data_5YEY # _entry.id 5YEY # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.370 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5YEY pdb_00005yey 10.2210/pdb5yey/pdb WWPDB D_1300005106 ? ? BMRB 36116 ? ? # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution' _pdbx_database_related.db_id 36116 _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 5YEY _pdbx_database_status.recvd_initial_deposition_date 2017-09-20 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Liu, C.' 1 ? 'Zhou, B.' 2 ? 'Kuryavyi, V.V.' 3 ? 'Zhu, G.' 4 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Chem Sci' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-6520 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 10 _citation.language ? _citation.page_first 218 _citation.page_last 226 _citation.title 'A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K+solution.' _citation.year 2019 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1039/c8sc03813a _citation.pdbx_database_id_PubMed 30713633 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Liu, C.' 1 ? primary 'Zhou, B.' 2 ? primary 'Geng, Y.' 3 ? primary 'Yan Tam, D.' 4 ? primary 'Feng, R.' 5 ? primary 'Miao, H.' 6 ? primary 'Xu, N.' 7 ? primary 'Shi, X.' 8 ? primary 'You, Y.' 9 ? primary 'Hong, Y.' 10 0000-0002-8085-1651 primary 'Tang, B.Z.' 11 ? primary 'Kwan Lo, P.' 12 0000-0001-5255-1718 primary 'Kuryavyi, V.' 13 ? primary 'Zhu, G.' 14 0000-0003-3802-3446 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') ; _entity.formula_weight 6661.276 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DT)(DG)(DG) (DG) ; _entity_poly.pdbx_seq_one_letter_code_can GGGTTAGGGTTAGGGTTTGGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DG n 1 4 DT n 1 5 DT n 1 6 DA n 1 7 DG n 1 8 DG n 1 9 DG n 1 10 DT n 1 11 DT n 1 12 DA n 1 13 DG n 1 14 DG n 1 15 DG n 1 16 DT n 1 17 DT n 1 18 DT n 1 19 DG n 1 20 DG n 1 21 DG n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 21 _pdbx_entity_src_syn.organism_scientific 'Homo sapiens' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 9606 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 5YEY _struct_ref.pdbx_db_accession 5YEY _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 5YEY _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 21 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 5YEY _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 21 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 21 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 1 2 '2D 1H-1H NOESY' 1 isotropic 3 1 2 '2D 1H-1H TOCSY' 2 isotropic 4 1 2 '2D 1H-1H COSY' 1 isotropic 5 1 2 '2D 1H-13C HSQC' 1 isotropic # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 284 _pdbx_nmr_exptl_sample_conditions.pressure_units Pa _pdbx_nmr_exptl_sample_conditions.pressure ambient _pdbx_nmr_exptl_sample_conditions.pH 7 _pdbx_nmr_exptl_sample_conditions.ionic_strength 90 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label 1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 ;2.5 mM DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), 90% H2O/10% D2O ; '90% H2O/10% D2O' '0.1-2.5 mM DNA, 90% H2O/10% D2O' solution ? 2 ;2.5 mM DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), 100% D2O ; '100% D2O' '0.1-2.5 mM DNA, 100% D2O' solution ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 INOVA ? Varian 800 ? 2 INOVA ? Varian 500 ? # _pdbx_nmr_refine.entry_id 5YEY _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details 'the structures are based on a total of 304 distance constriants' _pdbx_nmr_refine.software_ordinal 7 # _pdbx_nmr_ensemble.entry_id 5YEY _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 5YEY _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 collection VNMR ? Varian 2 'chemical shift calculation' NMRPipe ? 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' 3 'chemical shift assignment' Sparky ? Goddard 4 'peak picking' Sparky ? Goddard 5 'data analysis' Sparky ? Goddard 6 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 7 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 5YEY _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 5YEY _struct.title 'The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 5YEY _struct_keywords.text 'G-quadruplex, DNA' _struct_keywords.pdbx_keywords DNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DG 9 O6 ? ? A DG 1 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DG 9 N7 ? ? A DG 1 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 1 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 1 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 1 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 8 N2 ? ? A DG 2 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 8 N1 ? ? A DG 2 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DG 20 O6 ? ? A DG 2 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DG 20 N7 ? ? A DG 2 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 7 N2 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 7 N1 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 19 O6 ? ? A DG 3 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 19 N7 ? ? A DG 3 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DT 5 N3 ? ? ? 1_555 A DT 16 O4 ? ? A DT 5 A DT 16 1_555 ? ? ? ? ? ? 'DT-DT MISPAIR' ? ? ? hydrog14 hydrog ? ? A DT 5 O4 ? ? ? 1_555 A DT 18 N3 ? ? A DT 5 A DT 18 1_555 ? ? ? ? ? ? 'DT-DT MISPAIR' ? ? ? hydrog15 hydrog ? ? A DA 6 N1 ? ? ? 1_555 A DT 18 N3 ? ? A DA 6 A DT 18 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog16 hydrog ? ? A DA 6 N6 ? ? ? 1_555 A DT 18 O2 ? ? A DA 6 A DT 18 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog17 hydrog ? ? A DG 7 N7 ? ? ? 1_555 A DG 15 N2 ? ? A DG 7 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 7 O6 ? ? ? 1_555 A DG 15 N1 ? ? A DG 7 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 8 N7 ? ? ? 1_555 A DG 14 N2 ? ? A DG 8 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 8 O6 ? ? ? 1_555 A DG 14 N1 ? ? A DG 8 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 13 O6 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 13 N7 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 13 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 13 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 13 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 13 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 14 N7 ? ? ? 1_555 A DG 20 N2 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 14 O6 ? ? ? 1_555 A DG 20 N1 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 15 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 5YEY _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DT 4 4 4 DT DT A . n A 1 5 DT 5 5 5 DT DT A . n A 1 6 DA 6 6 6 DA DA A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DT 16 16 16 DT DT A . n A 1 17 DT 17 17 17 DT DT A . n A 1 18 DT 18 18 18 DT DT A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DG 21 21 21 DG DG A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 3350 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2018-09-26 2 'Structure model' 1 1 2019-04-10 3 'Structure model' 1 2 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' 'Data collection' 4 3 'Structure model' 'Database references' 5 3 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' database_2 4 3 'Structure model' pdbx_database_status 5 3 'Structure model' pdbx_nmr_software # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 3 'Structure model' '_database_2.pdbx_DOI' 13 3 'Structure model' '_database_2.pdbx_database_accession' 14 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 15 3 'Structure model' '_pdbx_nmr_software.name' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 ;DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') ; 2.5 ? mM 'natural abundance' 2 ;DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') ; 2.5 ? mM 'natural abundance' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.49 2 2 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.50 3 3 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.50 4 4 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.48 5 5 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.49 6 6 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.47 7 7 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.48 8 8 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.49 9 9 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.49 10 10 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.48 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5YEY 'double helix' 5YEY 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 2 1_555 A DG 8 1_555 -1.093 -3.593 -0.027 -0.006 0.390 95.930 1 A_DG2:DG8_A A 2 ? A 8 ? 6 3 1 A DG 20 1_555 A DG 14 1_555 1.221 3.700 -0.040 -0.381 0.522 -92.275 2 A_DG20:DG14_A A 20 ? A 14 ? 6 3 1 A DG 21 1_555 A DG 13 1_555 -0.896 -3.702 -0.058 -1.741 0.793 93.087 3 A_DG21:DG13_A A 21 ? A 13 ? 6 3 1 A DT 5 1_555 A DT 16 1_555 3.502 -0.759 -1.837 -46.728 -23.207 -67.345 4 A_DT5:DT16_A A 5 ? A 16 ? ? ? 1 A DA 6 1_555 A DT 18 1_555 -0.034 1.469 -0.271 3.387 -6.134 164.971 5 A_DA6:DT18_A A 6 ? A 18 ? 21 2 1 A DG 15 1_555 A DG 19 1_555 -0.785 -3.681 -0.152 -0.150 2.539 94.101 6 A_DG15:DG19_A A 15 ? A 19 ? 6 3 1 A DG 7 1_555 A DG 3 1_555 0.785 3.692 0.159 -0.980 -3.021 -94.081 7 A_DG7:DG3_A A 7 ? A 3 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 2 1_555 A DG 8 1_555 A DG 20 1_555 A DG 14 1_555 1.897 3.568 0.019 -0.219 -0.119 -179.241 -1.784 0.949 0.020 0.059 -0.109 -179.241 1 AA_DG2DG20:DG14DG8_AA A 2 ? A 8 ? A 20 ? A 14 ? 1 A DG 20 1_555 A DG 14 1_555 A DG 21 1_555 A DG 13 1_555 -2.991 -1.568 -2.307 86.075 -155.045 10.483 -1.821 0.920 -0.291 -78.581 -43.625 177.347 2 AA_DG20DG21:DG13DG14_AA A 20 ? A 14 ? A 21 ? A 13 ? 1 A DT 5 1_555 A DT 16 1_555 A DA 6 1_555 A DT 18 1_555 2.642 3.847 0.920 8.945 -11.333 -69.001 -3.213 2.395 1.154 9.895 7.810 -70.311 3 AA_DT5DA6:DT18DT16_AA A 5 ? A 16 ? A 6 ? A 18 ? 1 A DA 6 1_555 A DT 18 1_555 A DG 15 1_555 A DG 19 1_555 -2.160 2.307 -0.831 67.666 164.719 -153.746 -1.050 -1.122 -1.108 -82.383 33.843 -179.563 4 AA_DA6DG15:DG19DT18_AA A 6 ? A 18 ? A 15 ? A 19 ? 1 A DG 15 1_555 A DG 19 1_555 A DG 7 1_555 A DG 3 1_555 -1.731 -3.623 -0.037 -1.701 -1.666 179.958 -1.811 0.865 -0.037 -0.833 0.850 179.958 5 AA_DG15DG7:DG3DG19_AA A 15 ? A 19 ? A 7 ? A 3 ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details 'the gel eletrophoresis supports the assembly is monomeric' #