data_5C7W # _entry.id 5C7W # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5C7W pdb_00005c7w 10.2210/pdb5c7w/pdb WWPDB D_1000211058 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2015-08-12 2 'Structure model' 1 1 2015-08-19 3 'Structure model' 1 2 2017-11-22 4 'Structure model' 1 3 2020-01-01 5 'Structure model' 1 4 2023-09-27 6 'Structure model' 2 0 2024-05-01 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 3 'Structure model' 'Derived calculations' 4 3 'Structure model' 'Refinement description' 5 4 'Structure model' 'Author supporting evidence' 6 5 'Structure model' 'Data collection' 7 5 'Structure model' 'Database references' 8 5 'Structure model' 'Refinement description' 9 6 'Structure model' 'Data collection' 10 6 'Structure model' 'Non-polymer description' 11 6 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' citation 2 3 'Structure model' pdbx_struct_oper_list 3 3 'Structure model' software 4 4 'Structure model' pdbx_audit_support 5 5 'Structure model' chem_comp_atom 6 5 'Structure model' chem_comp_bond 7 5 'Structure model' database_2 8 5 'Structure model' pdbx_initial_refinement_model 9 6 'Structure model' chem_comp 10 6 'Structure model' chem_comp_atom 11 6 'Structure model' chem_comp_bond 12 6 'Structure model' entity # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_citation.journal_id_CSD' 2 3 'Structure model' '_pdbx_struct_oper_list.symmetry_operation' 3 3 'Structure model' '_software.classification' 4 4 'Structure model' '_pdbx_audit_support.funding_organization' 5 5 'Structure model' '_database_2.pdbx_DOI' 6 5 'Structure model' '_database_2.pdbx_database_accession' 7 6 'Structure model' '_chem_comp.formula' 8 6 'Structure model' '_chem_comp.formula_weight' 9 6 'Structure model' '_chem_comp.name' 10 6 'Structure model' '_entity.formula_weight' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 5C7W _pdbx_database_status.recvd_initial_deposition_date 2015-06-25 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Hernandez, A.R.' 1 ? 'Shao, Y.' 2 ? 'Hoshika, S.' 3 ? 'Yang, Z.' 4 ? 'Shelke, S.A.' 5 ? 'Herrou, J.' 6 ? 'Kim, H.-J.' 7 ? 'Kim, M.-J.' 8 ? 'Piccirilli, J.A.' 9 ? 'Benner, S.A.' 10 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country GE _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Angew.Chem.Int.Ed.Engl. _citation.journal_id_ASTM ACIEAY _citation.journal_id_CSD 0179 _citation.journal_id_ISSN 1521-3773 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 54 _citation.language ? _citation.page_first 9853 _citation.page_last 9856 _citation.title 'A Crystal Structure of a Functional RNA Molecule Containing an Artificial Nucleobase Pair.' _citation.year 2015 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1002/anie.201504731 _citation.pdbx_database_id_PubMed 26223188 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Hernandez, A.R.' 1 ? primary 'Shao, Y.' 2 ? primary 'Hoshika, S.' 3 ? primary 'Yang, Z.' 4 ? primary 'Shelke, S.A.' 5 ? primary 'Herrou, J.' 6 ? primary 'Kim, H.J.' 7 ? primary 'Kim, M.J.' 8 ? primary 'Piccirilli, J.A.' 9 ? primary 'Benner, S.A.' 10 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;5'-monophosphate Z:P guanine riboswitch ; 21550.793 1 ? ? ? ? 2 non-polymer syn 'COBALT HEXAMMINE(III)' 161.116 8 ? ? ? ? 3 non-polymer syn HYPOXANTHINE 136.111 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'GGA(50N)AUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAU(50L)UCC' _entity_poly.pdbx_seq_one_letter_code_can GGAXAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUXUCC _entity_poly.pdbx_strand_id C _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'COBALT HEXAMMINE(III)' NCO 3 HYPOXANTHINE HPA # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 50N n 1 5 A n 1 6 U n 1 7 A n 1 8 U n 1 9 A n 1 10 A n 1 11 U n 1 12 C n 1 13 G n 1 14 C n 1 15 G n 1 16 U n 1 17 G n 1 18 G n 1 19 A n 1 20 U n 1 21 A n 1 22 U n 1 23 G n 1 24 G n 1 25 C n 1 26 A n 1 27 C n 1 28 G n 1 29 C n 1 30 A n 1 31 A n 1 32 G n 1 33 U n 1 34 U n 1 35 U n 1 36 C n 1 37 U n 1 38 A n 1 39 C n 1 40 C n 1 41 G n 1 42 G n 1 43 G n 1 44 C n 1 45 A n 1 46 C n 1 47 C n 1 48 G n 1 49 U n 1 50 A n 1 51 A n 1 52 A n 1 53 U n 1 54 G n 1 55 U n 1 56 C n 1 57 C n 1 58 G n 1 59 A n 1 60 C n 1 61 U n 1 62 A n 1 63 U n 1 64 50L n 1 65 U n 1 66 C n 1 67 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 67 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 50L 'RNA linking' . '(5S)-2-amino-8-(5-O-phosphono-beta-D-ribofuranosyl)imidazo[1,2-a][1,3,5]triazin-4(8H)-one' ? 'C10 H14 N5 O8 P' 363.221 50N 'RNA linking' . '(1S)-1-(6-amino-2-hydroxy-5-nitropyridin-3-yl)-1,4-anhydro-5-O-phosphono-D-ribitol' ? 'C10 H14 N3 O10 P' 367.206 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HPA non-polymer . HYPOXANTHINE ? 'C5 H4 N4 O' 136.111 NCO non-polymer . 'COBALT HEXAMMINE(III)' ? 'Co H18 N6 3' 161.116 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 15 15 G G C . n A 1 2 G 2 16 16 G G C . n A 1 3 A 3 17 17 A A C . n A 1 4 50N 4 18 18 50N Z C . n A 1 5 A 5 19 19 A A C . n A 1 6 U 6 20 20 U U C . n A 1 7 A 7 21 21 A A C . n A 1 8 U 8 22 22 U U C . n A 1 9 A 9 23 23 A A C . n A 1 10 A 10 24 24 A A C . n A 1 11 U 11 25 25 U U C . n A 1 12 C 12 26 26 C C C . n A 1 13 G 13 27 27 G G C . n A 1 14 C 14 28 28 C C C . n A 1 15 G 15 29 29 G G C . n A 1 16 U 16 30 30 U U C . n A 1 17 G 17 31 31 G G C . n A 1 18 G 18 32 32 G G C . n A 1 19 A 19 33 33 A A C . n A 1 20 U 20 34 34 U U C . n A 1 21 A 21 35 35 A A C . n A 1 22 U 22 36 36 U U C . n A 1 23 G 23 37 37 G G C . n A 1 24 G 24 38 38 G G C . n A 1 25 C 25 39 39 C C C . n A 1 26 A 26 40 40 A A C . n A 1 27 C 27 41 41 C C C . n A 1 28 G 28 42 42 G G C . n A 1 29 C 29 43 43 C C C . n A 1 30 A 30 44 44 A A C . n A 1 31 A 31 45 45 A A C . n A 1 32 G 32 46 46 G G C . n A 1 33 U 33 47 47 U U C . n A 1 34 U 34 48 48 U U C . n A 1 35 U 35 49 49 U U C . n A 1 36 C 36 50 50 C C C . n A 1 37 U 37 51 51 U U C . n A 1 38 A 38 52 52 A A C . n A 1 39 C 39 53 53 C C C . n A 1 40 C 40 54 54 C C C . n A 1 41 G 41 55 55 G G C . n A 1 42 G 42 56 56 G G C . n A 1 43 G 43 57 57 G G C . n A 1 44 C 44 58 58 C C C . n A 1 45 A 45 59 59 A A C . n A 1 46 C 46 60 60 C C C . n A 1 47 C 47 61 61 C C C . n A 1 48 G 48 62 62 G G C . n A 1 49 U 49 63 63 U U C . n A 1 50 A 50 64 64 A A C . n A 1 51 A 51 65 65 A A C . n A 1 52 A 52 66 66 A A C . n A 1 53 U 53 67 67 U U C . n A 1 54 G 54 68 68 G G C . n A 1 55 U 55 69 69 U U C . n A 1 56 C 56 70 70 C C C . n A 1 57 C 57 71 71 C C C . n A 1 58 G 58 72 72 G G C . n A 1 59 A 59 73 73 A A C . n A 1 60 C 60 74 74 C C C . n A 1 61 U 61 75 75 U U C . n A 1 62 A 62 76 76 A A C . n A 1 63 U 63 77 77 U U C . n A 1 64 50L 64 78 78 50L P C . n A 1 65 U 65 79 79 U U C . n A 1 66 C 66 80 80 C C C . n A 1 67 C 67 81 81 C C C . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 NCO 1 101 1 NCO NCO C . C 2 NCO 1 102 2 NCO NCO C . D 2 NCO 1 103 3 NCO NCO C . E 2 NCO 1 104 4 NCO NCO C . F 2 NCO 1 105 5 NCO NCO C . G 2 NCO 1 106 6 NCO NCO C . H 2 NCO 1 107 7 NCO NCO C . I 2 NCO 1 108 8 NCO NCO C . J 3 HPA 1 109 1 HPA HPA C . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.8.2_1309 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? SCALA ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 5C7W _cell.details ? _cell.formula_units_Z ? _cell.length_a 52.180 _cell.length_a_esd ? _cell.length_b 52.180 _cell.length_b_esd ? _cell.length_c 274.500 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 5C7W _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 5C7W _exptl.crystals_number ? _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.51 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 50.97 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.5 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 296 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '17% PEG 1000, 240 mM NH4OAc, 10 mM K-HEPES, 10 mM Co(NH3)6Cl3' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'PSI PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2014-04-07 # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97918 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 24-ID-E' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97918 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 24-ID-E _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 5C7W _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.22 _reflns.d_resolution_low 44.59 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4107 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 8.54 _reflns.pdbx_Rmerge_I_obs 0.083 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 24.9 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 3.22 _reflns_shell.d_res_low 3.34 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 4.1 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs ? _reflns_shell.percent_possible_all 100 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.537 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 8.95 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 5C7W _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.220 _refine.ls_d_res_low 42.923 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 3887 _refine.ls_number_reflns_R_free 220 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.71 _refine.ls_percent_reflns_R_free 5.36 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2308 _refine.ls_R_factor_R_free 0.2797 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2277 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 4FE5 _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details 'Random selection' _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 27.49 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.34 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1428 _refine_hist.pdbx_number_atoms_ligand 66 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1494 _refine_hist.d_res_high 3.220 _refine_hist.d_res_low 42.923 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.010 ? 1654 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.802 ? 2618 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 17.134 ? 837 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.068 ? 334 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.010 ? 69 ? f_plane_restr ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 3.2204 _refine_ls_shell.d_res_low 4.0569 _refine_ls_shell.number_reflns_all . _refine_ls_shell.number_reflns_obs . _refine_ls_shell.number_reflns_R_free 109 _refine_ls_shell.number_reflns_R_work 1861 _refine_ls_shell.percent_reflns_obs 100.00 _refine_ls_shell.percent_reflns_R_free . _refine_ls_shell.R_factor_all . _refine_ls_shell.R_factor_obs . _refine_ls_shell.R_factor_R_free 0.3071 _refine_ls_shell.R_factor_R_free_error . _refine_ls_shell.R_factor_R_work 0.2335 _refine_ls_shell.redundancy_reflns_all . _refine_ls_shell.redundancy_reflns_obs . _refine_ls_shell.wR_factor_all . _refine_ls_shell.wR_factor_obs . _refine_ls_shell.wR_factor_R_free . _refine_ls_shell.wR_factor_R_work . _refine_ls_shell.pdbx_total_number_of_bins_used . _refine_ls_shell.pdbx_phase_error . _refine_ls_shell.pdbx_fsc_work . _refine_ls_shell.pdbx_fsc_free . # _struct.entry_id 5C7W _struct.title ;5'-monophosphate Z:P Guanine Riboswitch bound to hypoxanthine. ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag ? # _struct_keywords.entry_id 5C7W _struct_keywords.text 'expanded RNA; riboswitch; Unnatural base pair, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 2 ? I N N 2 ? J N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 5C7W _struct_ref.pdbx_db_accession 5C7W _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 5C7W _struct_ref_seq.pdbx_strand_id C _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 67 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 5C7W _struct_ref_seq.db_align_beg 15 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 81 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 15 _struct_ref_seq.pdbx_auth_seq_align_end 81 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A A 3 "O3'" ? ? ? 1_555 A 50N 4 P1 ? ? C A 17 C 50N 18 1_555 ? ? ? ? ? ? ? 1.598 ? ? covale2 covale one ? A 50N 4 O6 ? ? ? 1_555 A A 5 P ? ? C 50N 18 C A 19 1_555 ? ? ? ? ? ? ? 1.608 ? ? covale3 covale both ? A U 63 "O3'" ? ? ? 1_555 A 50L 64 P1 ? ? C U 77 C 50L 78 1_555 ? ? ? ? ? ? ? 1.609 ? ? covale4 covale one ? A 50L 64 O4 ? ? ? 1_555 A U 65 P ? ? C 50L 78 C U 79 1_555 ? ? ? ? ? ? ? 1.584 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 67 N3 ? ? C G 15 C C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 67 O2 ? ? C G 15 C C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 67 N4 ? ? C G 15 C C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 66 N3 ? ? C G 16 C C 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 66 O2 ? ? C G 16 C C 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 66 N4 ? ? C G 16 C C 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 65 N3 ? ? C A 17 C U 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 65 O4 ? ? C A 17 C U 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 62 N1 ? ? C U 20 C A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 62 N6 ? ? C U 20 C A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 61 N3 ? ? C A 21 C U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 61 O4 ? ? C A 21 C U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 38 N1 ? ? C U 22 C A 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 38 N6 ? ? C U 22 C A 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 9 N6 ? ? ? 1_555 A G 32 N3 ? ? C A 23 C G 46 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 31 N1 ? ? C U 25 C A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 31 N6 ? ? C U 25 C A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 29 N4 ? ? C G 27 C C 43 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog19 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 28 N1 ? ? C C 28 C G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 28 O6 ? ? C C 28 C G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 28 N2 ? ? C C 28 C G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 27 N3 ? ? C G 29 C C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 27 O2 ? ? C G 29 C C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 27 N4 ? ? C G 29 C C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 26 N1 ? ? C U 30 C A 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 26 N6 ? ? C U 30 C A 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 25 N3 ? ? C G 31 C C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 25 O2 ? ? C G 31 C C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 25 N4 ? ? C G 31 C C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 19 N1 ? ? ? 1_555 A A 52 N6 ? ? C A 33 C A 66 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog31 hydrog ? ? A U 20 N3 ? ? ? 1_555 A A 51 N7 ? ? C U 34 C A 65 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog32 hydrog ? ? A U 20 O2 ? ? ? 1_555 A A 51 N6 ? ? C U 34 C A 65 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog33 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 47 N3 ? ? C G 37 C C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 47 O2 ? ? C G 37 C C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 47 N4 ? ? C G 37 C C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 46 N3 ? ? C G 38 C C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 46 O2 ? ? C G 38 C C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 46 N4 ? ? C G 38 C C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 24 N2 ? ? ? 1_555 A A 52 N1 ? ? C G 38 C A 66 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog40 hydrog ? ? A G 24 N3 ? ? ? 1_555 A A 52 N6 ? ? C G 38 C A 66 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog41 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 39 N3 ? ? C G 46 C C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 39 O2 ? ? C G 46 C C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 39 N4 ? ? C G 46 C C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 33 N3 ? ? ? 1_555 A U 37 O4 ? ? C U 47 C U 51 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog45 hydrog ? ? A U 35 N3 ? ? ? 1_555 A A 62 N3 ? ? C U 49 C A 76 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog46 hydrog ? ? A C 36 N4 ? ? ? 1_555 A U 61 O2 ? ? C C 50 C U 75 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog47 hydrog ? ? A C 40 N3 ? ? ? 1_555 A G 58 N1 ? ? C C 54 C G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 40 N4 ? ? ? 1_555 A G 58 O6 ? ? C C 54 C G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 40 O2 ? ? ? 1_555 A G 58 N2 ? ? C C 54 C G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 57 N3 ? ? C G 55 C C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 57 O2 ? ? C G 55 C C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 57 N4 ? ? C G 55 C C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 42 N1 ? ? ? 1_555 A C 56 N3 ? ? C G 56 C C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 42 N2 ? ? ? 1_555 A C 56 O2 ? ? C G 56 C C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 56 N4 ? ? C G 56 C C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 43 N1 ? ? ? 1_555 A U 55 O2 ? ? C G 57 C U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog57 hydrog ? ? A G 43 O6 ? ? ? 1_555 A U 55 N3 ? ? C G 57 C U 69 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog58 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 54 N1 ? ? C C 58 C G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 54 O6 ? ? C C 58 C G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 54 N2 ? ? C C 58 C G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A A 45 N1 ? ? ? 1_555 A U 53 N3 ? ? C A 59 C U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A A 45 N6 ? ? ? 1_555 A U 53 O4 ? ? C A 59 C U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 47 O2 ? ? ? 1_555 A A 51 N6 ? ? C C 61 C A 65 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software C NCO 101 ? 6 'binding site for residue NCO C 101' AC2 Software C NCO 102 ? 2 'binding site for residue NCO C 102' AC3 Software C NCO 103 ? 6 'binding site for residue NCO C 103' AC4 Software C NCO 104 ? 3 'binding site for residue NCO C 104' AC5 Software C NCO 105 ? 5 'binding site for residue NCO C 105' AC6 Software C NCO 106 ? 4 'binding site for residue NCO C 106' AC7 Software C NCO 107 ? 3 'binding site for residue NCO C 107' AC8 Software C NCO 108 ? 5 'binding site for residue NCO C 108' AC9 Software C HPA 109 ? 8 'binding site for residue HPA C 109' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 6 C A 25 ? C C 39 . ? 1_555 ? 2 AC1 6 G A 41 ? G C 55 . ? 1_555 ? 3 AC1 6 G A 42 ? G C 56 . ? 1_555 ? 4 AC1 6 G A 43 ? G C 57 . ? 1_555 ? 5 AC1 6 G A 54 ? G C 68 . ? 1_555 ? 6 AC1 6 U A 55 ? U C 69 . ? 1_555 ? 7 AC2 2 G A 23 ? G C 37 . ? 1_555 ? 8 AC2 2 G A 24 ? G C 38 . ? 1_555 ? 9 AC3 6 U A 16 ? U C 30 . ? 1_555 ? 10 AC3 6 G A 17 ? G C 31 . ? 1_555 ? 11 AC3 6 G A 18 ? G C 32 . ? 1_555 ? 12 AC3 6 A A 51 ? A C 65 . ? 1_555 ? 13 AC3 6 A A 52 ? A C 66 . ? 1_555 ? 14 AC3 6 U A 53 ? U C 67 . ? 1_555 ? 15 AC4 3 C A 47 ? C C 61 . ? 1_555 ? 16 AC4 3 G A 48 ? G C 62 . ? 1_555 ? 17 AC4 3 C A 67 ? C C 81 . ? 6_454 ? 18 AC5 5 A A 31 ? A C 45 . ? 1_555 ? 19 AC5 5 G A 32 ? G C 46 . ? 1_555 ? 20 AC5 5 U A 33 ? U C 47 . ? 1_555 ? 21 AC5 5 C A 36 ? C C 50 . ? 1_555 ? 22 AC5 5 U A 37 ? U C 51 . ? 1_555 ? 23 AC6 4 A A 7 ? A C 21 . ? 1_555 ? 24 AC6 4 U A 8 ? U C 22 . ? 1_555 ? 25 AC6 4 C A 14 ? C C 28 . ? 8_555 ? 26 AC6 4 G A 15 ? G C 29 . ? 8_555 ? 27 AC7 3 U A 33 ? U C 47 . ? 1_555 ? 28 AC7 3 U A 35 ? U C 49 . ? 1_555 ? 29 AC7 3 C A 66 ? C C 80 . ? 10_555 ? 30 AC8 5 C A 12 ? C C 26 . ? 1_555 ? 31 AC8 5 G A 13 ? G C 27 . ? 8_555 ? 32 AC8 5 U A 53 ? U C 67 . ? 8_555 ? 33 AC8 5 G A 54 ? G C 68 . ? 8_555 ? 34 AC8 5 U A 55 ? U C 69 . ? 1_555 ? 35 AC9 8 A A 7 ? A C 21 . ? 1_555 ? 36 AC9 8 U A 8 ? U C 22 . ? 1_555 ? 37 AC9 8 U A 33 ? U C 47 . ? 1_555 ? 38 AC9 8 U A 37 ? U C 51 . ? 1_555 ? 39 AC9 8 A A 38 ? A C 52 . ? 1_555 ? 40 AC9 8 A A 59 ? A C 73 . ? 1_555 ? 41 AC9 8 C A 60 ? C C 74 . ? 1_555 ? 42 AC9 8 U A 61 ? U C 75 . ? 1_555 ? # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 1 _pdbx_validate_rmsd_bond.auth_atom_id_1 N9 _pdbx_validate_rmsd_bond.auth_asym_id_1 C _pdbx_validate_rmsd_bond.auth_comp_id_1 A _pdbx_validate_rmsd_bond.auth_seq_id_1 24 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 C4 _pdbx_validate_rmsd_bond.auth_asym_id_2 C _pdbx_validate_rmsd_bond.auth_comp_id_2 A _pdbx_validate_rmsd_bond.auth_seq_id_2 24 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.411 _pdbx_validate_rmsd_bond.bond_target_value 1.374 _pdbx_validate_rmsd_bond.bond_deviation 0.037 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.006 _pdbx_validate_rmsd_bond.linker_flag N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 C8 C G 27 ? ? N9 C G 27 ? ? C4 C G 27 ? ? 109.00 106.40 2.60 0.40 N 2 1 "O3'" C G 38 ? ? P C C 39 ? ? OP1 C C 39 ? ? 117.39 110.50 6.89 1.10 Y 3 1 N1 C C 54 ? ? C2 C C 54 ? ? O2 C C 54 ? ? 122.72 118.90 3.82 0.60 N 4 1 N3 C G 56 ? ? C2 C G 56 ? ? N2 C G 56 ? ? 124.52 119.90 4.62 0.70 N 5 1 "O5'" C G 57 ? ? P C G 57 ? ? OP1 C G 57 ? ? 99.93 105.70 -5.77 0.90 N 6 1 C8 C A 59 ? ? N9 C A 59 ? ? C4 C A 59 ? ? 108.66 105.80 2.86 0.40 N 7 1 C6 C C 60 ? ? N1 C C 60 ? ? C2 C C 60 ? ? 123.20 120.30 2.90 0.40 N 8 1 "O5'" C A 65 ? ? P C A 65 ? ? OP1 C A 65 ? ? 99.24 105.70 -6.46 0.90 N 9 1 C6 C A 65 ? ? N1 C A 65 ? ? C2 C A 65 ? ? 114.96 118.60 -3.64 0.60 N 10 1 OP1 C A 66 ? ? P C A 66 ? ? OP2 C A 66 ? ? 128.91 119.60 9.31 1.50 N 11 1 N1 C A 66 ? ? C2 C A 66 ? ? N3 C A 66 ? ? 125.34 129.30 -3.96 0.50 N 12 1 C2 C A 66 ? ? N3 C A 66 ? ? C4 C A 66 ? ? 113.96 110.60 3.36 0.50 N 13 1 C6 C U 67 ? ? N1 C U 67 ? ? C2 C U 67 ? ? 125.85 121.00 4.85 0.60 N 14 1 C5 C U 67 ? ? C4 C U 67 ? ? O4 C U 67 ? ? 121.42 125.90 -4.48 0.60 N 15 1 OP1 C C 71 ? ? P C C 71 ? ? OP2 C C 71 ? ? 108.93 119.60 -10.67 1.50 N # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -7.5373 _pdbx_refine_tls.origin_y -11.2460 _pdbx_refine_tls.origin_z 4.2317 _pdbx_refine_tls.T[1][1] 0.9364 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] -0.1644 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.1150 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.4938 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] -0.0494 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.8250 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.4356 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -1.6881 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.5383 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 3.1439 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.1706 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 1.2401 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.2268 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.0051 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.0510 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.0529 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] -0.0878 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] -1.0337 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] 0.2506 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.0281 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] 0.3173 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 50L P1 P N N 1 50L N1 N N N 2 50L C1 C N N 3 50L C2 C N N 4 50L O1 O N N 5 50L N2 N N N 6 50L C3 C N N 7 50L N3 N N N 8 50L N4 N N N 9 50L C4 C N N 10 50L C5 C N N 11 50L O2 O N N 12 50L C6 C N R 13 50L O3 O N N 14 50L C7 C N S 15 50L O4 O N N 16 50L C8 C N R 17 50L O5 O N N 18 50L C9 C N R 19 50L N5 N N N 20 50L C10 C N N 21 50L O6 O N N 22 50L O7 O N N 23 50L H1 H N N 24 50L H2 H N N 25 50L H3 H N N 26 50L H5 H N N 27 50L H6 H N N 28 50L H7 H N N 29 50L H8 H N N 30 50L H9 H N N 31 50L H10 H N N 32 50L H11 H N N 33 50L H12 H N N 34 50L H13 H N N 35 50L H15 H N N 36 50L O8 O N N 37 50L H17 H N N 38 50N P1 P N N 39 50N C1 C Y N 40 50N O1 O N N 41 50N N1 N Y N 42 50N C2 C Y N 43 50N C3 C Y N 44 50N C4 C Y N 45 50N OP1 O N N 46 50N OP2 O N N 47 50N O4 O N N 48 50N C5 C N N 49 50N C6 C N R 50 50N O5 O N N 51 50N C7 C N S 52 50N O6 O N N 53 50N C8 C N R 54 50N O7 O N N 55 50N C9 C N S 56 50N C10 C Y N 57 50N N2 N N N 58 50N O8 O N N 59 50N O9 O N N 60 50N N3 N N N 61 50N H1 H N N 62 50N HOP2 H N N 63 50N H4 H N N 64 50N H5 H N N 65 50N H6 H N N 66 50N H7 H N N 67 50N H8 H N N 68 50N H9 H N N 69 50N H10 H N N 70 50N H11 H N N 71 50N H13 H N N 72 50N H14 H N N 73 50N H15 H N N 74 50N OP3 O N N 75 50N HOP3 H N N 76 A OP3 O N N 77 A P P N N 78 A OP1 O N N 79 A OP2 O N N 80 A "O5'" O N N 81 A "C5'" C N N 82 A "C4'" C N R 83 A "O4'" O N N 84 A "C3'" C N S 85 A "O3'" O N N 86 A "C2'" C N R 87 A "O2'" O N N 88 A "C1'" C N R 89 A N9 N Y N 90 A C8 C Y N 91 A N7 N Y N 92 A C5 C Y N 93 A C6 C Y N 94 A N6 N N N 95 A N1 N Y N 96 A C2 C Y N 97 A N3 N Y N 98 A C4 C Y N 99 A HOP3 H N N 100 A HOP2 H N N 101 A "H5'" H N N 102 A "H5''" H N N 103 A "H4'" H N N 104 A "H3'" H N N 105 A "HO3'" H N N 106 A "H2'" H N N 107 A "HO2'" H N N 108 A "H1'" H N N 109 A H8 H N N 110 A H61 H N N 111 A H62 H N N 112 A H2 H N N 113 C OP3 O N N 114 C P P N N 115 C OP1 O N N 116 C OP2 O N N 117 C "O5'" O N N 118 C "C5'" C N N 119 C "C4'" C N R 120 C "O4'" O N N 121 C "C3'" C N S 122 C "O3'" O N N 123 C "C2'" C N R 124 C "O2'" O N N 125 C "C1'" C N R 126 C N1 N N N 127 C C2 C N N 128 C O2 O N N 129 C N3 N N N 130 C C4 C N N 131 C N4 N N N 132 C C5 C N N 133 C C6 C N N 134 C HOP3 H N N 135 C HOP2 H N N 136 C "H5'" H N N 137 C "H5''" H N N 138 C "H4'" H N N 139 C "H3'" H N N 140 C "HO3'" H N N 141 C "H2'" H N N 142 C "HO2'" H N N 143 C "H1'" H N N 144 C H41 H N N 145 C H42 H N N 146 C H5 H N N 147 C H6 H N N 148 G OP3 O N N 149 G P P N N 150 G OP1 O N N 151 G OP2 O N N 152 G "O5'" O N N 153 G "C5'" C N N 154 G "C4'" C N R 155 G "O4'" O N N 156 G "C3'" C N S 157 G "O3'" O N N 158 G "C2'" C N R 159 G "O2'" O N N 160 G "C1'" C N R 161 G N9 N Y N 162 G C8 C Y N 163 G N7 N Y N 164 G C5 C Y N 165 G C6 C N N 166 G O6 O N N 167 G N1 N N N 168 G C2 C N N 169 G N2 N N N 170 G N3 N N N 171 G C4 C Y N 172 G HOP3 H N N 173 G HOP2 H N N 174 G "H5'" H N N 175 G "H5''" H N N 176 G "H4'" H N N 177 G "H3'" H N N 178 G "HO3'" H N N 179 G "H2'" H N N 180 G "HO2'" H N N 181 G "H1'" H N N 182 G H8 H N N 183 G H1 H N N 184 G H21 H N N 185 G H22 H N N 186 HPA N1 N Y N 187 HPA C2 C Y N 188 HPA N3 N Y N 189 HPA C4 C Y N 190 HPA C5 C Y N 191 HPA C6 C Y N 192 HPA O6 O N N 193 HPA N7 N Y N 194 HPA C8 C Y N 195 HPA N9 N Y N 196 HPA HN1 H N N 197 HPA H2 H N N 198 HPA HN7 H N N 199 HPA H8 H N N 200 NCO CO CO N N 201 NCO N1 N N N 202 NCO N2 N N N 203 NCO N3 N N N 204 NCO N4 N N N 205 NCO N5 N N N 206 NCO N6 N N N 207 NCO HN11 H N N 208 NCO HN12 H N N 209 NCO HN13 H N N 210 NCO HN21 H N N 211 NCO HN22 H N N 212 NCO HN23 H N N 213 NCO HN31 H N N 214 NCO HN32 H N N 215 NCO HN33 H N N 216 NCO HN41 H N N 217 NCO HN42 H N N 218 NCO HN43 H N N 219 NCO HN51 H N N 220 NCO HN52 H N N 221 NCO HN53 H N N 222 NCO HN61 H N N 223 NCO HN62 H N N 224 NCO HN63 H N N 225 U OP3 O N N 226 U P P N N 227 U OP1 O N N 228 U OP2 O N N 229 U "O5'" O N N 230 U "C5'" C N N 231 U "C4'" C N R 232 U "O4'" O N N 233 U "C3'" C N S 234 U "O3'" O N N 235 U "C2'" C N R 236 U "O2'" O N N 237 U "C1'" C N R 238 U N1 N N N 239 U C2 C N N 240 U O2 O N N 241 U N3 N N N 242 U C4 C N N 243 U O4 O N N 244 U C5 C N N 245 U C6 C N N 246 U HOP3 H N N 247 U HOP2 H N N 248 U "H5'" H N N 249 U "H5''" H N N 250 U "H4'" H N N 251 U "H3'" H N N 252 U "HO3'" H N N 253 U "H2'" H N N 254 U "HO2'" H N N 255 U "H1'" H N N 256 U H3 H N N 257 U H5 H N N 258 U H6 H N N 259 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 50L O7 P1 sing N N 1 50L P1 O6 doub N N 2 50L P1 O2 sing N N 3 50L C10 C1 doub N N 4 50L C10 N5 sing N N 5 50L C1 N1 sing N N 6 50L O1 C2 doub N N 7 50L O2 C5 sing N N 8 50L C5 C6 sing N N 9 50L O3 C6 sing N N 10 50L O3 C9 sing N N 11 50L N5 C2 sing N N 12 50L N5 C4 sing N N 13 50L C2 N2 sing N N 14 50L N1 C4 sing N N 15 50L N1 C9 sing N N 16 50L C6 C7 sing N N 17 50L C4 N4 doub N N 18 50L C9 C8 sing N N 19 50L N2 C3 doub N N 20 50L N4 C3 sing N N 21 50L C3 N3 sing N N 22 50L C7 C8 sing N N 23 50L C7 O4 sing N N 24 50L C8 O5 sing N N 25 50L C1 H1 sing N N 26 50L N3 H2 sing N N 27 50L N3 H3 sing N N 28 50L C5 H5 sing N N 29 50L C5 H6 sing N N 30 50L C6 H7 sing N N 31 50L C7 H8 sing N N 32 50L O4 H9 sing N N 33 50L C8 H10 sing N N 34 50L O5 H11 sing N N 35 50L C9 H12 sing N N 36 50L C10 H13 sing N N 37 50L O7 H15 sing N N 38 50L P1 O8 sing N N 39 50L O8 H17 sing N N 40 50N O8 N3 sing N N 41 50N N2 C2 sing N N 42 50N N3 O9 doub N N 43 50N N3 C3 sing N N 44 50N C2 C3 sing Y N 45 50N C2 N1 doub Y N 46 50N C3 C4 doub Y N 47 50N OP1 P1 doub N N 48 50N N1 C1 sing Y N 49 50N C4 C10 sing Y N 50 50N O6 C7 sing N N 51 50N C1 C10 doub Y N 52 50N C1 O1 sing N N 53 50N P1 OP2 sing N N 54 50N P1 O4 sing N N 55 50N C7 C8 sing N N 56 50N C7 C6 sing N N 57 50N O4 C5 sing N N 58 50N C10 C9 sing N N 59 50N C8 C9 sing N N 60 50N C8 O7 sing N N 61 50N C5 C6 sing N N 62 50N C9 O5 sing N N 63 50N C6 O5 sing N N 64 50N C4 H1 sing N N 65 50N OP2 HOP2 sing N N 66 50N C5 H4 sing N N 67 50N C5 H5 sing N N 68 50N C6 H6 sing N N 69 50N C7 H7 sing N N 70 50N O6 H8 sing N N 71 50N C8 H9 sing N N 72 50N O7 H10 sing N N 73 50N C9 H11 sing N N 74 50N N2 H13 sing N N 75 50N N2 H14 sing N N 76 50N O1 H15 sing N N 77 50N P1 OP3 sing N N 78 50N OP3 HOP3 sing N N 79 A OP3 P sing N N 80 A OP3 HOP3 sing N N 81 A P OP1 doub N N 82 A P OP2 sing N N 83 A P "O5'" sing N N 84 A OP2 HOP2 sing N N 85 A "O5'" "C5'" sing N N 86 A "C5'" "C4'" sing N N 87 A "C5'" "H5'" sing N N 88 A "C5'" "H5''" sing N N 89 A "C4'" "O4'" sing N N 90 A "C4'" "C3'" sing N N 91 A "C4'" "H4'" sing N N 92 A "O4'" "C1'" sing N N 93 A "C3'" "O3'" sing N N 94 A "C3'" "C2'" sing N N 95 A "C3'" "H3'" sing N N 96 A "O3'" "HO3'" sing N N 97 A "C2'" "O2'" sing N N 98 A "C2'" "C1'" sing N N 99 A "C2'" "H2'" sing N N 100 A "O2'" "HO2'" sing N N 101 A "C1'" N9 sing N N 102 A "C1'" "H1'" sing N N 103 A N9 C8 sing Y N 104 A N9 C4 sing Y N 105 A C8 N7 doub Y N 106 A C8 H8 sing N N 107 A N7 C5 sing Y N 108 A C5 C6 sing Y N 109 A C5 C4 doub Y N 110 A C6 N6 sing N N 111 A C6 N1 doub Y N 112 A N6 H61 sing N N 113 A N6 H62 sing N N 114 A N1 C2 sing Y N 115 A C2 N3 doub Y N 116 A C2 H2 sing N N 117 A N3 C4 sing Y N 118 C OP3 P sing N N 119 C OP3 HOP3 sing N N 120 C P OP1 doub N N 121 C P OP2 sing N N 122 C P "O5'" sing N N 123 C OP2 HOP2 sing N N 124 C "O5'" "C5'" sing N N 125 C "C5'" "C4'" sing N N 126 C "C5'" "H5'" sing N N 127 C "C5'" "H5''" sing N N 128 C "C4'" "O4'" sing N N 129 C "C4'" "C3'" sing N N 130 C "C4'" "H4'" sing N N 131 C "O4'" "C1'" sing N N 132 C "C3'" "O3'" sing N N 133 C "C3'" "C2'" sing N N 134 C "C3'" "H3'" sing N N 135 C "O3'" "HO3'" sing N N 136 C "C2'" "O2'" sing N N 137 C "C2'" "C1'" sing N N 138 C "C2'" "H2'" sing N N 139 C "O2'" "HO2'" sing N N 140 C "C1'" N1 sing N N 141 C "C1'" "H1'" sing N N 142 C N1 C2 sing N N 143 C N1 C6 sing N N 144 C C2 O2 doub N N 145 C C2 N3 sing N N 146 C N3 C4 doub N N 147 C C4 N4 sing N N 148 C C4 C5 sing N N 149 C N4 H41 sing N N 150 C N4 H42 sing N N 151 C C5 C6 doub N N 152 C C5 H5 sing N N 153 C C6 H6 sing N N 154 G OP3 P sing N N 155 G OP3 HOP3 sing N N 156 G P OP1 doub N N 157 G P OP2 sing N N 158 G P "O5'" sing N N 159 G OP2 HOP2 sing N N 160 G "O5'" "C5'" sing N N 161 G "C5'" "C4'" sing N N 162 G "C5'" "H5'" sing N N 163 G "C5'" "H5''" sing N N 164 G "C4'" "O4'" sing N N 165 G "C4'" "C3'" sing N N 166 G "C4'" "H4'" sing N N 167 G "O4'" "C1'" sing N N 168 G "C3'" "O3'" sing N N 169 G "C3'" "C2'" sing N N 170 G "C3'" "H3'" sing N N 171 G "O3'" "HO3'" sing N N 172 G "C2'" "O2'" sing N N 173 G "C2'" "C1'" sing N N 174 G "C2'" "H2'" sing N N 175 G "O2'" "HO2'" sing N N 176 G "C1'" N9 sing N N 177 G "C1'" "H1'" sing N N 178 G N9 C8 sing Y N 179 G N9 C4 sing Y N 180 G C8 N7 doub Y N 181 G C8 H8 sing N N 182 G N7 C5 sing Y N 183 G C5 C6 sing N N 184 G C5 C4 doub Y N 185 G C6 O6 doub N N 186 G C6 N1 sing N N 187 G N1 C2 sing N N 188 G N1 H1 sing N N 189 G C2 N2 sing N N 190 G C2 N3 doub N N 191 G N2 H21 sing N N 192 G N2 H22 sing N N 193 G N3 C4 sing N N 194 HPA N1 C2 sing Y N 195 HPA N1 C6 sing Y N 196 HPA N1 HN1 sing N N 197 HPA C2 N3 doub Y N 198 HPA C2 H2 sing N N 199 HPA N3 C4 sing Y N 200 HPA C4 C5 doub Y N 201 HPA C4 N9 sing Y N 202 HPA C5 C6 sing Y N 203 HPA C5 N7 sing Y N 204 HPA C6 O6 doub N N 205 HPA N7 C8 sing Y N 206 HPA N7 HN7 sing N N 207 HPA C8 N9 doub Y N 208 HPA C8 H8 sing N N 209 NCO CO N1 sing N N 210 NCO CO N2 sing N N 211 NCO CO N3 sing N N 212 NCO CO N4 sing N N 213 NCO CO N5 sing N N 214 NCO CO N6 sing N N 215 NCO N1 HN11 sing N N 216 NCO N1 HN12 sing N N 217 NCO N1 HN13 sing N N 218 NCO N2 HN21 sing N N 219 NCO N2 HN22 sing N N 220 NCO N2 HN23 sing N N 221 NCO N3 HN31 sing N N 222 NCO N3 HN32 sing N N 223 NCO N3 HN33 sing N N 224 NCO N4 HN41 sing N N 225 NCO N4 HN42 sing N N 226 NCO N4 HN43 sing N N 227 NCO N5 HN51 sing N N 228 NCO N5 HN52 sing N N 229 NCO N5 HN53 sing N N 230 NCO N6 HN61 sing N N 231 NCO N6 HN62 sing N N 232 NCO N6 HN63 sing N N 233 U OP3 P sing N N 234 U OP3 HOP3 sing N N 235 U P OP1 doub N N 236 U P OP2 sing N N 237 U P "O5'" sing N N 238 U OP2 HOP2 sing N N 239 U "O5'" "C5'" sing N N 240 U "C5'" "C4'" sing N N 241 U "C5'" "H5'" sing N N 242 U "C5'" "H5''" sing N N 243 U "C4'" "O4'" sing N N 244 U "C4'" "C3'" sing N N 245 U "C4'" "H4'" sing N N 246 U "O4'" "C1'" sing N N 247 U "C3'" "O3'" sing N N 248 U "C3'" "C2'" sing N N 249 U "C3'" "H3'" sing N N 250 U "O3'" "HO3'" sing N N 251 U "C2'" "O2'" sing N N 252 U "C2'" "C1'" sing N N 253 U "C2'" "H2'" sing N N 254 U "O2'" "HO2'" sing N N 255 U "C1'" N1 sing N N 256 U "C1'" "H1'" sing N N 257 U N1 C2 sing N N 258 U N1 C6 sing N N 259 U C2 O2 doub N N 260 U C2 N3 sing N N 261 U N3 C4 sing N N 262 U N3 H3 sing N N 263 U C4 O4 doub N N 264 U C4 C5 sing N N 265 U C5 C6 doub N N 266 U C5 H5 sing N N 267 U C6 H6 sing N N 268 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5C7W 'double helix' 5C7W 'a-form double helix' 5C7W 'mismatched base pair' 5C7W 'internal loop' 5C7W 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 67 1_555 -0.874 -0.537 0.296 0.026 -1.707 0.922 1 C_G15:C81_C C 15 ? C 81 ? 19 1 1 A G 2 1_555 A C 66 1_555 -0.171 -0.430 -0.730 -15.055 -18.138 2.433 2 C_G16:C80_C C 16 ? C 80 ? 19 1 1 A A 3 1_555 A U 65 1_555 0.015 0.100 -0.344 -20.443 -4.889 -11.402 3 C_A17:U79_C C 17 ? C 79 ? 20 1 1 A U 6 1_555 A A 62 1_555 0.213 -0.542 1.361 -16.179 -11.073 -3.944 4 C_U20:A76_C C 20 ? C 76 ? 20 1 1 A A 7 1_555 A U 61 1_555 0.210 -0.114 0.217 -0.276 -18.677 -8.048 5 C_A21:U75_C C 21 ? C 75 ? 20 1 1 A U 33 1_555 A U 37 1_555 3.083 -0.349 0.608 28.954 27.887 -61.766 6 C_U47:U51_C C 47 ? C 51 ? ? ? 1 A U 8 1_555 A A 38 1_555 -0.490 0.360 -1.208 29.372 -4.865 -2.201 7 C_U22:A52_C C 22 ? C 52 ? 20 1 1 A C 39 1_555 A G 32 1_555 -0.727 0.019 -0.592 12.539 -4.194 -4.519 8 C_C53:G46_C C 53 ? C 46 ? 19 1 1 A U 11 1_555 A A 31 1_555 -0.132 -0.071 0.203 10.079 -14.550 0.174 9 C_U25:A45_C C 25 ? C 45 ? 20 1 1 A G 13 1_555 A C 29 1_555 -0.181 0.452 -0.243 -10.851 10.470 -4.017 10 C_G27:C43_C C 27 ? C 43 ? ? ? 1 A C 14 1_555 A G 28 1_555 0.184 0.013 0.218 6.713 5.733 4.633 11 C_C28:G42_C C 28 ? C 42 ? 19 1 1 A G 15 1_555 A C 27 1_555 -0.396 -0.085 -0.025 1.414 -5.478 3.684 12 C_G29:C41_C C 29 ? C 41 ? 19 1 1 A U 16 1_555 A A 26 1_555 0.155 0.056 -0.229 14.453 -11.473 2.822 13 C_U30:A40_C C 30 ? C 40 ? 20 1 1 A G 17 1_555 A C 25 1_555 0.049 -0.329 0.452 15.027 1.421 4.655 14 C_G31:C39_C C 31 ? C 39 ? 19 1 1 A C 46 1_555 A G 24 1_555 0.451 -0.136 0.451 -20.360 -2.087 4.437 15 C_C60:G38_C C 60 ? C 38 ? 19 1 1 A A 19 1_555 A A 52 1_555 4.993 0.621 0.171 -11.540 -4.663 -105.735 16 C_A33:A66_C C 33 ? C 66 ? ? ? 1 A U 20 1_555 A A 51 1_555 4.342 -2.510 -0.204 -0.712 2.042 -96.581 17 C_U34:A65_C C 34 ? C 65 ? 24 4 1 A G 23 1_555 A C 47 1_555 0.184 -0.142 0.213 -1.176 -10.441 2.273 18 C_G37:C61_C C 37 ? C 61 ? 19 1 1 A C 40 1_555 A G 58 1_555 -0.130 -0.204 0.680 -20.622 -4.336 1.489 19 C_C54:G72_C C 54 ? C 72 ? 19 1 1 A G 41 1_555 A C 57 1_555 -0.077 -0.190 -0.108 -10.292 -14.514 0.280 20 C_G55:C71_C C 55 ? C 71 ? 19 1 1 A G 42 1_555 A C 56 1_555 -1.523 -0.359 -0.127 -9.423 -16.510 -3.868 21 C_G56:C70_C C 56 ? C 70 ? 19 1 1 A G 43 1_555 A U 55 1_555 -2.135 -0.455 0.343 -4.941 -13.018 3.360 22 C_G57:U69_C C 57 ? C 69 ? 28 1 1 A C 44 1_555 A G 54 1_555 0.408 -0.256 0.698 -0.690 -5.523 -4.642 23 C_C58:G68_C C 58 ? C 68 ? 19 1 1 A A 45 1_555 A U 53 1_555 0.338 -0.286 -0.203 -2.904 -9.939 -6.635 24 C_A59:U67_C C 59 ? C 67 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 67 1_555 A G 2 1_555 A C 66 1_555 0.192 -1.878 3.808 4.647 7.890 36.275 -4.084 0.381 3.339 12.430 -7.321 37.375 1 CC_G15G16:C80C81_CC C 15 ? C 81 ? C 16 ? C 80 ? 1 A G 2 1_555 A C 66 1_555 A A 3 1_555 A U 65 1_555 -0.623 -1.005 3.237 -5.477 15.218 31.653 -3.756 0.266 2.573 25.893 9.318 35.452 2 CC_G16A17:U79C80_CC C 16 ? C 80 ? C 17 ? C 79 ? 1 A U 6 1_555 A A 62 1_555 A A 7 1_555 A U 61 1_555 0.550 -1.935 2.353 14.121 6.536 28.321 -4.298 0.767 1.926 12.259 -26.484 32.237 3 CC_U20A21:U75A76_CC C 20 ? C 76 ? C 21 ? C 75 ? 1 A A 7 1_555 A U 61 1_555 A U 33 1_555 A U 37 1_555 1.631 -0.654 6.637 -25.584 -151.097 24.380 3.091 -1.417 1.802 -85.903 14.545 153.862 4 CC_A21U47:U51U75_CC C 21 ? C 75 ? C 47 ? C 51 ? 1 A U 33 1_555 A U 37 1_555 A U 8 1_555 A A 38 1_555 0.092 0.623 -4.043 3.994 -31.063 -2.958 -7.510 -0.648 0.219 84.047 10.806 -31.455 5 CC_U47U22:A52U51_CC C 47 ? C 51 ? C 22 ? C 52 ? 1 A U 8 1_555 A A 38 1_555 A C 39 1_555 A G 32 1_555 -0.182 -2.481 2.207 160.193 -53.944 130.410 -1.085 0.555 2.264 -27.133 -80.573 175.406 6 CC_U22C53:G46A52_CC C 22 ? C 52 ? C 53 ? C 46 ? 1 A C 39 1_555 A G 32 1_555 A U 11 1_555 A A 31 1_555 -1.915 -0.523 3.378 -12.468 -0.365 59.013 -0.502 1.240 3.682 -0.366 12.505 60.200 7 CC_C53U25:A45G46_CC C 53 ? C 46 ? C 25 ? C 45 ? 1 A G 13 1_555 A C 29 1_555 A C 14 1_555 A G 28 1_555 0.557 -1.808 2.876 -2.550 2.464 34.458 -3.361 -1.271 2.698 4.146 4.290 34.634 8 CC_G27C28:G42C43_CC C 27 ? C 43 ? C 28 ? C 42 ? 1 A C 14 1_555 A G 28 1_555 A G 15 1_555 A C 27 1_555 -0.073 -2.262 2.894 0.577 8.574 28.044 -5.922 0.243 2.122 17.190 -1.157 29.306 9 CC_C28G29:C41G42_CC C 28 ? C 42 ? C 29 ? C 41 ? 1 A G 15 1_555 A C 27 1_555 A U 16 1_555 A A 26 1_555 -0.062 -1.528 2.972 4.132 0.790 29.887 -3.079 0.877 2.896 1.523 -7.962 30.175 10 CC_G29U30:A40C41_CC C 29 ? C 41 ? C 30 ? C 40 ? 1 A U 16 1_555 A A 26 1_555 A G 17 1_555 A C 25 1_555 0.654 -1.480 3.111 -9.602 7.570 28.128 -4.095 -2.878 2.304 14.727 18.679 30.622 11 CC_U30G31:C39A40_CC C 30 ? C 40 ? C 31 ? C 39 ? 1 A C 46 1_555 A G 24 1_555 A A 19 1_555 A A 52 1_555 -0.082 -6.999 0.692 -7.373 -8.734 -120.245 4.043 -0.059 0.382 5.031 -4.247 -120.572 12 CC_C60A33:A66G38_CC C 60 ? C 38 ? C 33 ? C 66 ? 1 A A 19 1_555 A A 52 1_555 A U 20 1_555 A A 51 1_555 0.154 -1.408 3.070 12.334 -0.413 36.273 -2.100 1.240 2.980 -0.640 -19.142 38.248 13 CC_A33U34:A65A66_CC C 33 ? C 66 ? C 34 ? C 65 ? 1 A C 40 1_555 A G 58 1_555 A G 41 1_555 A C 57 1_555 -0.249 -1.159 2.976 8.496 4.856 37.970 -2.241 1.269 2.698 7.315 -12.800 39.166 14 CC_C54G55:C71G72_CC C 54 ? C 72 ? C 55 ? C 71 ? 1 A G 41 1_555 A C 57 1_555 A G 42 1_555 A C 56 1_555 0.153 -1.139 3.015 -2.043 11.998 23.614 -5.146 -0.786 2.169 27.131 4.620 26.526 15 CC_G55G56:C70C71_CC C 55 ? C 71 ? C 56 ? C 70 ? 1 A G 42 1_555 A C 56 1_555 A G 43 1_555 A U 55 1_555 0.609 -1.132 2.927 -6.631 5.795 32.883 -2.721 -1.939 2.530 10.016 11.460 34.010 16 CC_G56G57:U69C70_CC C 56 ? C 70 ? C 57 ? C 69 ? 1 A G 43 1_555 A U 55 1_555 A C 44 1_555 A G 54 1_555 -0.325 -1.145 3.123 -4.532 -1.230 45.471 -1.371 0.037 3.168 -1.586 5.845 45.700 17 CC_G57C58:G68U69_CC C 57 ? C 69 ? C 58 ? C 68 ? 1 A C 44 1_555 A G 54 1_555 A A 45 1_555 A U 53 1_555 0.364 -2.409 3.430 6.556 -4.758 28.643 -3.575 0.830 3.762 -9.383 -12.929 29.744 18 CC_C58A59:U67G68_CC C 58 ? C 68 ? C 59 ? C 67 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Defense Threat Reduction Agency (DTRA)' 'United States' HDTRA1-13-1-0004 1 'National Aeronautic Space Administration (NASA, United States)' 'United States' NNX10AT28G 2 'Templeton World Charitable Fund' 'United States' ? 3 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 4FE5 _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 5C7W _atom_sites.fract_transf_matrix[1][1] 0.019164 _atom_sites.fract_transf_matrix[1][2] 0.011065 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.022129 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.003643 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C CO N O P # loop_