data_5Z71 # _entry.id 5Z71 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5Z71 pdb_00005z71 10.2210/pdb5z71/pdb WWPDB D_1300006587 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2019-01-30 2 'Structure model' 1 1 2024-03-27 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 5Z71 _pdbx_database_status.recvd_initial_deposition_date 2018-01-26 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # _pdbx_database_related.db_name PDB _pdbx_database_related.details 'PDB entry for the same citation' _pdbx_database_related.db_id 5XZ1 _pdbx_database_related.content_type unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kanazawa, H.' 1 ? 'Tsurumi, N.' 2 ? 'Kondo, J.' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Structural studies of aminoglycoside antibiotics G418 and its derivatives with readthrough activities' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kanazawa, H.' 1 ? primary 'Tsurumi, N.' 2 ? primary 'Baasov, T.' 3 ? primary 'Kondo, J.' 4 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(P*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*CP*GP*GP*AP*AP*AP*AP*GP*UP*CP*GP*C)-3') ; 7049.243 2 ? ? ? ? 2 non-polymer syn GENETICIN 496.552 1 ? ? ? ? 3 water nat water 18.015 4 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UGCGUCGCUCCGGAAAAGUCGC _entity_poly.pdbx_seq_one_letter_code_can UGCGUCGCUCCGGAAAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 GENETICIN GET 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 C n 1 7 G n 1 8 C n 1 9 U n 1 10 C n 1 11 C n 1 12 G n 1 13 G n 1 14 A n 1 15 A n 1 16 A n 1 17 A n 1 18 G n 1 19 U n 1 20 C n 1 21 G n 1 22 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 22 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GET non-polymer . GENETICIN G418 'C20 H40 N4 O10' 496.552 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 2 2 U U A . n A 1 2 G 2 3 3 G G A . n A 1 3 C 3 4 4 C C A . n A 1 4 G 4 5 5 G G A . n A 1 5 U 5 6 6 U U A . n A 1 6 C 6 7 7 C C A . n A 1 7 G 7 8 8 G G A . n A 1 8 C 8 9 9 C C A . n A 1 9 U 9 10 10 U U A . n A 1 10 C 10 11 11 C C A . n A 1 11 C 11 12 12 C C A . n A 1 12 G 12 13 13 G G A . n A 1 13 G 13 14 14 G G A . n A 1 14 A 14 15 15 A A A . n A 1 15 A 15 16 ? ? ? A . n A 1 16 A 16 17 ? ? ? A . n A 1 17 A 17 18 ? ? ? A . n A 1 18 G 18 19 19 G G A . n A 1 19 U 19 20 20 U U A . n A 1 20 C 20 21 21 C C A . n A 1 21 G 21 22 22 G G A . n A 1 22 C 22 23 23 C C A . n B 1 1 U 1 25 25 U U B . n B 1 2 G 2 26 26 G G B . n B 1 3 C 3 27 27 C C B . n B 1 4 G 4 28 28 G G B . n B 1 5 U 5 29 29 U U B . n B 1 6 C 6 30 30 C C B . n B 1 7 G 7 31 31 G G B . n B 1 8 C 8 32 32 C C B . n B 1 9 U 9 33 33 U U B . n B 1 10 C 10 34 34 C C B . n B 1 11 C 11 35 35 C C B . n B 1 12 G 12 36 36 G G B . n B 1 13 G 13 37 37 G G B . n B 1 14 A 14 38 38 A A B . n B 1 15 A 15 39 39 A A B . n B 1 16 A 16 40 40 A A B . n B 1 17 A 17 41 41 A A B . n B 1 18 G 18 42 42 G G B . n B 1 19 U 19 43 43 U U B . n B 1 20 C 20 44 44 C C B . n B 1 21 G 21 45 45 G G B . n B 1 22 C 22 46 46 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 GET 1 201 201 GET GET B . D 3 HOH 1 301 102 HOH HOH B . D 3 HOH 2 302 104 HOH HOH B . D 3 HOH 3 303 103 HOH HOH B . D 3 HOH 4 304 101 HOH HOH B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.8.3_1479 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.24 3 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 5Z71 _cell.details ? _cell.formula_units_Z ? _cell.length_a 30.924 _cell.length_a_esd ? _cell.length_b 90.106 _cell.length_b_esd ? _cell.length_c 46.701 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 5Z71 _symmetry.cell_setting ? _symmetry.Int_Tables_number 18 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 21 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 5Z71 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.31 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 46.70 _exptl_crystal.description 'The entry contains friedel pairs in F_plus/minus columns and I_plus/minus columns' _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'MPD, Sodium chloride, Sprimine 4HCl, Sodium cacodylate (pH 5.0)' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'ADSC QUANTUM 270' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2011-12-10 # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.98 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.98 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-17A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.B_iso_Wilson_estimate 65.460 _reflns.entry_id 5Z71 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.500 _reflns.d_resolution_low 45.053 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 8669 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 98.900 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 3.827 _reflns.pdbx_Rmerge_I_obs 0.029 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 25.530 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.087 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.034 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_R_split 2.500 2.560 ? 3.610 ? ? ? ? 648 97.900 ? ? ? ? 0.313 ? ? ? ? ? ? ? ? 3.730 ? ? ? ? 0.364 ? ? 1 1 0.909 ? 2.560 2.630 ? 5.220 ? ? ? ? 597 98.200 ? ? ? ? 0.233 ? ? ? ? ? ? ? ? 3.955 ? ? ? ? 0.269 ? ? 2 1 0.960 ? 2.630 2.710 ? 6.250 ? ? ? ? 622 100.000 ? ? ? ? 0.195 ? ? ? ? ? ? ? ? 3.944 ? ? ? ? 0.226 ? ? 3 1 0.967 ? 2.710 2.790 ? 8.500 ? ? ? ? 611 100.000 ? ? ? ? 0.137 ? ? ? ? ? ? ? ? 3.817 ? ? ? ? 0.159 ? ? 4 1 0.982 ? 2.790 2.880 ? 11.770 ? ? ? ? 573 98.500 ? ? ? ? 0.096 ? ? ? ? ? ? ? ? 3.925 ? ? ? ? 0.111 ? ? 5 1 0.993 ? 2.880 2.980 ? 17.070 ? ? ? ? 543 100.000 ? ? ? ? 0.068 ? ? ? ? ? ? ? ? 3.912 ? ? ? ? 0.079 ? ? 6 1 0.997 ? 2.980 3.100 ? 23.400 ? ? ? ? 554 98.200 ? ? ? ? 0.039 ? ? ? ? ? ? ? ? 3.774 ? ? ? ? 0.045 ? ? 7 1 0.999 ? 3.100 3.220 ? 28.220 ? ? ? ? 493 100.000 ? ? ? ? 0.031 ? ? ? ? ? ? ? ? 3.848 ? ? ? ? 0.037 ? ? 8 1 0.999 ? 3.220 3.370 ? 32.620 ? ? ? ? 504 100.000 ? ? ? ? 0.032 ? ? ? ? ? ? ? ? 3.831 ? ? ? ? 0.038 ? ? 9 1 0.999 ? 3.370 3.530 ? 34.780 ? ? ? ? 482 99.200 ? ? ? ? 0.028 ? ? ? ? ? ? ? ? 3.768 ? ? ? ? 0.033 ? ? 10 1 0.999 ? 3.530 3.720 ? 36.320 ? ? ? ? 446 100.000 ? ? ? ? 0.026 ? ? ? ? ? ? ? ? 3.857 ? ? ? ? 0.031 ? ? 11 1 0.999 ? 3.720 3.950 ? 39.440 ? ? ? ? 422 99.100 ? ? ? ? 0.029 ? ? ? ? ? ? ? ? 3.803 ? ? ? ? 0.034 ? ? 12 1 0.999 ? 3.950 4.220 ? 41.230 ? ? ? ? 400 100.000 ? ? ? ? 0.025 ? ? ? ? ? ? ? ? 3.820 ? ? ? ? 0.028 ? ? 13 1 0.999 ? 4.220 4.560 ? 44.030 ? ? ? ? 377 98.700 ? ? ? ? 0.025 ? ? ? ? ? ? ? ? 3.764 ? ? ? ? 0.029 ? ? 14 1 0.999 ? 4.560 4.990 ? 45.690 ? ? ? ? 338 100.000 ? ? ? ? 0.023 ? ? ? ? ? ? ? ? 3.825 ? ? ? ? 0.027 ? ? 15 1 0.999 ? 4.990 5.580 ? 46.530 ? ? ? ? 312 99.400 ? ? ? ? 0.024 ? ? ? ? ? ? ? ? 3.747 ? ? ? ? 0.027 ? ? 16 1 0.999 ? 5.580 6.450 ? 45.140 ? ? ? ? 268 99.300 ? ? ? ? 0.025 ? ? ? ? ? ? ? ? 3.709 ? ? ? ? 0.029 ? ? 17 1 0.999 ? 6.450 7.900 ? 46.600 ? ? ? ? 239 99.600 ? ? ? ? 0.021 ? ? ? ? ? ? ? ? 3.695 ? ? ? ? 0.024 ? ? 18 1 0.999 ? 7.900 11.170 ? 49.020 ? ? ? ? 174 98.900 ? ? ? ? 0.020 ? ? ? ? ? ? ? ? 3.816 ? ? ? ? 0.023 ? ? 19 1 1.000 ? 11.170 45.053 ? 46.260 ? ? ? ? 66 66.700 ? ? ? ? 0.022 ? ? ? ? ? ? ? ? 3.424 ? ? ? ? 0.026 ? ? 20 1 0.999 ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 89.790 _refine.B_iso_mean 63.5000 _refine.B_iso_min 41.300 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details 'The entry contains friedel pairs in F_plus/minus columns and I_plus/minus columns' _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 5Z71 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.5 _refine.ls_d_res_low 45.0530 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 8659 _refine.ls_number_reflns_R_free 936 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.7000 _refine.ls_percent_reflns_R_free 10.8100 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2731 _refine.ls_R_factor_R_free 0.3051 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2695 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.360 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct ? _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 35.3100 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.4400 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.cycle_id final _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.d_res_high 2.5 _refine_hist.d_res_low 45.0530 _refine_hist.pdbx_number_atoms_ligand 34 _refine_hist.number_atoms_solvent 4 _refine_hist.number_atoms_total 910 _refine_hist.pdbx_number_residues_total 41 _refine_hist.pdbx_B_iso_mean_ligand 59.85 _refine_hist.pdbx_B_iso_mean_solvent 61.20 _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 872 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.015 ? 1006 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.487 ? 1560 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.508 ? 220 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.020 ? 41 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 12.956 ? 484 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.4966 2.6282 1219 . 132 1087 98.0000 . . . 0.4520 0.0000 0.4389 . . . . . . 7 . . . 'X-RAY DIFFRACTION' 2.6282 2.7928 1268 . 132 1136 100.0000 . . . 0.4854 0.0000 0.4167 . . . . . . 7 . . . 'X-RAY DIFFRACTION' 2.7928 3.0084 1222 . 147 1075 99.0000 . . . 0.3924 0.0000 0.3624 . . . . . . 7 . . . 'X-RAY DIFFRACTION' 3.0084 3.3111 1247 . 141 1106 98.0000 . . . 0.3196 0.0000 0.2843 . . . . . . 7 . . . 'X-RAY DIFFRACTION' 3.3111 3.7900 1249 . 137 1112 100.0000 . . . 0.2546 0.0000 0.2514 . . . . . . 7 . . . 'X-RAY DIFFRACTION' 3.7900 4.7742 1238 . 126 1112 99.0000 . . . 0.2738 0.0000 0.2408 . . . . . . 7 . . . 'X-RAY DIFFRACTION' 4.7742 45.0603 1216 . 121 1095 97.0000 . . . 0.2797 0.0000 0.2345 . . . . . . 7 . . . # _struct.entry_id 5Z71 _struct.title 'Crystal structure of the Homo Sapiens cytoplasmic ribosomal decoding site in complex with G418 (P21212 form)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 5Z71 _struct_keywords.text 'ribosome, decoding site, G418, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 5Z71 _struct_ref.pdbx_db_accession 5Z71 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 5Z71 A 1 ? 22 ? 5Z71 2 ? 23 ? 2 23 2 1 5Z71 B 1 ? 22 ? 5Z71 25 ? 46 ? 25 46 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2860 ? 1 MORE -30 ? 1 'SSA (A^2)' 7910 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 21 N1 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 21 O6 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 21 N2 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 5 O4 ? ? ? 1_555 B U 19 N3 ? ? A U 6 B U 43 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A C 6 N3 ? ? ? 1_555 B G 18 N1 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 6 N4 ? ? ? 1_555 B G 18 O6 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 O2 ? ? ? 1_555 B G 18 N2 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 8 N4 ? ? ? 1_555 B A 15 N1 ? ? A C 9 B A 39 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A U 9 N3 ? ? ? 1_555 B A 14 N1 ? ? A U 10 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 9 O4 ? ? ? 1_555 B A 14 N6 ? ? A U 10 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 11 B G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 14 B C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A A 14 N1 ? ? ? 1_555 B U 9 N3 ? ? A A 15 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 14 N6 ? ? ? 1_555 B U 9 O4 ? ? A A 15 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 18 N1 ? ? ? 1_555 B C 6 N3 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 18 N2 ? ? ? 1_555 B C 6 O2 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 18 O6 ? ? ? 1_555 B C 6 N4 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 19 N3 ? ? ? 1_555 B U 5 O4 ? ? A U 20 B U 29 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog35 hydrog ? ? A U 19 O2 ? ? ? 1_555 B U 5 N3 ? ? A U 20 B U 29 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog36 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id B _struct_site.pdbx_auth_comp_id GET _struct_site.pdbx_auth_seq_id 201 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 10 _struct_site.details 'binding site for residue GET B 201' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 10 G A 4 ? G A 5 . ? 1_555 ? 2 AC1 10 U A 5 ? U A 6 . ? 1_555 ? 3 AC1 10 C A 6 ? C A 7 . ? 1_555 ? 4 AC1 10 G A 7 ? G A 8 . ? 1_555 ? 5 AC1 10 C A 8 ? C A 9 . ? 1_555 ? 6 AC1 10 A B 15 ? A B 39 . ? 1_555 ? 7 AC1 10 A B 16 ? A B 40 . ? 1_555 ? 8 AC1 10 A B 17 ? A B 41 . ? 1_555 ? 9 AC1 10 G B 18 ? G B 42 . ? 1_555 ? 10 AC1 10 U B 19 ? U B 43 . ? 1_555 ? # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A A 16 ? A A 15 2 1 Y 1 A A 17 ? A A 16 3 1 Y 1 A A 18 ? A A 17 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GET C11 C N S 111 GET O11 O N N 112 GET C21 C N R 113 GET N21 N N N 114 GET C31 C N R 115 GET O31 O N N 116 GET C41 C N S 117 GET O41 O N N 118 GET C51 C N R 119 GET O51 O N N 120 GET C61 C N R 121 GET O61 O N N 122 GET C71 C N N 123 GET C12 C N R 124 GET N12 N N N 125 GET C22 C N N 126 GET C32 C N S 127 GET N32 N N N 128 GET C42 C N R 129 GET C52 C N S 130 GET O52 O N N 131 GET C62 C N S 132 GET O62 O N N 133 GET C13 C N R 134 GET C23 C N R 135 GET O23 O N N 136 GET C33 C N R 137 GET N33 N N N 138 GET C93 C N N 139 GET C43 C N R 140 GET O43 O N N 141 GET C83 C N N 142 GET C53 C N N 143 GET O53 O N N 144 GET H111 H N N 145 GET H21 H N N 146 GET H211 H N N 147 GET H212 H N N 148 GET H311 H N N 149 GET H31 H N N 150 GET H411 H N N 151 GET H41 H N N 152 GET H511 H N N 153 GET H611 H N N 154 GET H61 H N N 155 GET H711 H N N 156 GET H712 H N N 157 GET H713 H N N 158 GET H12 H N N 159 GET H121 H N N 160 GET H122 H N N 161 GET H221 H N N 162 GET H222 H N N 163 GET H32 H N N 164 GET H321 H N N 165 GET H322 H N N 166 GET H421 H N N 167 GET H521 H N N 168 GET H52 H N N 169 GET H621 H N N 170 GET H131 H N N 171 GET H231 H N N 172 GET H23 H N N 173 GET H331 H N N 174 GET H33 H N N 175 GET H931 H N N 176 GET H932 H N N 177 GET H933 H N N 178 GET H43 H N N 179 GET H831 H N N 180 GET H832 H N N 181 GET H833 H N N 182 GET H531 H N N 183 GET H532 H N N 184 HOH O O N N 185 HOH H1 H N N 186 HOH H2 H N N 187 U OP3 O N N 188 U P P N N 189 U OP1 O N N 190 U OP2 O N N 191 U "O5'" O N N 192 U "C5'" C N N 193 U "C4'" C N R 194 U "O4'" O N N 195 U "C3'" C N S 196 U "O3'" O N N 197 U "C2'" C N R 198 U "O2'" O N N 199 U "C1'" C N R 200 U N1 N N N 201 U C2 C N N 202 U O2 O N N 203 U N3 N N N 204 U C4 C N N 205 U O4 O N N 206 U C5 C N N 207 U C6 C N N 208 U HOP3 H N N 209 U HOP2 H N N 210 U "H5'" H N N 211 U "H5''" H N N 212 U "H4'" H N N 213 U "H3'" H N N 214 U "HO3'" H N N 215 U "H2'" H N N 216 U "HO2'" H N N 217 U "H1'" H N N 218 U H3 H N N 219 U H5 H N N 220 U H6 H N N 221 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GET C11 O11 sing N N 116 GET C11 C21 sing N N 117 GET C11 O51 sing N N 118 GET C11 H111 sing N N 119 GET O11 C42 sing N N 120 GET C21 N21 sing N N 121 GET C21 C31 sing N N 122 GET C21 H21 sing N N 123 GET N21 H211 sing N N 124 GET N21 H212 sing N N 125 GET C31 O31 sing N N 126 GET C31 C41 sing N N 127 GET C31 H311 sing N N 128 GET O31 H31 sing N N 129 GET C41 O41 sing N N 130 GET C41 C51 sing N N 131 GET C41 H411 sing N N 132 GET O41 H41 sing N N 133 GET C51 O51 sing N N 134 GET C51 C61 sing N N 135 GET C51 H511 sing N N 136 GET C61 O61 sing N N 137 GET C61 C71 sing N N 138 GET C61 H611 sing N N 139 GET O61 H61 sing N N 140 GET C71 H711 sing N N 141 GET C71 H712 sing N N 142 GET C71 H713 sing N N 143 GET C12 N12 sing N N 144 GET C12 C22 sing N N 145 GET C12 C62 sing N N 146 GET C12 H12 sing N N 147 GET N12 H121 sing N N 148 GET N12 H122 sing N N 149 GET C22 C32 sing N N 150 GET C22 H221 sing N N 151 GET C22 H222 sing N N 152 GET C32 N32 sing N N 153 GET C32 C42 sing N N 154 GET C32 H32 sing N N 155 GET N32 H321 sing N N 156 GET N32 H322 sing N N 157 GET C42 C52 sing N N 158 GET C42 H421 sing N N 159 GET C52 O52 sing N N 160 GET C52 C62 sing N N 161 GET C52 H521 sing N N 162 GET O52 H52 sing N N 163 GET C62 O62 sing N N 164 GET C62 H621 sing N N 165 GET O62 C13 sing N N 166 GET C13 C23 sing N N 167 GET C13 O53 sing N N 168 GET C13 H131 sing N N 169 GET C23 O23 sing N N 170 GET C23 C33 sing N N 171 GET C23 H231 sing N N 172 GET O23 H23 sing N N 173 GET C33 N33 sing N N 174 GET C33 C43 sing N N 175 GET C33 H331 sing N N 176 GET N33 C93 sing N N 177 GET N33 H33 sing N N 178 GET C93 H931 sing N N 179 GET C93 H932 sing N N 180 GET C93 H933 sing N N 181 GET C43 O43 sing N N 182 GET C43 C83 sing N N 183 GET C43 C53 sing N N 184 GET O43 H43 sing N N 185 GET C83 H831 sing N N 186 GET C83 H832 sing N N 187 GET C83 H833 sing N N 188 GET C53 O53 sing N N 189 GET C53 H531 sing N N 190 GET C53 H532 sing N N 191 HOH O H1 sing N N 192 HOH O H2 sing N N 193 U OP3 P sing N N 194 U OP3 HOP3 sing N N 195 U P OP1 doub N N 196 U P OP2 sing N N 197 U P "O5'" sing N N 198 U OP2 HOP2 sing N N 199 U "O5'" "C5'" sing N N 200 U "C5'" "C4'" sing N N 201 U "C5'" "H5'" sing N N 202 U "C5'" "H5''" sing N N 203 U "C4'" "O4'" sing N N 204 U "C4'" "C3'" sing N N 205 U "C4'" "H4'" sing N N 206 U "O4'" "C1'" sing N N 207 U "C3'" "O3'" sing N N 208 U "C3'" "C2'" sing N N 209 U "C3'" "H3'" sing N N 210 U "O3'" "HO3'" sing N N 211 U "C2'" "O2'" sing N N 212 U "C2'" "C1'" sing N N 213 U "C2'" "H2'" sing N N 214 U "O2'" "HO2'" sing N N 215 U "C1'" N1 sing N N 216 U "C1'" "H1'" sing N N 217 U N1 C2 sing N N 218 U N1 C6 sing N N 219 U C2 O2 doub N N 220 U C2 N3 sing N N 221 U N3 C4 sing N N 222 U N3 H3 sing N N 223 U C4 O4 doub N N 224 U C4 C5 sing N N 225 U C5 C6 doub N N 226 U C5 H5 sing N N 227 U C6 H6 sing N N 228 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5Z71 'double helix' 5Z71 'a-form double helix' 5Z71 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 B C 22 1_555 -0.890 -0.522 0.627 6.071 7.192 3.149 1 A_G3:C46_B A 3 ? B 46 ? 19 1 1 A C 3 1_555 B G 21 1_555 -0.434 -0.345 0.038 2.347 5.625 -1.525 2 A_C4:G45_B A 4 ? B 45 ? 19 1 1 A G 4 1_555 B C 20 1_555 -0.643 -0.637 -0.111 5.661 -1.830 2.170 3 A_G5:C44_B A 5 ? B 44 ? 19 1 1 A U 5 1_555 B U 19 1_555 -1.941 -1.369 -0.213 3.411 -7.506 -12.115 4 A_U6:U43_B A 6 ? B 43 ? ? ? 1 A C 6 1_555 B G 18 1_555 0.664 -0.529 -0.364 -3.486 1.180 -8.297 5 A_C7:G42_B A 7 ? B 42 ? 19 1 1 A C 8 1_555 B A 15 1_555 -1.518 -0.068 0.321 8.515 -17.478 8.998 6 A_C9:A39_B A 9 ? B 39 ? ? 1 1 A U 9 1_555 B A 14 1_555 -0.219 -0.494 -0.229 7.836 -9.956 1.536 7 A_U10:A38_B A 10 ? B 38 ? 20 1 1 A C 10 1_555 B G 13 1_555 0.596 -0.015 -0.193 12.406 -11.742 8.534 8 A_C11:G37_B A 11 ? B 37 ? 19 1 1 A C 11 1_555 B G 12 1_555 0.274 -0.207 -0.261 5.516 -5.843 -0.705 9 A_C12:G36_B A 12 ? B 36 ? 19 1 1 A G 12 1_555 B C 11 1_555 -0.146 -0.098 -0.072 -3.211 -9.065 6.796 10 A_G13:C35_B A 13 ? B 35 ? 19 1 1 A G 13 1_555 B C 10 1_555 -0.122 -0.692 0.195 3.791 -5.714 -3.889 11 A_G14:C34_B A 14 ? B 34 ? 19 1 1 A A 14 1_555 B U 9 1_555 0.638 -0.302 0.005 0.160 -7.536 -3.851 12 A_A15:U33_B A 15 ? B 33 ? 20 1 1 A G 18 1_555 B C 6 1_555 -0.062 -0.294 -0.093 1.796 0.971 -10.029 13 A_G19:C30_B A 19 ? B 30 ? 19 1 1 A U 19 1_555 B U 5 1_555 1.169 -2.045 0.053 -1.873 -14.449 -5.986 14 A_U20:U29_B A 20 ? B 29 ? 16 1 1 A C 20 1_555 B G 4 1_555 0.997 -0.580 0.052 3.581 -15.225 3.704 15 A_C21:G28_B A 21 ? B 28 ? 19 1 1 A G 21 1_555 B C 3 1_555 0.351 0.344 -0.058 -7.187 -8.912 2.465 16 A_G22:C27_B A 22 ? B 27 ? 19 1 1 A C 22 1_555 B G 2 1_555 0.187 0.093 -0.088 3.998 -1.138 -5.453 17 A_C23:G26_B A 23 ? B 26 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 B C 22 1_555 A C 3 1_555 B G 21 1_555 -0.389 -1.770 3.434 2.478 5.535 32.821 -4.005 1.090 3.066 9.692 -4.339 33.361 1 AA_G3C4:G45C46_BB A 3 ? B 46 ? A 4 ? B 45 ? 1 A C 3 1_555 B G 21 1_555 A G 4 1_555 B C 20 1_555 -0.031 -1.878 3.091 -0.080 4.588 28.647 -4.661 0.046 2.763 9.197 0.160 29.004 2 AA_C4G5:C44G45_BB A 4 ? B 45 ? A 5 ? B 44 ? 1 A G 4 1_555 B C 20 1_555 A U 5 1_555 B U 19 1_555 -0.879 -2.521 3.127 -2.858 2.366 24.767 -6.472 1.236 2.957 5.478 6.616 25.039 3 AA_G5U6:U43C44_BB A 5 ? B 44 ? A 6 ? B 43 ? 1 A U 5 1_555 B U 19 1_555 A C 6 1_555 B G 18 1_555 0.749 -2.343 3.564 0.868 -0.064 48.460 -2.848 -0.839 3.579 -0.078 -1.057 48.467 4 AA_U6C7:G42U43_BB A 6 ? B 43 ? A 7 ? B 42 ? 1 A C 6 1_555 B G 18 1_555 A C 8 1_555 B A 15 1_555 1.449 -3.547 6.316 -15.428 16.556 67.003 -4.127 -2.234 5.037 14.578 13.584 70.297 5 AA_C7C9:A39G42_BB A 7 ? B 42 ? A 9 ? B 39 ? 1 A C 8 1_555 B A 15 1_555 A U 9 1_555 B A 14 1_555 -0.081 -1.411 3.229 2.514 10.951 37.097 -3.377 0.409 2.710 16.747 -3.845 38.704 6 AA_C9U10:A38A39_BB A 9 ? B 39 ? A 10 ? B 38 ? 1 A U 9 1_555 B A 14 1_555 A C 10 1_555 B G 13 1_555 0.381 -1.161 3.128 0.555 5.496 36.633 -2.516 -0.531 2.934 8.683 -0.877 37.033 7 AA_U10C11:G37A38_BB A 10 ? B 38 ? A 11 ? B 37 ? 1 A C 10 1_555 B G 13 1_555 A C 11 1_555 B G 12 1_555 -1.047 -1.995 3.435 0.222 12.190 26.129 -6.521 2.151 2.286 25.285 -0.461 28.788 8 AA_C11C12:G36G37_BB A 11 ? B 37 ? A 12 ? B 36 ? 1 A C 11 1_555 B G 12 1_555 A G 12 1_555 B C 11 1_555 0.688 -1.658 3.432 -0.777 9.853 27.091 -5.449 -1.549 2.657 20.200 1.593 28.806 9 AA_C12G13:C35G36_BB A 12 ? B 36 ? A 13 ? B 35 ? 1 A G 12 1_555 B C 11 1_555 A G 13 1_555 B C 10 1_555 -0.550 -1.909 3.092 -0.969 1.678 33.273 -3.589 0.808 3.010 2.928 1.690 33.328 10 AA_G13G14:C34C35_BB A 13 ? B 35 ? A 14 ? B 34 ? 1 A G 13 1_555 B C 10 1_555 A A 14 1_555 B U 9 1_555 0.160 -1.707 3.235 4.205 11.364 39.077 -3.600 0.198 2.660 16.513 -6.110 40.843 11 AA_G14A15:U33C34_BB A 14 ? B 34 ? A 15 ? B 33 ? 1 A G 18 1_555 B C 6 1_555 A U 19 1_555 B U 5 1_555 -0.748 -1.451 3.512 -1.544 4.326 44.671 -2.314 0.832 3.387 5.674 2.025 44.894 12 AA_G19U20:U29C30_BB A 19 ? B 30 ? A 20 ? B 29 ? 1 A U 19 1_555 B U 5 1_555 A C 20 1_555 B G 4 1_555 0.600 -1.929 2.956 1.805 5.989 36.718 -3.707 -0.733 2.645 9.423 -2.840 37.229 13 AA_U20C21:G28U29_BB A 20 ? B 29 ? A 21 ? B 28 ? 1 A C 20 1_555 B G 4 1_555 A G 21 1_555 B C 3 1_555 -1.720 -2.454 3.428 -0.625 5.076 16.701 -11.030 5.304 2.633 16.965 2.089 17.462 14 AA_C21G22:C27G28_BB A 21 ? B 28 ? A 22 ? B 27 ? 1 A G 21 1_555 B C 3 1_555 A C 22 1_555 B G 2 1_555 0.618 -1.834 3.100 3.066 -0.261 30.598 -3.410 -0.590 3.161 -0.493 -5.792 30.749 15 AA_G22C23:G26C27_BB A 22 ? B 27 ? A 23 ? B 26 ? # _atom_sites.entry_id 5Z71 _atom_sites.fract_transf_matrix[1][1] 0.032337 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.011098 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.021413 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 # loop_ _atom_type.symbol C N O P # loop_