data_5M0H # _entry.id 5M0H # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5M0H pdb_00005m0h 10.2210/pdb5m0h/pdb WWPDB D_1200001681 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2017-01-18 2 'Structure model' 1 1 2017-01-25 3 'Structure model' 1 2 2017-02-15 4 'Structure model' 1 3 2024-01-17 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 4 'Structure model' chem_comp_atom 2 4 'Structure model' chem_comp_bond 3 4 'Structure model' database_2 4 4 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 4 'Structure model' '_database_2.pdbx_DOI' 2 4 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 5M0H _pdbx_database_status.recvd_initial_deposition_date 2016-10-05 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Edelmann, F.T.' 1 'Janowski, R.' 2 'Niessing, D.' 3 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat. Struct. Mol. Biol.' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1545-9985 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 24 _citation.language ? _citation.page_first 152 _citation.page_last 161 _citation.title 'Molecular architecture and dynamics of ASH1 mRNA recognition by its mRNA-transport complex.' _citation.year 2017 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/nsmb.3351 _citation.pdbx_database_id_PubMed 28092367 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Edelmann, F.T.' 1 ? primary 'Schlundt, A.' 2 ? primary 'Heym, R.G.' 3 ? primary 'Jenner, A.' 4 ? primary 'Niedner-Boblenz, A.' 5 ? primary 'Syed, M.I.' 6 ? primary 'Paillart, J.C.' 7 ? primary 'Stehle, R.' 8 ? primary 'Janowski, R.' 9 ? primary 'Sattler, M.' 10 ? primary 'Jansen, R.P.' 11 ? primary 'Niessing, D.' 12 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'ASH1 E3 (42 nt-TL/TLR)' 13504.076 1 ? ? ? ? 2 non-polymer syn 'SULFATE ION' 96.063 1 ? ? ? ? 3 water nat water 18.015 10 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GAUAACUGAAUCGCUAAGGAUGAAAGUCUAUGCGACAUUAUC _entity_poly.pdbx_seq_one_letter_code_can GAUAACUGAAUCGCUAAGGAUGAAAGUCUAUGCGACAUUAUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'SULFATE ION' SO4 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 U n 1 4 A n 1 5 A n 1 6 C n 1 7 U n 1 8 G n 1 9 A n 1 10 A n 1 11 U n 1 12 C n 1 13 G n 1 14 C n 1 15 U n 1 16 A n 1 17 A n 1 18 G n 1 19 G n 1 20 A n 1 21 U n 1 22 G n 1 23 A n 1 24 A n 1 25 A n 1 26 G n 1 27 U n 1 28 C n 1 29 U n 1 30 A n 1 31 U n 1 32 G n 1 33 C n 1 34 G n 1 35 A n 1 36 C n 1 37 A n 1 38 U n 1 39 U n 1 40 A n 1 41 U n 1 42 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 42 _pdbx_entity_src_syn.organism_scientific 'Saccharomyces cerevisiae' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 4932 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 SO4 non-polymer . 'SULFATE ION' ? 'O4 S -2' 96.063 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 A 2 2 2 A A A . n A 1 3 U 3 3 3 U U A . n A 1 4 A 4 4 4 A A A . n A 1 5 A 5 5 5 A A A . n A 1 6 C 6 6 6 C C A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 A 9 9 9 A A A . n A 1 10 A 10 10 10 A A A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 C 14 14 14 C C A . n A 1 15 U 15 15 15 U U A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 G 22 22 22 G G A . n A 1 23 A 23 23 23 A A A . n A 1 24 A 24 24 24 A A A . n A 1 25 A 25 25 25 A A A . n A 1 26 G 26 26 26 G G A . n A 1 27 U 27 27 27 U U A . n A 1 28 C 28 28 28 C C A . n A 1 29 U 29 29 29 U U A . n A 1 30 A 30 30 30 A A A . n A 1 31 U 31 31 31 U U A . n A 1 32 G 32 32 32 G G A . n A 1 33 C 33 33 33 C C A . n A 1 34 G 34 34 34 G G A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 A 37 37 37 A A A . n A 1 38 U 38 38 38 U U A . n A 1 39 U 39 39 39 U U A . n A 1 40 A 40 40 40 A A A . n A 1 41 U 41 41 41 U U A . n A 1 42 C 42 42 42 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 SO4 1 101 1 SO4 SO4 A . C 3 HOH 1 201 10 HOH HOH A . C 3 HOH 2 202 14 HOH HOH A . C 3 HOH 3 203 13 HOH HOH A . C 3 HOH 4 204 9 HOH HOH A . C 3 HOH 5 205 15 HOH HOH A . C 3 HOH 6 206 3 HOH HOH A . C 3 HOH 7 207 6 HOH HOH A . C 3 HOH 8 208 8 HOH HOH A . C 3 HOH 9 209 5 HOH HOH A . C 3 HOH 10 210 1 HOH HOH A . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 0 A G 8 ? P ? A G 8 P 2 1 Y 0 A G 8 ? "C4'" ? A G 8 "C4'" 3 1 Y 0 A G 8 ? "C3'" ? A G 8 "C3'" 4 1 Y 0 A G 8 ? "C2'" ? A G 8 "C2'" 5 1 Y 0 A A 10 ? C5 ? A A 10 C5 6 1 Y 0 A A 10 ? C2 ? A A 10 C2 7 1 Y 0 A A 10 ? C4 ? A A 10 C4 # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.10_2155: ???)' 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 5M0H _cell.details ? _cell.formula_units_Z ? _cell.length_a 64.320 _cell.length_a_esd ? _cell.length_b 64.320 _cell.length_b_esd ? _cell.length_c 75.190 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 5M0H _symmetry.cell_setting ? _symmetry.Int_Tables_number 92 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 41 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 5M0H _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.88 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 57.28 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 294 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '50 mM MES, pH 6.0, 5 % (w/v) PEG 4000, 5 mM MgSO4' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'MARMOSAIC 225 mm CCD' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2015-02-01 # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.8726 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ESRF BEAMLINE ID23-2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.8726 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline ID23-2 _diffrn_source.pdbx_synchrotron_site ESRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 5M0H _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.65 _reflns.d_resolution_low 50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4920 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F 0 _reflns.observed_criterion_sigma_I 0 _reflns.percent_possible_obs 99.6 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 7.24 _reflns.pdbx_Rmerge_I_obs 0.073 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 19.93 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 2.65 _reflns_shell.d_res_low 2.72 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 2.27 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs ? _reflns_shell.percent_possible_all 100 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.8 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 7.5 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 5M0H _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.650 _refine.ls_d_res_low 45.481 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4920 _refine.ls_number_reflns_R_free 227 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.47 _refine.ls_percent_reflns_R_free 4.61 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2125 _refine.ls_R_factor_R_free 0.2397 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2111 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 4FNJ _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 21.89 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.25 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 894 _refine_hist.pdbx_number_atoms_ligand 5 _refine_hist.number_atoms_solvent 10 _refine_hist.number_atoms_total 909 _refine_hist.d_res_high 2.650 _refine_hist.d_res_low 45.481 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.006 ? 1005 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.206 ? 1564 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 17.253 ? 500 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.051 ? 209 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.008 ? 42 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.6504 3.3391 . . 107 2290 100.00 . . . 0.4070 . 0.3068 . . . . . . . . . . 'X-RAY DIFFRACTION' 3.3391 45.4878 . . 120 2403 99.00 . . . 0.1982 . 0.1800 . . . . . . . . . . # _struct.entry_id 5M0H _struct.title 'Crystal structure of the central flexible region of ASH1 mRNA E3-localization element' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 5M0H _struct_keywords.text 'She2p, She3p, ASH1-mRNA, mRNA transport, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 5M0H _struct_ref.pdbx_db_accession 5M0H _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 5M0H _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 42 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 5M0H _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 42 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 42 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 170 ? 1 MORE -14 ? 1 'SSA (A^2)' 7800 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 1 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 1 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 1 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 41 N3 ? ? A A 2 A U 41 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog5 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 40 N1 ? ? A U 3 A A 40 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog6 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 39 N3 ? ? A A 4 A U 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 39 O4 ? ? A A 4 A U 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 38 O4 ? ? A A 5 A U 38 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog9 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 37 N1 ? ? A U 7 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 37 N6 ? ? A U 7 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 8 N2 ? ? ? 1_555 A U 11 O4 ? ? A G 8 A U 11 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog12 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 8 A C 36 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog13 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 35 N1 ? ? A U 11 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 35 N6 ? ? A U 11 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 34 N1 ? ? A C 12 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 34 O6 ? ? A C 12 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 34 N2 ? ? A C 12 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 13 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 13 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 13 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 14 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 14 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 14 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 30 N7 ? ? A U 15 A A 30 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog25 hydrog ? ? A U 15 O2 ? ? ? 1_555 A A 30 N6 ? ? A U 15 A A 30 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog26 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 29 O2 ? ? A G 18 A U 29 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog27 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 29 N3 ? ? A G 18 A U 29 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog28 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 19 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 19 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 19 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 20 N1 ? ? ? 1_555 A U 27 N3 ? ? A A 20 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 20 N6 ? ? ? 1_555 A U 27 O4 ? ? A A 20 A U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 21 N3 ? ? ? 1_555 A G 26 O6 ? ? A U 21 A G 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog34 hydrog ? ? A U 21 O2 ? ? ? 1_555 A G 26 N1 ? ? A U 21 A G 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog35 hydrog ? ? A G 22 N2 ? ? ? 1_555 A A 25 N7 ? ? A G 22 A A 25 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id SO4 _struct_site.pdbx_auth_seq_id 101 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 3 _struct_site.details 'binding site for residue SO4 A 101' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 3 A A 25 ? A A 25 . ? 1_555 ? 2 AC1 3 G A 26 ? G A 26 . ? 1_555 ? 3 AC1 3 U A 27 ? U A 27 . ? 1_555 ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N1 A C 6 ? ? C2 A C 6 ? ? O2 A C 6 ? ? 123.07 118.90 4.17 0.60 N 2 1 C2 A C 6 ? ? N1 A C 6 ? ? "C1'" A C 6 ? ? 126.72 118.80 7.92 1.10 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 SO4 S S N N 114 SO4 O1 O N N 115 SO4 O2 O N N 116 SO4 O3 O N N 117 SO4 O4 O N N 118 U OP3 O N N 119 U P P N N 120 U OP1 O N N 121 U OP2 O N N 122 U "O5'" O N N 123 U "C5'" C N N 124 U "C4'" C N R 125 U "O4'" O N N 126 U "C3'" C N S 127 U "O3'" O N N 128 U "C2'" C N R 129 U "O2'" O N N 130 U "C1'" C N R 131 U N1 N N N 132 U C2 C N N 133 U O2 O N N 134 U N3 N N N 135 U C4 C N N 136 U O4 O N N 137 U C5 C N N 138 U C6 C N N 139 U HOP3 H N N 140 U HOP2 H N N 141 U "H5'" H N N 142 U "H5''" H N N 143 U "H4'" H N N 144 U "H3'" H N N 145 U "HO3'" H N N 146 U "H2'" H N N 147 U "HO2'" H N N 148 U "H1'" H N N 149 U H3 H N N 150 U H5 H N N 151 U H6 H N N 152 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 SO4 S O1 doub N N 118 SO4 S O2 doub N N 119 SO4 S O3 sing N N 120 SO4 S O4 sing N N 121 U OP3 P sing N N 122 U OP3 HOP3 sing N N 123 U P OP1 doub N N 124 U P OP2 sing N N 125 U P "O5'" sing N N 126 U OP2 HOP2 sing N N 127 U "O5'" "C5'" sing N N 128 U "C5'" "C4'" sing N N 129 U "C5'" "H5'" sing N N 130 U "C5'" "H5''" sing N N 131 U "C4'" "O4'" sing N N 132 U "C4'" "C3'" sing N N 133 U "C4'" "H4'" sing N N 134 U "O4'" "C1'" sing N N 135 U "C3'" "O3'" sing N N 136 U "C3'" "C2'" sing N N 137 U "C3'" "H3'" sing N N 138 U "O3'" "HO3'" sing N N 139 U "C2'" "O2'" sing N N 140 U "C2'" "C1'" sing N N 141 U "C2'" "H2'" sing N N 142 U "O2'" "HO2'" sing N N 143 U "C1'" N1 sing N N 144 U "C1'" "H1'" sing N N 145 U N1 C2 sing N N 146 U N1 C6 sing N N 147 U C2 O2 doub N N 148 U C2 N3 sing N N 149 U N3 C4 sing N N 150 U N3 H3 sing N N 151 U C4 O4 doub N N 152 U C4 C5 sing N N 153 U C5 C6 doub N N 154 U C5 H5 sing N N 155 U C6 H6 sing N N 156 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5M0H 'double helix' 5M0H 'a-form double helix' 5M0H 'hairpin loop' 5M0H tetraloop 5M0H 'bulge loop' 5M0H 'mismatched base pair' 5M0H 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 42 1_555 -0.896 0.116 -0.104 -11.448 -14.693 0.964 1 A_G1:C42_A A 1 ? A 42 ? 19 1 1 A A 2 1_555 A U 41 1_555 0.054 0.466 0.912 0.779 -12.833 7.102 2 A_A2:U41_A A 2 ? A 41 ? ? ? 1 A U 3 1_555 A A 40 1_555 -0.264 0.181 0.864 4.676 -9.466 18.030 3 A_U3:A40_A A 3 ? A 40 ? ? 1 1 A A 4 1_555 A U 39 1_555 1.244 0.077 -0.200 -16.706 -25.495 2.608 4 A_A4:U39_A A 4 ? A 39 ? 20 1 1 A A 5 1_555 A U 38 1_555 -0.508 0.679 -0.524 4.340 -18.479 -35.000 5 A_A5:U38_A A 5 ? A 38 ? ? ? 1 A U 7 1_555 A A 37 1_555 0.582 -0.016 0.762 -18.041 -4.652 7.936 6 A_U7:A37_A A 7 ? A 37 ? 20 1 1 A G 8 1_555 A C 36 1_555 1.561 0.517 0.041 0.087 -13.664 6.674 7 A_G8:C36_A A 8 ? A 36 ? ? 1 1 A U 11 1_555 A A 35 1_555 -1.485 -0.223 -1.927 34.240 -25.706 -9.484 8 A_U11:A35_A A 11 ? A 35 ? 20 1 1 A C 12 1_555 A G 34 1_555 0.472 -0.063 -0.211 8.478 -13.834 1.529 9 A_C12:G34_A A 12 ? A 34 ? 19 1 1 A G 13 1_555 A C 33 1_555 -0.243 -0.200 -0.133 -4.743 -14.473 2.435 10 A_G13:C33_A A 13 ? A 33 ? 19 1 1 A C 14 1_555 A G 32 1_555 0.178 -0.152 -0.201 3.200 -8.697 -0.530 11 A_C14:G32_A A 14 ? A 32 ? 19 1 1 A U 15 1_555 A A 30 1_555 4.265 -2.496 -0.446 -17.486 0.752 -88.554 12 A_U15:A30_A A 15 ? A 30 ? 24 4 1 A G 18 1_555 A U 29 1_555 -2.439 -0.606 -0.056 -3.287 -12.912 -2.484 13 A_G18:U29_A A 18 ? A 29 ? 28 1 1 A G 19 1_555 A C 28 1_555 -0.003 -0.023 -0.129 -6.284 -7.949 3.891 14 A_G19:C28_A A 19 ? A 28 ? 19 1 1 A A 20 1_555 A U 27 1_555 0.504 -0.060 -0.030 -12.372 -8.448 5.788 15 A_A20:U27_A A 20 ? A 27 ? 20 1 1 A U 21 1_555 A G 26 1_555 2.437 -0.530 -0.017 -3.388 6.587 3.949 16 A_U21:G26_A A 21 ? A 26 ? 28 1 1 A G 22 1_555 A A 25 1_555 6.989 -4.844 0.985 13.587 -4.511 -12.335 17 A_G22:A25_A A 22 ? A 25 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 42 1_555 A A 2 1_555 A U 41 1_555 -0.162 -1.252 2.625 -10.601 7.353 36.363 -2.606 -0.773 2.296 11.352 16.366 38.511 1 AA_G1A2:U41C42_AA A 1 ? A 42 ? A 2 ? A 41 ? 1 A A 2 1_555 A U 41 1_555 A U 3 1_555 A A 40 1_555 0.165 -1.469 3.125 -2.663 2.088 29.480 -3.282 -0.849 2.990 4.086 5.212 29.670 2 AA_A2U3:A40U41_AA A 2 ? A 41 ? A 3 ? A 40 ? 1 A U 3 1_555 A A 40 1_555 A A 4 1_555 A U 39 1_555 -0.287 -1.158 3.528 10.507 19.084 43.452 -2.911 1.175 2.694 24.062 -13.248 48.370 3 AA_U3A4:U39A40_AA A 3 ? A 40 ? A 4 ? A 39 ? 1 A A 4 1_555 A U 39 1_555 A A 5 1_555 A U 38 1_555 -1.934 -0.728 2.704 -4.278 10.435 17.591 -5.736 3.812 2.315 30.396 12.462 20.872 4 AA_A4A5:U38U39_AA A 4 ? A 39 ? A 5 ? A 38 ? 1 A A 5 1_555 A U 38 1_555 A U 7 1_555 A A 37 1_555 0.575 -2.496 3.580 -12.484 17.755 54.099 -3.496 -1.242 2.538 18.699 13.148 57.984 5 AA_A5U7:A37U38_AA A 5 ? A 38 ? A 7 ? A 37 ? 1 A U 7 1_555 A A 37 1_555 A G 8 1_555 A C 36 1_555 -1.753 -1.114 3.018 7.031 -5.833 30.079 -1.078 4.421 2.713 -10.926 -13.170 31.405 6 AA_U7G8:C36A37_AA A 7 ? A 37 ? A 8 ? A 36 ? 1 A G 8 1_555 A C 36 1_555 A U 11 1_555 A A 35 1_555 -2.844 -0.845 2.375 13.178 6.846 29.365 -2.107 6.210 0.841 12.544 -24.147 32.833 7 AA_G8U11:A35C36_AA A 8 ? A 36 ? A 11 ? A 35 ? 1 A U 11 1_555 A A 35 1_555 A C 12 1_555 A G 34 1_555 0.931 -1.194 4.289 -11.284 12.208 43.395 -2.801 -2.369 3.516 15.835 14.636 46.326 8 AA_U11C12:G34A35_AA A 11 ? A 35 ? A 12 ? A 34 ? 1 A C 12 1_555 A G 34 1_555 A G 13 1_555 A C 33 1_555 0.582 -1.878 3.505 -1.528 12.946 28.198 -5.875 -1.367 2.398 24.955 2.945 31.010 9 AA_C12G13:C33G34_AA A 12 ? A 34 ? A 13 ? A 33 ? 1 A G 13 1_555 A C 33 1_555 A C 14 1_555 A G 32 1_555 -1.030 -2.197 3.062 -1.209 -0.343 30.082 -4.163 1.749 3.124 -0.661 2.329 30.108 10 AA_G13C14:G32C33_AA A 13 ? A 33 ? A 14 ? A 32 ? 1 A C 14 1_555 A G 32 1_555 A U 15 1_555 A A 30 1_555 -2.515 -2.015 3.864 10.159 8.646 73.978 -1.948 2.410 3.328 7.129 -8.376 75.002 11 AA_C14U15:A30G32_AA A 14 ? A 32 ? A 15 ? A 30 ? 1 A U 15 1_555 A A 30 1_555 A G 18 1_555 A U 29 1_555 -0.404 -0.545 6.572 6.894 -1.086 47.390 -0.499 1.593 6.466 -1.342 -8.524 47.872 12 AA_U15G18:U29A30_AA A 15 ? A 30 ? A 18 ? A 29 ? 1 A G 18 1_555 A U 29 1_555 A G 19 1_555 A C 28 1_555 0.132 -1.515 3.330 -2.483 6.372 40.357 -2.853 -0.455 3.053 9.157 3.568 40.908 13 AA_G18G19:C28U29_AA A 18 ? A 29 ? A 19 ? A 28 ? 1 A G 19 1_555 A C 28 1_555 A A 20 1_555 A U 27 1_555 0.262 -1.779 3.413 1.894 8.160 34.486 -4.101 -0.156 2.938 13.519 -3.138 35.459 14 AA_G19A20:U27C28_AA A 19 ? A 28 ? A 20 ? A 27 ? 1 A A 20 1_555 A U 27 1_555 A U 21 1_555 A G 26 1_555 0.349 -1.351 3.042 1.913 7.219 37.021 -2.924 -0.318 2.753 11.229 -2.976 37.741 15 AA_A20U21:G26U27_AA A 20 ? A 27 ? A 21 ? A 26 ? 1 A U 21 1_555 A G 26 1_555 A G 22 1_555 A A 25 1_555 -1.891 -0.996 2.748 0.964 12.267 44.233 -2.128 2.495 2.366 15.928 -1.252 45.830 16 AA_U21G22:A25G26_AA A 21 ? A 26 ? A 22 ? A 25 ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 4FNJ _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 5M0H _atom_sites.fract_transf_matrix[1][1] 0.015547 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.015547 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.013300 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P S # loop_ #