 -0.138 -0.081 0.093 -15.359 -22.009 -1.424 4 A_G4:C85_A A 4 ? A 85 ? 19 1 1 A A 5 1_555 A G 84 1_555 -0.110 1.495 -0.309 -18.929 -12.364 -19.721 5 A_A5:G84_A A 5 ? A 84 ? 8 1 1 A G 37 1_555 A C 83 1_555 -0.314 -0.147 -0.340 -7.517 -10.189 0.359 6 A_G37:C83_A A 37 ? A 83 ? 19 1 1 A G 38 1_555 A C 82 1_555 -0.308 -0.152 -0.366 -14.444 -8.779 0.655 7 A_G38:C82_A A 38 ? A 82 ? 19 1 1 A A 39 1_555 A U 81 1_555 0.001 -0.078 -0.067 -7.644 -8.669 0.106 8 A_A39:U81_A A 39 ? A 81 ? 20 1 1 A U 40 1_555 A A 80 1_555 0.339 -0.143 0.230 -10.863 -18.088 4.587 9 A_U40:A80_A A 40 ? A 80 ? 20 1 1 A G 41 1_555 A C 79 1_555 -0.385 0.063 -0.676 -40.542 -11.698 2.155 10 A_G41:C79_A A 41 ? A 79 ? 19 1 1 A U 42 1_555 A U 35 1_555 -3.683 -0.286 -0.597 4.358 -11.237 -94.708 11 A_U42:U35_A A 42 ? A 35 ? ? 4 1 A G 44 1_555 A A 34 1_555 -0.156 1.471 -0.319 5.657 -13.397 -17.903 12 A_G44:A34_A A 44 ? A 34 ? 8 1 1 A U 45 1_555 A A 33 1_555 0.087 -0.213 0.030 7.660 -12.841 -3.366 13 A_U45:A33_A A 45 ? A 33 ? 20 1 1 A C 46 1_555 A G 32 1_555 0.217 -0.134 0.129 5.210 -12.639 1.205 14 A_C46:G32_A A 46 ? A 32 ? 19 1 1 A A 47 1_555 A U 31 1_555 0.062 -0.094 0.127 6.752 -11.876 1.063 15 A_A47:U31_A A 47 ? A 31 ? 20 1 1 A C 48 1_555 A G 30 1_555 0.198 -0.128 0.037 10.755 -15.245 0.543 16 A_C48:G30_A A 48 ? A 30 ? 19 1 1 A A 49 1_555 A U 29 1_555 0.113 -0.119 0.001 4.860 -13.374 0.469 17 A_A49:U29_A A 49 ? A 29 ? 20 1 1 A C 50 1_555 A G 28 1_555 0.329 -0.229 -0.031 8.577 -18.117 3.865 18 A_C50:G28_A A 50 ? A 28 ? 19 1 1 A A 51 1_555 A U 27 1_555 0.201 -0.077 -0.198 -7.421 -13.406 -0.468 19 A_A51:U27_A A 51 ? A 27 ? 20 1 1 A A 52 1_555 A G 26 1_555 -0.038 1.314 -0.746 -10.322 -16.427 -10.417 20 A_A52:G26_A A 52 ? A 26 ? 8 1 1 A C 18 1_555 A G 67 1_555 0.110 -0.117 0.057 1.604 -12.987 -1.539 21 A_C18:G67_A A 18 ? A 67 ? 19 1 1 A A 23 1_555 A A 55 1_555 -4.132 1.485 -0.335 -16.840 -7.052 -113.452 22 A_A23:A55_A A 23 ? A 55 ? 5 4 1 A G 24 1_555 A G 54 1_555 -3.748 1.151 0.432 8.293 -6.410 -60.171 23 A_G24:G54_A A 24 ? A 54 ? ? 1 1 A G 19 1_555 A C 66 1_555 -0.230 -0.221 0.035 -7.760 -27.119 -0.201 24 A_G19:C66_A A 19 ? A 66 ? 19 1 1 A U 20 1_555 A G 65 1_555 2.278 -0.492 0.242 -7.079 -14.002 -9.475 25 A_U20:G65_A A 20 ? A 65 ? 28 1 1 A G 57 1_555 A C 64 1_555 -0.259 -0.137 0.122 -8.154 -8.198 0.227 26 A_G57:C64_A A 57 ? A 64 ? 19 1 1 A C 58 1_555 A G 63 1_555 0.261 -0.141 -0.049 5.080 -4.979 -0.029 27 A_C58:G63_A A 58 ? A 63 ? 19 1 1 A G 59 1_555 A A 62 1_555 8.066 -4.874 0.225 13.270 -5.426 -55.006 28 A_G59:A62_A A 59 ? A 62 ? ? ? 1 A A 8 1_555 A G 78 1_555 -7.180 -5.097 0.211 -13.690 4.120 -16.541 29 A_A8:G78_A A 8 ? A 78 ? ? 10 1 A G 9 1_555 A U 77 1_555 -2.410 -0.629 -0.174 2.671 -2.068 -0.153 30 A_G9:U77_A A 9 ? A 77 ? 28 1 1 A A 10 1_555 A U 76 1_555 -0.066 -0.101 0.017 0.736 -10.043 3.135 31 A_A10:U76_A A 10 ? A 76 ? 20 1 1 A U 11 1_555 A A 75 1_555 -0.249 -0.125 0.061 -1.665 -13.511 2.963 32 A_U11:A75_A A 11 ? A 75 ? 20 1 1 A G 12 1_555 A C 74 1_555 -0.013 -0.471 -0.037 -5.627 -15.763 5.671 33 A_G12:C74_A A 12 ? A 74 ? 22 1 1 A A 13 1_555 A U 73 1_555 0.013 -0.262 0.469 1.836 -7.048 -3.491 34 A_A13:U73_A A 13 ? A 73 ? 20 1 1 A U 14 1_555 A A 72 1_555 -0.352 -0.101 0.086 -11.429 -21.416 -4.407 35 A_U14:A72_A A 14 ? A 72 ? 20 1 1 A U 15 1_555 A A 71 1_555 -0.166 -0.103 0.281 -7.542 -15.515 1.191 36 A_U15:A71_A A 15 ? A 71 ? 20 1 1 A C 16 1_555 A G 70 1_555 0.131 -0.108 0.030 4.476 -8.528 -0.703 37 A_C16:G70_A A 16 ? A 70 ? 19 1 1 A G 17 1_555 A U 69 1_555 -2.200 -0.532 -0.071 -0.286 -13.491 0.191 38 A_G17:U69_A A 17 ? A 69 ? 28 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 88 1_555 A G 2 1_555 A C 87 1_555 -0.065 -1.825 3.389 2.137 6.678 36.822 -3.707 0.378 3.016 10.455 -3.345 37.461 1 AA_G1G2:C87C88_AA A 1 ? A 88 ? A 2 ? A 87 ? 1 A G 2 1_555 A C 87 1_555 A A 3 1_555 A U 86 1_555 0.071 -1.408 3.249 1.052 4.959 32.165 -3.344 0.050 3.005 8.881 -1.883 32.552 2 AA_G2A3:U86C87_AA A 2 ? A 87 ? A 3 ? A 86 ? 1 A A 3 1_555 A U 86 1_555 A G 4 1_555 A C 85 1_555 0.463 -1.879 3.329 2.467 10.122 31.852 -4.830 -0.421 2.652 17.857 -4.352 33.470 3 AA_A3G4:C85U86_AA A 3 ? A 86 ? A 4 ? A 85 ? 1 A G 4 1_555 A C 85 1_555 A A 5 1_555 A G 84 1_555 -1.090 -1.593 3.158 5.183 2.797 36.662 -2.848 2.353 2.858 4.412 -8.175 37.116 4 AA_G4A5:G84C85_AA A 4 ? A 85 ? A 5 ? A 84 ? 1 A A 5 1_555 A G 84 1_555 A G 37 1_555 A C 83 1_555 -1.759 -3.400 3.461 12.910 4.803 48.660 -4.313 2.935 2.619 5.698 -15.314 50.458 5 AA_A5G37:C83G84_AA A 5 ? A 84 ? A 37 ? A 83 ? 1 A G 37 1_555 A C 83 1_555 A G 38 1_555 A C 82 1_555 -0.801 -1.816 3.366 -3.679 9.354 36.097 -4.029 0.777 2.888 14.747 5.800 37.425 6 AA_G37G38:C82C83_AA A 37 ? A 83 ? A 38 ? A 82 ? 1 A G 38 1_555 A C 82 1_555 A A 39 1_555 A U 81 1_555 -0.781 -1.864 3.069 -2.828 9.822 25.491 -5.987 1.054 2.279 21.204 6.106 27.433 7 AA_G38A39:U81C82_AA A 38 ? A 82 ? A 39 ? A 81 ? 1 A A 39 1_555 A U 81 1_555 A U 40 1_555 A A 80 1_555 1.179 -1.562 3.357 1.913 13.540 34.204 -4.233 -1.622 2.633 21.964 -3.103 36.760 8 AA_A39U40:A80U81_AA A 39 ? A 81 ? A 40 ? A 80 ? 1 A U 40 1_555 A A 80 1_555 A G 41 1_555 A C 79 1_555 1.709 -0.889 3.756 18.936 14.709 40.393 -2.630 -0.213 3.667 19.382 -24.952 46.717 9 AA_U40G41:C79A80_AA A 40 ? A 80 ? A 41 ? A 79 ? 1 A G 41 1_555 A C 79 1_555 A U 42 1_555 A U 35 1_555 -2.810 1.593 2.931 -18.138 8.449 49.614 1.194 1.883 3.876 9.630 20.672 53.259 10 AA_G41U42:U35C79_AA A 41 ? A 79 ? A 42 ? A 35 ? 1 A U 42 1_555 A U 35 1_555 A G 44 1_555 A A 34 1_555 1.770 -2.504 3.170 -1.979 -1.058 59.452 -2.472 -1.881 3.155 -1.066 1.995 59.490 11 AA_U42G44:A34U35_AA A 42 ? A 35 ? A 44 ? A 34 ? 1 A G 44 1_555 A A 34 1_555 A U 45 1_555 A A 33 1_555 0.898 -1.819 3.127 -3.700 0.795 34.343 -3.179 -2.047 2.975 1.342 6.242 34.544 12 AA_G44U45:A33A34_AA A 44 ? A 34 ? A 45 ? A 33 ? 1 A U 45 1_555 A A 33 1_555 A C 46 1_555 A G 32 1_555 0.562 -1.890 3.314 -0.339 2.019 35.185 -3.421 -0.978 3.199 3.336 0.560 35.243 13 AA_U45C46:G32A33_AA A 45 ? A 33 ? A 46 ? A 32 ? 1 A C 46 1_555 A G 32 1_555 A A 47 1_555 A U 31 1_555 -0.844 -1.588 3.146 -1.020 4.879 29.179 -4.066 1.451 2.875 9.596 2.006 29.593 14 AA_C46A47:U31G32_AA A 46 ? A 32 ? A 47 ? A 31 ? 1 A A 47 1_555 A U 31 1_555 A C 48 1_555 A G 30 1_555 0.112 -1.351 3.197 0.197 5.087 32.137 -3.252 -0.168 2.954 9.117 -0.354 32.527 15 AA_A47C48:G30U31_AA A 47 ? A 31 ? A 48 ? A 30 ? 1 A C 48 1_555 A G 30 1_555 A A 49 1_555 A U 29 1_555 -0.554 -1.512 3.317 -0.597 11.691 32.060 -4.325 0.855 2.631 20.340 1.038 34.078 16 AA_C48A49:U29G30_AA A 48 ? A 30 ? A 49 ? A 29 ? 1 A A 49 1_555 A U 29 1_555 A C 50 1_555 A G 28 1_555 0.381 -1.198 3.168 0.919 7.567 32.448 -3.262 -0.523 2.834 13.314 -1.617 33.308 17 AA_A49C50:G28U29_AA A 49 ? A 29 ? A 50 ? A 28 ? 1 A C 50 1_555 A G 28 1_555 A A 51 1_555 A U 27 1_555 0.070 -2.030 3.582 2.917 14.026 32.124 -5.414 0.310 2.503 23.917 -4.973 35.097 18 AA_C50A51:U27G28_AA A 50 ? A 28 ? A 51 ? A 27 ? 1 A A 51 1_555 A U 27 1_555 A A 52 1_555 A G 26 1_555 -0.785 -1.980 3.312 5.803 7.993 31.440 -4.749 2.297 2.564 14.315 -10.393 32.917 19 AA_A51A52:G26U27_AA A 51 ? A 27 ? A 52 ? A 26 ? 1 A C 18 1_555 A G 67 1_555 A A 23 1_555 A A 55 1_555 -0.679 1.286 6.934 37.245 -136.681 35.290 3.524 1.133 0.868 -81.031 -22.081 143.534 20 AA_C18A23:A55G67_AA A 18 ? A 67 ? A 23 ? A 55 ? 1 A A 23 1_555 A A 55 1_555 A G 24 1_555 A G 54 1_555 2.902 -2.111 2.902 -4.947 -2.628 34.548 -3.175 -5.461 2.623 -4.389 8.263 34.986 21 AA_A23G24:G54A55_AA A 23 ? A 55 ? A 24 ? A 54 ? 1 A G 19 1_555 A C 66 1_555 A U 20 1_555 A G 65 1_555 -0.203 -1.031 3.136 0.118 4.165 46.369 -1.636 0.267 3.037 5.277 -0.149 46.545 22 AA_G19U20:G65C66_AA A 19 ? A 66 ? A 20 ? A 65 ? 1 A U 20 1_555 A G 65 1_555 A G 57 1_555 A C 64 1_555 -1.882 -2.234 3.066 2.473 5.572 32.094 -4.804 3.717 2.505 9.966 -4.423 32.653 23 AA_U20G57:C64G65_AA A 20 ? A 65 ? A 57 ? A 64 ? 1 A G 57 1_555 A C 64 1_555 A C 58 1_555 A G 63 1_555 0.997 -2.305 3.008 3.500 -1.431 25.474 -4.788 -1.295 3.235 -3.223 -7.882 25.749 24 AA_G57C58:G63C64_AA A 57 ? A 64 ? A 58 ? A 63 ? 1 A C 58 1_555 A G 63 1_555 A G 59 1_555 A A 62 1_555 -4.941 -1.888 3.174 -1.421 1.509 55.419 -2.116 5.229 3.241 1.622 1.528 55.454 25 AA_C58G59:A62G63_AA A 58 ? A 63 ? A 59 ? A 62 ? 1 A A 8 1_555 A G 78 1_555 A G 9 1_555 A U 77 1_555 2.141 -1.286 2.856 0.033 5.880 46.676 -2.024 -2.681 2.686 7.386 -0.042 47.024 26 AA_A8G9:U77G78_AA A 8 ? A 78 ? A 9 ? A 77 ? 1 A G 9 1_555 A U 77 1_555 A A 10 1_555 A U 76 1_555 -0.571 -1.733 3.321 -3.536 2.801 40.056 -2.834 0.427 3.234 4.074 5.143 40.299 27 AA_G9A10:U76U77_AA A 9 ? A 77 ? A 10 ? A 76 ? 1 A A 10 1_555 A U 76 1_555 A U 11 1_555 A A 75 1_555 -0.107 -1.342 3.232 1.792 8.668 30.539 -3.934 0.502 2.746 16.038 -3.315 31.766 28 AA_A10U11:A75U76_AA A 10 ? A 76 ? A 11 ? A 75 ? 1 A U 11 1_555 A A 75 1_555 A G 12 1_555 A C 74 1_555 0.256 -1.249 3.186 1.430 13.914 31.183 -4.118 -0.233 2.434 24.404 -2.507 34.105 29 AA_U11G12:C74A75_AA A 11 ? A 75 ? A 12 ? A 74 ? 1 A G 12 1_555 A C 74 1_555 A A 13 1_555 A U 73 1_555 -0.649 -1.247 2.934 -7.139 5.728 35.015 -2.726 0.151 2.777 9.325 11.622 36.155 30 AA_G12A13:U73C74_AA A 12 ? A 74 ? A 13 ? A 73 ? 1 A A 13 1_555 A U 73 1_555 A U 14 1_555 A A 72 1_555 -0.021 -1.512 3.575 4.460 11.324 29.876 -4.773 0.845 2.800 20.907 -8.235 32.208 31 AA_A13U14:A72U73_AA A 13 ? A 73 ? A 14 ? A 72 ? 1 A U 14 1_555 A A 72 1_555 A U 15 1_555 A A 71 1_555 0.559 -1.116 3.144 -1.137 6.103 35.388 -2.622 -1.059 2.899 9.945 1.852 35.911 32 AA_U14U15:A71A72_AA A 14 ? A 72 ? A 15 ? A 71 ? 1 A U 15 1_555 A A 71 1_555 A C 16 1_555 A G 70 1_555 -0.304 -1.000 2.973 1.237 2.743 33.179 -2.154 0.715 2.870 4.791 -2.161 33.311 33 AA_U15C16:G70A71_AA A 15 ? A 71 ? A 16 ? A 70 ? 1 A C 16 1_555 A G 70 1_555 A G 17 1_555 A U 69 1_555 1.766 -2.451 3.250 1.118 8.598 20.606 -9.090 -4.199 2.155 22.779 -2.963 22.338 34 AA_C16G17:U69G70_AA A 16 ? A 70 ? A 17 ? A 69 ? # _atom_sites.entry_id 4LVW _atom_sites.fract_transf_matrix[1][1] 0.037341 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.014603 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.006390 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_