data_4PDQ # _entry.id 4PDQ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 4PDQ pdb_00004pdq 10.2210/pdb4pdq/pdb WWPDB D_1000201202 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2015-01-07 2 'Structure model' 1 1 2020-01-22 3 'Structure model' 1 2 2024-03-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Derived calculations' 3 2 'Structure model' 'Source and taxonomy' 4 3 'Structure model' 'Data collection' 5 3 'Structure model' 'Database references' 6 3 'Structure model' 'Derived calculations' 7 3 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' diffrn_source 2 2 'Structure model' pdbx_entity_src_syn 3 2 'Structure model' pdbx_struct_oper_list 4 3 'Structure model' chem_comp 5 3 'Structure model' chem_comp_atom 6 3 'Structure model' chem_comp_bond 7 3 'Structure model' database_2 8 3 'Structure model' entity 9 3 'Structure model' pdbx_entity_nonpoly # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_diffrn_source.pdbx_synchrotron_site' 2 2 'Structure model' '_pdbx_entity_src_syn.pdbx_alt_source_flag' 3 2 'Structure model' '_pdbx_struct_oper_list.symmetry_operation' 4 3 'Structure model' '_chem_comp.name' 5 3 'Structure model' '_database_2.pdbx_DOI' 6 3 'Structure model' '_database_2.pdbx_database_accession' 7 3 'Structure model' '_entity.pdbx_description' 8 3 'Structure model' '_pdbx_entity_nonpoly.name' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 4PDQ _pdbx_database_status.recvd_initial_deposition_date 2014-04-21 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Hanessian, S.' 1 'Saavedra, O.M.' 2 'Vilchis-Reyes, M.A.' 3 'Maianti, J.P.' 4 'Kanazawa, H.' 5 'Dozzo, P.' 6 'Feeney, L.A.' 7 'Armstrong, E.S.' 8 'Kondo, J.' 9 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Chem Sci' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-6539 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 5 _citation.language ? _citation.page_first 4621 _citation.page_last 4632 _citation.title ;Synthesis, broad spectrum antibacterial activity, and X-ray co-crystal structure of the decoding bacterial ribosomal A-site with 4'-deoxy-4'-fluoro neomycin analogs ; _citation.year 2014 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1039/C4SC01626B _citation.pdbx_database_id_PubMed ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Hanessian, S.' 1 ? primary 'Saavedra, O.M.' 2 ? primary 'Vilchis-Reyes, M.A.' 3 ? primary 'Maianti, J.P.' 4 ? primary 'Kanazawa, H.' 5 ? primary 'Dozzo, P.' 6 ? primary 'Matias, R.D.' 7 ? primary 'Serio, A.' 8 ? primary 'Kondo, J.' 9 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-*UP*UP*GP*CP*GP*UP*CP*AP*CP*GP*CP*CP*GP*GP*CP*GP*AP*AP*GP*UP*CP*GP*C-3') ; 7370.424 2 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 3 non-polymer syn ;(2S)-4-amino-N-{(1R,2S,3R,4R,5S)-5-amino-3-{[3-O-(2,6-diamino-2,6-dideoxy-beta-L-idopyranosyl)-beta-D-ribofuranosyl]oxy }-4-[(2,6-diamino-2,4,6-trideoxy-4-fluoro-alpha-D-galactopyranosyl)oxy]-2-hydroxycyclohexyl}-2-hydroxybutanamide ; 717.739 1 ? ? ? ? 4 water nat water 18.015 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UUGCGUCACGCCGGCGAAGUCGC _entity_poly.pdbx_seq_one_letter_code_can UUGCGUCACGCCGGCGAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 ;(2S)-4-amino-N-{(1R,2S,3R,4R,5S)-5-amino-3-{[3-O-(2,6-diamino-2,6-dideoxy-beta-L-idopyranosyl)-beta-D-ribofuranosyl]oxy }-4-[(2,6-diamino-2,4,6-trideoxy-4-fluoro-alpha-D-galactopyranosyl)oxy]-2-hydroxycyclohexyl}-2-hydroxybutanamide ; NMZ 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 U n 1 3 G n 1 4 C n 1 5 G n 1 6 U n 1 7 C n 1 8 A n 1 9 C n 1 10 G n 1 11 C n 1 12 C n 1 13 G n 1 14 G n 1 15 C n 1 16 G n 1 17 A n 1 18 A n 1 19 G n 1 20 U n 1 21 C n 1 22 G n 1 23 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 23 _pdbx_entity_src_syn.organism_scientific synthetic _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 NMZ non-polymer . ;(2S)-4-amino-N-{(1R,2S,3R,4R,5S)-5-amino-3-{[3-O-(2,6-diamino-2,6-dideoxy-beta-L-idopyranosyl)-beta-D-ribofuranosyl]oxy }-4-[(2,6-diamino-2,4,6-trideoxy-4-fluoro-alpha-D-galactopyranosyl)oxy]-2-hydroxycyclohexyl}-2-hydroxybutanamide ; "1-N-[(S)-4-Amino-2-hydroxybutanoyl]-4'-deoxy-4'-fluoro-4'-epineomycin" 'C27 H52 F N7 O14' 717.739 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 1 1 U U A . n A 1 2 U 2 2 2 U U A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 A 8 8 8 A A A . n A 1 9 C 9 9 9 C C A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n B 1 1 U 1 24 24 U U B . n B 1 2 U 2 25 25 U U B . n B 1 3 G 3 26 26 G G B . n B 1 4 C 4 27 27 C C B . n B 1 5 G 5 28 28 G G B . n B 1 6 U 6 29 29 U U B . n B 1 7 C 7 30 30 C C B . n B 1 8 A 8 31 31 A A B . n B 1 9 C 9 32 32 C C B . n B 1 10 G 10 33 33 G G B . n B 1 11 C 11 34 34 C C B . n B 1 12 C 12 35 35 C C B . n B 1 13 G 13 36 36 G G B . n B 1 14 G 14 37 37 G G B . n B 1 15 C 15 38 38 C C B . n B 1 16 G 16 39 39 G G B . n B 1 17 A 17 40 40 A A B . n B 1 18 A 18 41 41 A A B . n B 1 19 G 19 42 42 G G B . n B 1 20 U 20 43 43 U U B . n B 1 21 C 21 44 44 C C B . n B 1 22 G 22 45 45 G G B . n B 1 23 C 23 46 46 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 MG 1 101 101 MG MG A . D 3 NMZ 1 101 101 NMZ NMZ B . E 2 MG 1 102 102 MG MG B . F 4 HOH 1 201 201 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? CNS ? ? ? . 1 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.14 2 ? 'model building' ? ? ? ? ? ? ? ? ? ? ? Coot ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 4 ? 'model building' ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 5 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? CrystalClear ? ? ? . 6 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? CrystalClear ? ? ? . 7 # _cell.entry_id 4PDQ _cell.length_a 103.657 _cell.length_b 103.657 _cell.length_c 44.572 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 18 _cell.pdbx_unique_axis ? # _symmetry.entry_id 4PDQ _symmetry.space_group_name_H-M 'H 3' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 146 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 4PDQ _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.13 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 60.66 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Sodium cacodylate, MgCl2, MPD, Spermine tetrahydrochloride' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment ? # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'ADSC QUANTUM 270' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2013-11-18 # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.98 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.98 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-17A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.entry_id 4PDQ _reflns.observed_criterion_sigma_I ? _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 19.600 _reflns.d_resolution_high 3.000 _reflns.number_obs 3522 _reflns.number_all ? _reflns.percent_possible_obs 98.7 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI 12.6000 _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 5.600 # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 4PDQ _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 3522 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 0.000 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 19.60 _refine.ls_d_res_high 3.00 _refine.ls_percent_reflns_obs 98.4 _refine.ls_R_factor_obs 0.195 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.195 _refine.ls_R_factor_R_free 0.236 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 9.900 _refine.ls_number_reflns_R_free 355 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean 76.3504 _refine.aniso_B[1][1] 1.05200 _refine.aniso_B[2][2] 1.05200 _refine.aniso_B[3][3] -2.10400 _refine.aniso_B[1][2] 0.00000 _refine.aniso_B[1][3] 0.00000 _refine.aniso_B[2][3] 0.00000 _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol 59.88 _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 974 _refine_hist.pdbx_number_atoms_ligand 51 _refine_hist.number_atoms_solvent 1 _refine_hist.number_atoms_total 1026 _refine_hist.d_res_high 3.00 _refine_hist.d_res_low 19.60 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function c_bond_d 0.008 ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_bond_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_angle_deg_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_dihedral_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_na ? ? ? ? 'X-RAY DIFFRACTION' ? c_improper_angle_d_prot ? ? ? ? 'X-RAY DIFFRACTION' ? c_mcbond_it 0.000 1.500 ? ? 'X-RAY DIFFRACTION' ? c_mcangle_it 0.000 2.000 ? ? 'X-RAY DIFFRACTION' ? c_scbond_it 1.692 2.000 ? ? 'X-RAY DIFFRACTION' ? c_scangle_it 2.722 2.500 ? ? 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.d_res_high 3.00 _refine_ls_shell.d_res_low 3.11 _refine_ls_shell.number_reflns_R_work 322 _refine_ls_shell.R_factor_R_work 0.3192 _refine_ls_shell.percent_reflns_obs 100.0 _refine_ls_shell.R_factor_R_free 0.3010 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.number_reflns_R_free 37 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? # loop_ _pdbx_xplor_file.pdbx_refine_id _pdbx_xplor_file.serial_no _pdbx_xplor_file.param_file _pdbx_xplor_file.topol_file 'X-RAY DIFFRACTION' 1 DNA-RNA_FREE.PARAM ? 'X-RAY DIFFRACTION' 2 CNS_TOPPAR:WATER_REP.PARAM ? 'X-RAY DIFFRACTION' 3 CNS_TOPPAR:ION.PARAM ? 'X-RAY DIFFRACTION' 4 GET_XPLOR.PARAM ? 'X-RAY DIFFRACTION' 5 174.PARAM ? # _struct.entry_id 4PDQ _struct.title ;Crystal structure of the bacterial ribosomal decoding site in complex with 4'-deoxy-4'-fluoro neomycin analog ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag ? # _struct_keywords.entry_id 4PDQ _struct_keywords.text 'ribosome, aminoglycoside, RNA-ANTIBIOTIC complex' _struct_keywords.pdbx_keywords RNA/ANTIBIOTIC # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 3 ? E N N 2 ? F N N 4 ? # _struct_ref.db_code 4PDQ _struct_ref.db_name PDB _struct_ref.details ? _struct_ref.entity_id 1 _struct_ref.id 1 _struct_ref.seq_align ? _struct_ref.seq_dif ? _struct_ref.pdbx_db_accession 4PDQ _struct_ref.pdbx_db_isoform ? _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 _struct_ref.pdbx_align_end ? # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 4PDQ A 1 ? 23 ? 4PDQ 1 ? 23 ? 1 23 2 1 4PDQ B 1 ? 23 ? 4PDQ 24 ? 46 ? 24 46 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2610 ? 1 MORE -21 ? 1 'SSA (A^2)' 8560 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 3 N1 ? ? ? 1_555 B C 23 N3 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 3 N2 ? ? ? 1_555 B C 23 O2 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 O6 ? ? ? 1_555 B C 23 N4 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 4 N3 ? ? ? 1_555 B G 22 N1 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 4 N4 ? ? ? 1_555 B G 22 O6 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 4 O2 ? ? ? 1_555 B G 22 N2 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 5 N1 ? ? ? 1_555 B C 21 N3 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 5 N2 ? ? ? 1_555 B C 21 O2 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 O6 ? ? ? 1_555 B C 21 N4 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 6 O4 ? ? ? 1_555 B U 20 N3 ? ? A U 6 B U 43 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A C 7 N3 ? ? ? 1_555 B G 19 N1 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 7 N4 ? ? ? 1_555 B G 19 O6 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 7 O2 ? ? ? 1_555 B G 19 N2 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 9 N3 ? ? ? 1_555 B G 16 N1 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 9 N4 ? ? ? 1_555 B G 16 O6 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 9 O2 ? ? ? 1_555 B G 16 N2 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 10 N1 ? ? ? 1_555 B C 15 N3 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 N2 ? ? ? 1_555 B C 15 O2 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 10 O6 ? ? ? 1_555 B C 15 N4 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 14 N1 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 14 O6 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 14 N2 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 12 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 12 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 12 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 12 N3 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 12 O2 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 12 N4 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 14 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 14 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 14 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 N3 ? ? ? 1_555 B G 10 N1 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N4 ? ? ? 1_555 B G 10 O6 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 O2 ? ? ? 1_555 B G 10 N2 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 16 N1 ? ? ? 1_555 B C 9 N3 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 16 N2 ? ? ? 1_555 B C 9 O2 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 16 O6 ? ? ? 1_555 B C 9 N4 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 7 N3 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 7 O2 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 7 N4 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 20 N3 ? ? ? 1_555 B U 6 O4 ? ? A U 20 B U 29 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog42 hydrog ? ? A C 21 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 21 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 21 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 22 N1 ? ? ? 1_555 B C 4 N3 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 22 N2 ? ? ? 1_555 B C 4 O2 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 22 O6 ? ? ? 1_555 B C 4 N4 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 23 N3 ? ? ? 1_555 B G 3 N1 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 23 N4 ? ? ? 1_555 B G 3 O6 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 23 O2 ? ? ? 1_555 B G 3 N2 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A MG 101 ? 1 'binding site for residue MG A 101' AC2 Software B NMZ 101 ? 17 'binding site for residue NMZ B 101' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 1 G A 13 ? G A 13 . ? 1_555 ? 2 AC2 17 G A 3 ? G A 3 . ? 1_555 ? 3 AC2 17 C A 4 ? C A 4 . ? 1_555 ? 4 AC2 17 G A 5 ? G A 5 . ? 1_555 ? 5 AC2 17 U A 6 ? U A 6 . ? 1_555 ? 6 AC2 17 C A 7 ? C A 7 . ? 1_555 ? 7 AC2 17 A A 8 ? A A 8 . ? 1_555 ? 8 AC2 17 C A 9 ? C A 9 . ? 1_555 ? 9 AC2 17 G B 14 ? G B 37 . ? 1_555 ? 10 AC2 17 C B 15 ? C B 38 . ? 1_555 ? 11 AC2 17 G B 16 ? G B 39 . ? 1_555 ? 12 AC2 17 A B 17 ? A B 40 . ? 1_555 ? 13 AC2 17 A B 18 ? A B 41 . ? 1_555 ? 14 AC2 17 G B 19 ? G B 42 . ? 1_555 ? 15 AC2 17 U B 20 ? U B 43 . ? 1_555 ? 16 AC2 17 C B 21 ? C B 44 . ? 1_555 ? 17 AC2 17 G B 22 ? G B 45 . ? 1_555 ? 18 AC2 17 C B 23 ? C B 46 . ? 1_555 ? # _phasing.method MR # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 MG MG MG N N 114 NMZ C4 C N R 115 NMZ C5 C N R 116 NMZ C6 C N N 117 NMZ C3 C N R 118 NMZ C2 C N R 119 NMZ C1 C N S 120 NMZ O1 O N N 121 NMZ O2 O N N 122 NMZ C10 C N R 123 NMZ C11 C N R 124 NMZ C12 C N S 125 NMZ C13 C N S 126 NMZ C14 C N R 127 NMZ C15 C N S 128 NMZ C16 C N R 129 NMZ C17 C N N 130 NMZ C18 C N R 131 NMZ C19 C N R 132 NMZ C20 C N R 133 NMZ C21 C N S 134 NMZ C22 C N S 135 NMZ C23 C N N 136 NMZ C24 C N N 137 NMZ C26 C N N 138 NMZ C27 C N N 139 NMZ C28 C N S 140 NMZ C7 C N R 141 NMZ C8 C N N 142 NMZ C9 C N S 143 NMZ F99 F N N 144 NMZ N19 N N N 145 NMZ N2 N N N 146 NMZ N23 N N N 147 NMZ N3 N N N 148 NMZ N6 N N N 149 NMZ N7 N N N 150 NMZ N9 N N N 151 NMZ O11 O N N 152 NMZ O12 O N N 153 NMZ O14 O N N 154 NMZ O16 O N N 155 NMZ O17 O N N 156 NMZ O18 O N N 157 NMZ O19 O N N 158 NMZ O22 O N N 159 NMZ O23 O N N 160 NMZ O24 O N N 161 NMZ O25 O N N 162 NMZ O5 O N N 163 NMZ H1 H N N 164 NMZ H2 H N N 165 NMZ H3 H N N 166 NMZ H4 H N N 167 NMZ H5 H N N 168 NMZ H6 H N N 169 NMZ H7 H N N 170 NMZ H8 H N N 171 NMZ H9 H N N 172 NMZ H10 H N N 173 NMZ H11 H N N 174 NMZ H12 H N N 175 NMZ H13 H N N 176 NMZ H14 H N N 177 NMZ H15 H N N 178 NMZ H16 H N N 179 NMZ H17 H N N 180 NMZ H18 H N N 181 NMZ H19 H N N 182 NMZ H20 H N N 183 NMZ H21 H N N 184 NMZ H22 H N N 185 NMZ H23 H N N 186 NMZ H24 H N N 187 NMZ H25 H N N 188 NMZ H26 H N N 189 NMZ H27 H N N 190 NMZ H28 H N N 191 NMZ H29 H N N 192 NMZ H30 H N N 193 NMZ H31 H N N 194 NMZ H32 H N N 195 NMZ H33 H N N 196 NMZ H34 H N N 197 NMZ H36 H N N 198 NMZ H37 H N N 199 NMZ H39 H N N 200 NMZ H40 H N N 201 NMZ H42 H N N 202 NMZ H43 H N N 203 NMZ H45 H N N 204 NMZ H46 H N N 205 NMZ H48 H N N 206 NMZ H49 H N N 207 NMZ H50 H N N 208 NMZ H52 H N N 209 NMZ H53 H N N 210 NMZ H54 H N N 211 NMZ H55 H N N 212 NMZ H56 H N N 213 NMZ H57 H N N 214 NMZ H58 H N N 215 U OP3 O N N 216 U P P N N 217 U OP1 O N N 218 U OP2 O N N 219 U "O5'" O N N 220 U "C5'" C N N 221 U "C4'" C N R 222 U "O4'" O N N 223 U "C3'" C N S 224 U "O3'" O N N 225 U "C2'" C N R 226 U "O2'" O N N 227 U "C1'" C N R 228 U N1 N N N 229 U C2 C N N 230 U O2 O N N 231 U N3 N N N 232 U C4 C N N 233 U O4 O N N 234 U C5 C N N 235 U C6 C N N 236 U HOP3 H N N 237 U HOP2 H N N 238 U "H5'" H N N 239 U "H5''" H N N 240 U "H4'" H N N 241 U "H3'" H N N 242 U "HO3'" H N N 243 U "H2'" H N N 244 U "HO2'" H N N 245 U "H1'" H N N 246 U H3 H N N 247 U H5 H N N 248 U H6 H N N 249 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 NMZ N6 C6 sing N N 118 NMZ C6 C5 sing N N 119 NMZ N9 C9 sing N N 120 NMZ C5 C4 sing N N 121 NMZ C5 O5 sing N N 122 NMZ C4 F99 sing N N 123 NMZ C4 C3 sing N N 124 NMZ C9 C8 sing N N 125 NMZ C9 C10 sing N N 126 NMZ C8 C7 sing N N 127 NMZ C3 O23 sing N N 128 NMZ C3 C2 sing N N 129 NMZ O5 C1 sing N N 130 NMZ O1 C10 sing N N 131 NMZ O1 C1 sing N N 132 NMZ O19 C28 sing N N 133 NMZ C10 C11 sing N N 134 NMZ O2 C26 doub N N 135 NMZ C28 C26 sing N N 136 NMZ C28 C24 sing N N 137 NMZ C26 N7 sing N N 138 NMZ C1 C2 sing N N 139 NMZ N7 C7 sing N N 140 NMZ C7 C12 sing N N 141 NMZ C2 N2 sing N N 142 NMZ C27 C24 sing N N 143 NMZ C27 N3 sing N N 144 NMZ C11 C12 sing N N 145 NMZ C11 O11 sing N N 146 NMZ C12 O12 sing N N 147 NMZ O11 C13 sing N N 148 NMZ C13 O16 sing N N 149 NMZ C13 C14 sing N N 150 NMZ O16 C16 sing N N 151 NMZ O17 C17 sing N N 152 NMZ C17 C16 sing N N 153 NMZ C14 O14 sing N N 154 NMZ C14 C15 sing N N 155 NMZ C16 C15 sing N N 156 NMZ C15 O18 sing N N 157 NMZ O18 C18 sing N N 158 NMZ C18 O22 sing N N 159 NMZ C18 C19 sing N N 160 NMZ O22 C22 sing N N 161 NMZ N19 C23 sing N N 162 NMZ N23 C19 sing N N 163 NMZ C19 C20 sing N N 164 NMZ C23 C22 sing N N 165 NMZ C22 C21 sing N N 166 NMZ O24 C21 sing N N 167 NMZ C20 C21 sing N N 168 NMZ C20 O25 sing N N 169 NMZ C4 H1 sing N N 170 NMZ C5 H2 sing N N 171 NMZ C6 H3 sing N N 172 NMZ C6 H4 sing N N 173 NMZ C3 H5 sing N N 174 NMZ C2 H6 sing N N 175 NMZ C1 H7 sing N N 176 NMZ C10 H8 sing N N 177 NMZ C11 H9 sing N N 178 NMZ C12 H10 sing N N 179 NMZ C13 H11 sing N N 180 NMZ C14 H12 sing N N 181 NMZ C15 H13 sing N N 182 NMZ C16 H14 sing N N 183 NMZ C17 H15 sing N N 184 NMZ C17 H16 sing N N 185 NMZ C18 H17 sing N N 186 NMZ C19 H18 sing N N 187 NMZ C20 H19 sing N N 188 NMZ C21 H20 sing N N 189 NMZ C22 H21 sing N N 190 NMZ C23 H22 sing N N 191 NMZ C23 H23 sing N N 192 NMZ C24 H24 sing N N 193 NMZ C24 H25 sing N N 194 NMZ C27 H26 sing N N 195 NMZ C27 H27 sing N N 196 NMZ C28 H28 sing N N 197 NMZ C7 H29 sing N N 198 NMZ C8 H30 sing N N 199 NMZ C8 H31 sing N N 200 NMZ C9 H32 sing N N 201 NMZ N19 H33 sing N N 202 NMZ N19 H34 sing N N 203 NMZ N2 H36 sing N N 204 NMZ N2 H37 sing N N 205 NMZ N23 H39 sing N N 206 NMZ N23 H40 sing N N 207 NMZ N3 H42 sing N N 208 NMZ N3 H43 sing N N 209 NMZ N6 H45 sing N N 210 NMZ N6 H46 sing N N 211 NMZ N7 H48 sing N N 212 NMZ N9 H49 sing N N 213 NMZ N9 H50 sing N N 214 NMZ O12 H52 sing N N 215 NMZ O14 H53 sing N N 216 NMZ O17 H54 sing N N 217 NMZ O19 H55 sing N N 218 NMZ O23 H56 sing N N 219 NMZ O24 H57 sing N N 220 NMZ O25 H58 sing N N 221 U OP3 P sing N N 222 U OP3 HOP3 sing N N 223 U P OP1 doub N N 224 U P OP2 sing N N 225 U P "O5'" sing N N 226 U OP2 HOP2 sing N N 227 U "O5'" "C5'" sing N N 228 U "C5'" "C4'" sing N N 229 U "C5'" "H5'" sing N N 230 U "C5'" "H5''" sing N N 231 U "C4'" "O4'" sing N N 232 U "C4'" "C3'" sing N N 233 U "C4'" "H4'" sing N N 234 U "O4'" "C1'" sing N N 235 U "C3'" "O3'" sing N N 236 U "C3'" "C2'" sing N N 237 U "C3'" "H3'" sing N N 238 U "O3'" "HO3'" sing N N 239 U "C2'" "O2'" sing N N 240 U "C2'" "C1'" sing N N 241 U "C2'" "H2'" sing N N 242 U "O2'" "HO2'" sing N N 243 U "C1'" N1 sing N N 244 U "C1'" "H1'" sing N N 245 U N1 C2 sing N N 246 U N1 C6 sing N N 247 U C2 O2 doub N N 248 U C2 N3 sing N N 249 U N3 C4 sing N N 250 U N3 H3 sing N N 251 U C4 O4 doub N N 252 U C4 C5 sing N N 253 U C5 C6 doub N N 254 U C5 H5 sing N N 255 U C6 H6 sing N N 256 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 4PDQ 'double helix' 4PDQ 'a-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 3 1_555 B C 23 1_555 -0.063 -0.101 0.509 1.508 -15.036 1.760 1 A_G3:C46_B A 3 ? B 46 ? 19 1 1 A C 4 1_555 B G 22 1_555 0.103 -0.073 0.256 0.011 -6.626 -0.450 2 A_C4:G45_B A 4 ? B 45 ? 19 1 1 A G 5 1_555 B C 21 1_555 -0.051 -0.044 0.201 2.508 -6.401 -0.687 3 A_G5:C44_B A 5 ? B 44 ? 19 1 1 A U 6 1_555 B U 20 1_555 -2.871 -1.082 -0.998 12.127 -9.828 -27.493 4 A_U6:U43_B A 6 ? B 43 ? ? ? 1 A C 7 1_555 B G 19 1_555 -0.035 -0.089 -0.269 -2.038 11.571 -0.362 5 A_C7:G42_B A 7 ? B 42 ? 19 1 1 A C 9 1_555 B G 16 1_555 0.229 -0.063 -0.295 17.044 -27.131 5.520 6 A_C9:G39_B A 9 ? B 39 ? 19 1 1 A G 10 1_555 B C 15 1_555 -0.300 -0.170 0.246 1.195 -12.462 4.489 7 A_G10:C38_B A 10 ? B 38 ? 19 1 1 A C 11 1_555 B G 14 1_555 0.202 -0.076 0.098 0.622 -6.151 0.885 8 A_C11:G37_B A 11 ? B 37 ? 19 1 1 A C 12 1_555 B G 13 1_555 0.031 -0.118 0.366 -3.415 -8.044 2.229 9 A_C12:G36_B A 12 ? B 36 ? 19 1 1 A G 13 1_555 B C 12 1_555 0.007 -0.103 0.202 0.182 -17.059 1.739 10 A_G13:C35_B A 13 ? B 35 ? 19 1 1 A G 14 1_555 B C 11 1_555 -0.161 -0.201 -0.109 -4.206 -10.791 1.057 11 A_G14:C34_B A 14 ? B 34 ? 19 1 1 A C 15 1_555 B G 10 1_555 0.145 -0.198 0.273 -1.092 -3.472 -1.914 12 A_C15:G33_B A 15 ? B 33 ? 19 1 1 A G 16 1_555 B C 9 1_555 0.112 -0.173 -0.176 -5.423 -6.802 -2.346 13 A_G16:C32_B A 16 ? B 32 ? 19 1 1 A G 19 1_555 B C 7 1_555 -0.429 0.019 0.079 -22.795 -5.990 3.424 14 A_G19:C30_B A 19 ? B 30 ? 19 1 1 A U 20 1_555 B U 6 1_555 1.502 -1.071 0.636 -1.206 7.080 -16.316 15 A_U20:U29_B A 20 ? B 29 ? ? ? 1 A C 21 1_555 B G 5 1_555 0.039 -0.213 0.068 6.793 -12.333 -2.344 16 A_C21:G28_B A 21 ? B 28 ? 19 1 1 A G 22 1_555 B C 4 1_555 -0.298 -0.135 -0.110 -8.719 -20.477 3.184 17 A_G22:C27_B A 22 ? B 27 ? 19 1 1 A C 23 1_555 B G 3 1_555 0.218 -0.153 0.050 -10.711 -10.782 0.985 18 A_C23:G26_B A 23 ? B 26 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 3 1_555 B C 23 1_555 A C 4 1_555 B G 22 1_555 -0.568 -1.610 3.322 -2.483 -2.089 32.527 -2.487 0.563 3.449 -3.719 4.419 32.684 1 AA_G3C4:G45C46_BB A 3 ? B 46 ? A 4 ? B 45 ? 1 A C 4 1_555 B G 22 1_555 A G 5 1_555 B C 21 1_555 -0.119 -1.885 3.109 0.414 4.815 32.688 -4.057 0.274 2.808 8.498 -0.731 33.033 2 AA_C4G5:C44G45_BB A 4 ? B 45 ? A 5 ? B 44 ? 1 A G 5 1_555 B C 21 1_555 A U 6 1_555 B U 20 1_555 -0.745 -2.064 3.045 7.872 5.971 19.472 -7.322 4.433 1.895 16.362 -21.570 21.814 3 AA_G5U6:U43C44_BB A 5 ? B 44 ? A 6 ? B 43 ? 1 A U 6 1_555 B U 20 1_555 A C 7 1_555 B G 19 1_555 2.634 -2.637 3.824 -4.432 4.212 43.854 -3.929 -3.949 3.302 5.607 5.900 44.257 4 AA_U6C7:G42U43_BB A 6 ? B 43 ? A 7 ? B 42 ? 1 A C 7 1_555 B G 19 1_555 A C 9 1_555 B G 16 1_555 2.168 -3.813 5.798 -4.756 27.266 79.803 -3.917 -1.809 4.439 20.696 3.610 83.702 5 AA_C7C9:G39G42_BB A 7 ? B 42 ? A 9 ? B 39 ? 1 A C 9 1_555 B G 16 1_555 A G 10 1_555 B C 15 1_555 -0.079 -1.765 3.329 -5.483 18.309 30.674 -5.151 -0.561 1.984 31.111 9.317 36.019 6 AA_C9G10:C38G39_BB A 9 ? B 39 ? A 10 ? B 38 ? 1 A G 10 1_555 B C 15 1_555 A C 11 1_555 B G 14 1_555 -0.970 -1.458 3.214 -1.862 4.601 32.091 -3.383 1.421 3.031 8.260 3.343 32.463 7 AA_G10C11:G37C38_BB A 10 ? B 38 ? A 11 ? B 37 ? 1 A C 11 1_555 B G 14 1_555 A C 12 1_555 B G 13 1_555 0.509 -1.264 3.311 -1.268 3.444 35.420 -2.563 -1.015 3.159 5.642 2.077 35.603 8 AA_C11C12:G36G37_BB A 11 ? B 37 ? A 12 ? B 36 ? 1 A C 12 1_555 B G 13 1_555 A G 13 1_555 B C 12 1_555 -0.173 -1.786 2.980 3.440 9.894 29.252 -4.903 0.868 2.237 18.845 -6.553 31.033 9 AA_C12G13:C35G36_BB A 12 ? B 36 ? A 13 ? B 35 ? 1 A G 13 1_555 B C 12 1_555 A G 14 1_555 B C 11 1_555 -0.438 -1.527 3.189 1.481 9.025 32.964 -3.901 0.960 2.669 15.536 -2.550 34.176 10 AA_G13G14:C34C35_BB A 13 ? B 35 ? A 14 ? B 34 ? 1 A G 14 1_555 B C 11 1_555 A C 15 1_555 B G 10 1_555 -0.160 -1.383 3.091 -2.453 11.658 31.998 -3.983 -0.070 2.458 20.290 4.269 34.090 11 AA_G14C15:G33C34_BB A 14 ? B 34 ? A 15 ? B 33 ? 1 A C 15 1_555 B G 10 1_555 A G 16 1_555 B C 9 1_555 0.552 -2.457 3.249 4.982 11.178 28.374 -6.514 -0.193 2.209 21.579 -9.618 30.851 12 AA_C15G16:C32G33_BB A 15 ? B 33 ? A 16 ? B 32 ? 1 A G 19 1_555 B C 7 1_555 A U 20 1_555 B U 6 1_555 -0.446 -1.431 2.865 -4.276 5.040 30.962 -3.417 0.144 2.641 9.309 7.897 31.643 13 AA_G19U20:U29C30_BB A 19 ? B 30 ? A 20 ? B 29 ? 1 A U 20 1_555 B U 6 1_555 A C 21 1_555 B G 5 1_555 0.824 -1.889 2.971 4.969 1.522 27.608 -4.221 -0.629 2.964 3.153 -10.297 28.083 14 AA_U20C21:G28U29_BB A 20 ? B 29 ? A 21 ? B 28 ? 1 A C 21 1_555 B G 5 1_555 A G 22 1_555 B C 4 1_555 0.041 -1.807 3.551 0.997 10.674 29.509 -5.341 0.110 2.746 20.136 -1.882 31.355 15 AA_C21G22:C27G28_BB A 21 ? B 28 ? A 22 ? B 27 ? 1 A G 22 1_555 B C 4 1_555 A C 23 1_555 B G 3 1_555 0.395 -1.082 3.421 0.584 2.728 37.533 -2.045 -0.534 3.342 4.233 -0.906 37.633 16 AA_G22C23:G26C27_BB A 22 ? B 27 ? A 23 ? B 26 ? # _atom_sites.entry_id 4PDQ _atom_sites.fract_transf_matrix[1][1] 0.009647 _atom_sites.fract_transf_matrix[1][2] 0.005570 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.011140 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.022436 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C CA F MG N O P # loop_