data_5A18 # _entry.id 5A18 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.394 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5A18 pdb_00005a18 10.2210/pdb5a18/pdb PDBE EBI-63708 ? ? WWPDB D_1290063708 ? ? BMRB 26568 ? 10.13018/BMR26568 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2015-05-06 2 'Structure model' 1 1 2015-07-01 3 'Structure model' 1 2 2015-07-29 4 'Structure model' 1 3 2016-04-27 5 'Structure model' 2 0 2020-07-29 6 'Structure model' 2 1 2023-06-14 7 'Structure model' 2 2 2024-06-19 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Atomic model' 4 4 'Structure model' Other 5 5 'Structure model' Advisory 6 5 'Structure model' 'Atomic model' 7 5 'Structure model' 'Data collection' 8 5 'Structure model' 'Database references' 9 5 'Structure model' 'Derived calculations' 10 5 'Structure model' Other 11 5 'Structure model' 'Source and taxonomy' 12 5 'Structure model' 'Structure summary' 13 6 'Structure model' 'Database references' 14 6 'Structure model' Other 15 7 'Structure model' 'Data collection' 16 7 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 5 'Structure model' atom_site 2 5 'Structure model' citation 3 5 'Structure model' entity 4 5 'Structure model' entity_src_gen 5 5 'Structure model' ndb_struct_na_base_pair 6 5 'Structure model' ndb_struct_na_base_pair_step 7 5 'Structure model' pdbx_database_status 8 5 'Structure model' pdbx_entity_src_syn 9 5 'Structure model' pdbx_nmr_representative 10 5 'Structure model' pdbx_nmr_software 11 5 'Structure model' pdbx_nmr_spectrometer 12 5 'Structure model' pdbx_struct_assembly 13 5 'Structure model' pdbx_struct_assembly_prop 14 5 'Structure model' pdbx_struct_oper_list 15 5 'Structure model' pdbx_validate_close_contact 16 5 'Structure model' struct_ref 17 6 'Structure model' database_2 18 6 'Structure model' pdbx_database_status 19 7 'Structure model' chem_comp_atom 20 7 'Structure model' chem_comp_bond 21 7 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 5 'Structure model' '_atom_site.B_iso_or_equiv' 2 5 'Structure model' '_atom_site.Cartn_x' 3 5 'Structure model' '_atom_site.Cartn_y' 4 5 'Structure model' '_atom_site.Cartn_z' 5 5 'Structure model' '_atom_site.auth_atom_id' 6 5 'Structure model' '_atom_site.label_atom_id' 7 5 'Structure model' '_atom_site.type_symbol' 8 5 'Structure model' '_citation.page_last' 9 5 'Structure model' '_entity.src_method' 10 5 'Structure model' '_ndb_struct_na_base_pair.buckle' 11 5 'Structure model' '_ndb_struct_na_base_pair.opening' 12 5 'Structure model' '_ndb_struct_na_base_pair.propeller' 13 5 'Structure model' '_ndb_struct_na_base_pair.shear' 14 5 'Structure model' '_ndb_struct_na_base_pair.stagger' 15 5 'Structure model' '_ndb_struct_na_base_pair.stretch' 16 5 'Structure model' '_ndb_struct_na_base_pair_step.helical_rise' 17 5 'Structure model' '_ndb_struct_na_base_pair_step.helical_twist' 18 5 'Structure model' '_ndb_struct_na_base_pair_step.inclination' 19 5 'Structure model' '_ndb_struct_na_base_pair_step.rise' 20 5 'Structure model' '_ndb_struct_na_base_pair_step.roll' 21 5 'Structure model' '_ndb_struct_na_base_pair_step.shift' 22 5 'Structure model' '_ndb_struct_na_base_pair_step.slide' 23 5 'Structure model' '_ndb_struct_na_base_pair_step.tilt' 24 5 'Structure model' '_ndb_struct_na_base_pair_step.tip' 25 5 'Structure model' '_ndb_struct_na_base_pair_step.twist' 26 5 'Structure model' '_ndb_struct_na_base_pair_step.x_displacement' 27 5 'Structure model' '_ndb_struct_na_base_pair_step.y_displacement' 28 5 'Structure model' '_pdbx_database_status.status_code_cs' 29 5 'Structure model' '_pdbx_database_status.status_code_mr' 30 5 'Structure model' '_pdbx_nmr_representative.conformer_id' 31 5 'Structure model' '_pdbx_nmr_software.name' 32 5 'Structure model' '_pdbx_nmr_spectrometer.manufacturer' 33 5 'Structure model' '_pdbx_nmr_spectrometer.model' 34 5 'Structure model' '_pdbx_struct_assembly.method_details' 35 5 'Structure model' '_pdbx_struct_oper_list.symmetry_operation' 36 5 'Structure model' '_pdbx_validate_close_contact.PDB_model_num' 37 5 'Structure model' '_struct_ref.pdbx_align_begin' 38 6 'Structure model' '_database_2.pdbx_DOI' 39 6 'Structure model' '_database_2.pdbx_database_accession' 40 6 'Structure model' '_pdbx_database_status.status_code_nmr_data' 41 7 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 5A18 _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.SG_entry . _pdbx_database_status.recvd_initial_deposition_date 2015-04-28 _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.status_code_nmr_data REL # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.content_type _pdbx_database_related.details PDB 5A17 unspecified 'THE STRUCTURE OF THE SOLE ELEMENT OF OSKAR MRNA' BMRB 26568 unspecified . # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simon, B.' 1 ? 'Masiewicz, P.' 2 ? 'Ephrussi, A.' 3 ? 'Carlomagno, T.' 4 ? # _citation.id primary _citation.title 'The Structure of the Sole Element of Oskar Mrna.' _citation.journal_abbrev RNA _citation.journal_volume 21 _citation.page_first 1444 _citation.page_last 1453 _citation.year 2015 _citation.journal_id_ASTM RNARFU _citation.country UK _citation.journal_id_ISSN 1355-8382 _citation.journal_id_CSD 2122 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 26089324 _citation.pdbx_database_id_DOI 10.1261/RNA.049601.115 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simon, B.' 1 ? primary 'Masiewicz, P.' 2 ? primary 'Ephrussi, A.' 3 ? primary 'Carlomagno, T.' 4 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'OSKAR MRNA' _entity.formula_weight 10312.204 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment 'SOLE ELEMENT' _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC _entity_poly.pdbx_seq_one_letter_code_can GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 C n 1 4 G n 1 5 A n 1 6 U n 1 7 A n 1 8 U n 1 9 C n 1 10 G n 1 11 A n 1 12 G n 1 13 C n 1 14 A n 1 15 U n 1 16 C n 1 17 A n 1 18 A n 1 19 G n 1 20 A n 1 21 G n 1 22 U n 1 23 G n 1 24 A n 1 25 A n 1 26 U n 1 27 A n 1 28 U n 1 29 C n 1 30 G n 1 31 U n 1 32 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 32 _pdbx_entity_src_syn.organism_scientific 'DROSOPHILA MELANOGASTER' _pdbx_entity_src_syn.organism_common_name 'FRUIT FLY' _pdbx_entity_src_syn.ncbi_taxonomy_id 7227 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 A 2 2 2 A A A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 A 14 14 14 A A A . n A 1 15 U 15 15 15 U U A . n A 1 16 C 16 16 16 C C A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 U 22 22 22 U U A . n A 1 23 G 23 23 23 G G A . n A 1 24 A 24 24 24 A A A . n A 1 25 A 25 25 25 A A A . n A 1 26 U 26 26 26 U U A . n A 1 27 A 27 27 27 A A A . n A 1 28 U 28 28 28 U U A . n A 1 29 C 29 29 29 C C A . n A 1 30 G 30 30 30 G G A . n A 1 31 U 31 31 31 U U A . n A 1 32 C 32 32 32 C C A . n # _cell.entry_id 5A18 _cell.length_a 1.000 _cell.length_b 1.000 _cell.length_c 1.000 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 1 _cell.pdbx_unique_axis ? # _symmetry.entry_id 5A18 _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 # _exptl.entry_id 5A18 _exptl.method 'SOLUTION NMR' _exptl.crystals_number ? # _database_PDB_matrix.entry_id 5A18 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 5A18 _struct.title 'The structure of the SOLE element of oskar mRNA' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 5A18 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA, SOLE ELEMENT, OSKAR' # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 5A18 _struct_ref.pdbx_db_accession 5A18 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 5A18 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 32 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 5A18 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 32 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 32 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 6530 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 1 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 1 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 1 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 31 N3 ? ? A A 2 A U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 2 N6 ? ? ? 1_555 A U 31 O4 ? ? A A 2 A U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 30 N1 ? ? A C 3 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 30 O6 ? ? A C 3 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 30 N2 ? ? A C 3 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 4 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 4 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 4 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 28 N3 ? ? A A 5 A U 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 28 O4 ? ? A A 5 A U 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 27 N1 ? ? A U 6 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 27 N6 ? ? A U 6 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 7 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 7 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 25 N1 ? ? A U 8 A A 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 25 N6 ? ? A U 8 A A 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 9 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 9 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 9 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N1 ? ? ? 1_555 A U 22 O2 ? ? A G 10 A U 22 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog24 hydrog ? ? A G 10 O6 ? ? ? 1_555 A U 22 N3 ? ? A G 10 A U 22 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog25 hydrog ? ? A A 11 N1 ? ? ? 1_555 A G 21 N1 ? ? A A 11 A G 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog26 hydrog ? ? A A 11 N6 ? ? ? 1_555 A G 21 O6 ? ? A A 11 A G 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog27 hydrog ? ? A G 12 N1 ? ? ? 1_555 A A 20 N1 ? ? A G 12 A A 20 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 A A 20 N6 ? ? A G 12 A A 20 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog29 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 13 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 13 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 13 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 4 _pdbx_validate_close_contact.auth_atom_id_1 H3 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 U _pdbx_validate_close_contact.auth_seq_id_1 8 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 H62 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 A _pdbx_validate_close_contact.auth_seq_id_2 25 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.35 # _pdbx_nmr_ensemble.entry_id 5A18 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'LEAST RESTRAINT VIOLATION' # _pdbx_nmr_representative.entry_id 5A18 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria ? # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '90% H2O/10% D2O' _pdbx_nmr_sample_details.solvent_system ? _pdbx_nmr_sample_details.label ? _pdbx_nmr_sample_details.type ? _pdbx_nmr_sample_details.details ? # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.temperature_units _pdbx_nmr_exptl_sample_conditions.label 1 308.0 ? ? 6.4 ? ? pH K ? 2 308.0 ? ? 6.4 ? ? pH K ? # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.solution_id 1 1 HBCNB/HSCNB 1 2 1 'HCCH-COSY- TOCSY' 1 3 1 '3D EDITED NOESY' 1 4 2 HBCNB/HSCNB 1 5 2 'HCCH-COSY- TOCSY' 1 6 2 '3D 13C EDITED NOESY' 1 7 2 '2D NOESY' 1 8 2 '2D HNN-COSY' 1 # _pdbx_nmr_details.entry_id 5A18 _pdbx_nmr_details.text NONE # _pdbx_nmr_refine.entry_id 5A18 _pdbx_nmr_refine.method ARIA _pdbx_nmr_refine.details 'PRIOR TO WATER REFINEMENT' _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors _pdbx_nmr_software.ordinal refinement CNS 1.1 'BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE- KUNSTLEVE, JIANG,KUSZEWSKI,NILGES,PANNU,READ, RICE,SIMONSON, WARREN' 1 'structure solution' Felix ? ? 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5A18 'double helix' 5A18 'a-form double helix' 5A18 'hairpin loop' 5A18 'bulge loop' 5A18 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 32 1_555 0.904 -0.055 -0.450 -1.000 5.913 -10.021 1 A_G1:C32_A A 1 ? A 32 ? 19 1 1 A A 2 1_555 A U 31 1_555 -0.861 -0.537 0.968 8.867 -13.023 -2.701 2 A_A2:U31_A A 2 ? A 31 ? 20 1 1 A C 3 1_555 A G 30 1_555 -0.684 -0.075 -0.007 7.438 -11.765 0.020 3 A_C3:G30_A A 3 ? A 30 ? 19 1 1 A G 4 1_555 A C 29 1_555 0.903 -0.154 -0.104 -6.443 -17.691 1.510 4 A_G4:C29_A A 4 ? A 29 ? 19 1 1 A A 5 1_555 A U 28 1_555 -1.011 -0.358 -0.011 -1.273 -5.771 5.955 5 A_A5:U28_A A 5 ? A 28 ? 20 1 1 A U 6 1_555 A A 27 1_555 0.457 -0.133 0.207 1.366 -5.946 2.140 6 A_U6:A27_A A 6 ? A 27 ? 20 1 1 A A 7 1_555 A U 26 1_555 -0.985 -0.378 -0.063 -1.953 -11.720 5.119 7 A_A7:U26_A A 7 ? A 26 ? 20 1 1 A U 8 1_555 A A 25 1_555 1.093 -0.386 0.194 -4.728 -3.896 -2.480 8 A_U8:A25_A A 8 ? A 25 ? 20 1 1 A C 9 1_555 A G 23 1_555 1.027 -0.398 -0.084 0.496 -7.121 -0.718 9 A_C9:G23_A A 9 ? A 23 ? 19 1 1 A G 10 1_555 A U 22 1_555 -1.350 -0.363 0.174 1.478 -7.662 -0.663 10 A_G10:U22_A A 10 ? A 22 ? 28 1 1 A A 11 1_555 A G 21 1_555 -0.490 1.575 -0.105 -7.107 3.822 -18.607 11 A_A11:G21_A A 11 ? A 21 ? 8 1 1 A G 12 1_555 A A 20 1_555 0.904 1.351 -0.150 0.981 -5.845 -15.452 12 A_G12:A20_A A 12 ? A 20 ? 8 1 1 A C 13 1_555 A G 19 1_555 1.145 -0.437 0.115 0.039 -1.314 -0.722 13 A_C13:G19_A A 13 ? A 19 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 32 1_555 A A 2 1_555 A U 31 1_555 0.542 -1.675 3.763 -9.000 3.468 25.376 -4.527 -3.637 3.138 7.555 19.607 27.119 1 AA_G1A2:U31C32_AA A 1 ? A 32 ? A 2 ? A 31 ? 1 A A 2 1_555 A U 31 1_555 A C 3 1_555 A G 30 1_555 0.661 -1.265 3.352 10.045 4.866 33.318 -2.850 0.454 3.202 8.206 -16.939 35.087 2 AA_A2C3:G30U31_AA A 2 ? A 31 ? A 3 ? A 30 ? 1 A C 3 1_555 A G 30 1_555 A G 4 1_555 A C 29 1_555 0.031 -0.831 4.138 1.929 13.946 28.357 -4.662 0.376 3.365 26.501 -3.666 31.595 3 AA_C3G4:C29G30_AA A 3 ? A 30 ? A 4 ? A 29 ? 1 A G 4 1_555 A C 29 1_555 A A 5 1_555 A U 28 1_555 -0.045 -0.498 3.644 -4.562 -3.319 23.904 -0.019 -1.480 3.624 -7.873 10.821 24.551 4 AA_G4A5:U28C29_AA A 4 ? A 29 ? A 5 ? A 28 ? 1 A A 5 1_555 A U 28 1_555 A U 6 1_555 A A 27 1_555 0.147 -1.322 3.870 -0.523 6.710 33.087 -3.523 -0.351 3.538 11.632 0.906 33.745 5 AA_A5U6:A27U28_AA A 5 ? A 28 ? A 6 ? A 27 ? 1 A U 6 1_555 A A 27 1_555 A A 7 1_555 A U 26 1_555 0.336 -0.687 3.567 2.080 17.702 24.913 -4.944 -0.209 2.551 35.770 -4.203 30.550 6 AA_U6A7:U26A27_AA A 6 ? A 27 ? A 7 ? A 26 ? 1 A A 7 1_555 A U 26 1_555 A U 8 1_555 A A 25 1_555 -0.766 -1.370 5.235 -4.244 -18.249 45.636 0.684 0.379 5.427 -22.447 5.220 49.141 7 AA_A7U8:A25U26_AA A 7 ? A 26 ? A 8 ? A 25 ? 1 A U 8 1_555 A A 25 1_555 A C 9 1_555 A G 23 1_555 1.020 -1.412 5.303 -7.824 2.205 38.431 -2.518 -2.994 4.925 3.305 11.726 39.250 8 AA_U8C9:G23A25_AA A 8 ? A 25 ? A 9 ? A 23 ? 1 A C 9 1_555 A G 23 1_555 A G 10 1_555 A U 22 1_555 0.969 -2.112 4.662 -3.064 -4.329 23.022 -3.043 -3.866 4.804 -10.666 7.549 23.617 9 AA_C9G10:U22G23_AA A 9 ? A 23 ? A 10 ? A 22 ? 1 A G 10 1_555 A U 22 1_555 A A 11 1_555 A G 21 1_555 -2.676 -1.519 5.018 -1.388 -10.830 25.696 1.118 5.007 5.342 -23.070 2.957 27.883 10 AA_G10A11:G21U22_AA A 10 ? A 22 ? A 11 ? A 21 ? 1 A A 11 1_555 A G 21 1_555 A G 12 1_555 A A 20 1_555 0.105 -1.888 3.798 1.273 8.398 12.687 -13.796 0.618 2.135 33.524 -5.083 15.258 11 AA_A11G12:A20G21_AA A 11 ? A 21 ? A 12 ? A 20 ? 1 A G 12 1_555 A A 20 1_555 A C 13 1_555 A G 19 1_555 2.289 0.184 3.918 -3.350 5.864 33.208 -0.788 -4.560 3.655 10.130 5.787 33.869 12 AA_G12C13:G19A20_AA A 12 ? A 20 ? A 13 ? A 19 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.type 1 AVANCE Bruker 600 ? 2 AVANCE Bruker 800 ? # _atom_sites.entry_id 5A18 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_