data_5FK3 # _entry.id 5FK3 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5FK3 pdb_00005fk3 10.2210/pdb5fk3/pdb PDBE EBI-65293 ? ? WWPDB D_1290065293 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2016-05-25 2 'Structure model' 1 1 2016-07-06 3 'Structure model' 1 2 2024-01-10 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Derived calculations' 5 3 'Structure model' Other 6 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 3 'Structure model' chem_comp_atom 2 3 'Structure model' chem_comp_bond 3 3 'Structure model' database_2 4 3 'Structure model' pdbx_database_status 5 3 'Structure model' pdbx_initial_refinement_model 6 3 'Structure model' pdbx_struct_conn_angle 7 3 'Structure model' struct_conn 8 3 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_database_2.pdbx_database_accession' 3 3 'Structure model' '_pdbx_database_status.status_code_sf' 4 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_comp_id' 5 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id' 6 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_asym_id' 7 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_atom_id' 8 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_comp_id' 9 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_seq_id' 10 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_symmetry' 11 3 'Structure model' '_pdbx_struct_conn_angle.ptnr2_auth_comp_id' 12 3 'Structure model' '_pdbx_struct_conn_angle.ptnr2_auth_seq_id' 13 3 'Structure model' '_pdbx_struct_conn_angle.ptnr2_label_asym_id' 14 3 'Structure model' '_pdbx_struct_conn_angle.ptnr2_label_atom_id' 15 3 'Structure model' '_pdbx_struct_conn_angle.ptnr2_label_comp_id' 16 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_comp_id' 17 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id' 18 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_asym_id' 19 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_atom_id' 20 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_comp_id' 21 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_seq_id' 22 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_symmetry' 23 3 'Structure model' '_pdbx_struct_conn_angle.value' 24 3 'Structure model' '_struct_conn.pdbx_dist_value' 25 3 'Structure model' '_struct_conn.ptnr1_auth_comp_id' 26 3 'Structure model' '_struct_conn.ptnr1_auth_seq_id' 27 3 'Structure model' '_struct_conn.ptnr1_label_asym_id' 28 3 'Structure model' '_struct_conn.ptnr1_label_atom_id' 29 3 'Structure model' '_struct_conn.ptnr1_label_comp_id' 30 3 'Structure model' '_struct_conn.ptnr1_label_seq_id' 31 3 'Structure model' '_struct_conn.ptnr1_symmetry' 32 3 'Structure model' '_struct_conn.ptnr2_auth_comp_id' 33 3 'Structure model' '_struct_conn.ptnr2_auth_seq_id' 34 3 'Structure model' '_struct_conn.ptnr2_label_asym_id' 35 3 'Structure model' '_struct_conn.ptnr2_label_atom_id' 36 3 'Structure model' '_struct_conn.ptnr2_label_comp_id' 37 3 'Structure model' '_struct_conn.ptnr2_label_seq_id' 38 3 'Structure model' '_struct_conn.ptnr2_symmetry' 39 3 'Structure model' '_struct_site.pdbx_auth_asym_id' 40 3 'Structure model' '_struct_site.pdbx_auth_comp_id' 41 3 'Structure model' '_struct_site.pdbx_auth_seq_id' # _pdbx_database_status.status_code REL _pdbx_database_status.entry_id 5FK3 _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.SG_entry . _pdbx_database_status.recvd_initial_deposition_date 2015-10-14 _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.status_code_nmr_data ? # loop_ _pdbx_database_related.db_name _pdbx_database_related.db_id _pdbx_database_related.content_type _pdbx_database_related.details PDB 5FJC unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT C-2BU' PDB 5FK1 unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS UG' PDB 5FK2 unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS GG' PDB 5FK4 unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS UU' PDB 5FK5 unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS AA' PDB 5FK6 unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS CA' PDB 5FKD unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS UA' PDB 5FKE unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS GU' PDB 5FKF unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS UC' PDB 5FKG unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS CG' PDB 5FKH unspecified 'SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS CU' # loop_ _audit_author.name _audit_author.pdbx_ordinal 'Huang, L.' 1 'Lilley, D.M.J.' 2 # _citation.id primary _citation.title 'A Critical Base Pair in K-Turns Determines the Conformational Class Adopted, and Correlates with Biological Function.' _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_volume 44 _citation.page_first 5390 _citation.page_last ? _citation.year 2016 _citation.journal_id_ASTM NARHAD _citation.country UK _citation.journal_id_ISSN 0305-1048 _citation.journal_id_CSD 0389 _citation.book_publisher ? _citation.pdbx_database_id_PubMed 27016741 _citation.pdbx_database_id_DOI 10.1093/NAR/GKW201 # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Huang, L.' 1 ? primary 'Wang, J.' 2 ? primary 'Lilley, D.M.J.' 3 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'SAM-I RIBOSWITCH' 30543.330 1 ? ? 'SAM BINDING DOMAIN, RESIDUES 1-94' ? 2 non-polymer syn S-ADENOSYLMETHIONINE 398.437 1 ? ? ? ? 3 non-polymer syn 'BARIUM ION' 137.327 15 ? ? ? ? 4 non-polymer syn 'POTASSIUM ION' 39.098 3 ? ? ? ? 5 water nat water 18.015 14 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGCUUAUCAAGAGAGGGCGAGCGACUGGCGCGAAGACCCCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGU UGAAAGAUGAGCCG ; _entity_poly.pdbx_seq_one_letter_code_can ;GGCUUAUCAAGAGAGGGCGAGCGACUGGCGCGAAGACCCCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGU UGAAAGAUGAGCCG ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 S-ADENOSYLMETHIONINE SAM 3 'BARIUM ION' BA 4 'POTASSIUM ION' K 5 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 U n 1 5 U n 1 6 A n 1 7 U n 1 8 C n 1 9 A n 1 10 A n 1 11 G n 1 12 A n 1 13 G n 1 14 A n 1 15 G n 1 16 G n 1 17 G n 1 18 C n 1 19 G n 1 20 A n 1 21 G n 1 22 C n 1 23 G n 1 24 A n 1 25 C n 1 26 U n 1 27 G n 1 28 G n 1 29 C n 1 30 G n 1 31 C n 1 32 G n 1 33 A n 1 34 A n 1 35 G n 1 36 A n 1 37 C n 1 38 C n 1 39 C n 1 40 C n 1 41 C n 1 42 G n 1 43 G n 1 44 C n 1 45 A n 1 46 A n 1 47 C n 1 48 C n 1 49 A n 1 50 G n 1 51 A n 1 52 A n 1 53 A n 1 54 U n 1 55 G n 1 56 G n 1 57 U n 1 58 G n 1 59 C n 1 60 C n 1 61 A n 1 62 A n 1 63 U n 1 64 U n 1 65 C n 1 66 C n 1 67 U n 1 68 G n 1 69 C n 1 70 A n 1 71 G n 1 72 C n 1 73 G n 1 74 G n 1 75 A n 1 76 A n 1 77 A n 1 78 C n 1 79 G n 1 80 U n 1 81 U n 1 82 G n 1 83 A n 1 84 A n 1 85 A n 1 86 G n 1 87 A n 1 88 U n 1 89 G n 1 90 A n 1 91 G n 1 92 C n 1 93 C n 1 94 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num ? _pdbx_entity_src_syn.pdbx_end_seq_num ? _pdbx_entity_src_syn.organism_scientific 'THERMOANAEROBACTER TENGCONGENSIS' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 119072 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 BA non-polymer . 'BARIUM ION' ? 'Ba 2' 137.327 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 SAM non-polymer . S-ADENOSYLMETHIONINE ? 'C15 H22 N6 O5 S' 398.437 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 A 6 6 6 A A A . n A 1 7 U 7 7 7 U U A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 A 10 10 10 A A A . n A 1 11 G 11 11 11 G G A . n A 1 12 A 12 12 12 A A A . n A 1 13 G 13 13 13 G G A . n A 1 14 A 14 14 14 A A A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 G 17 17 17 G G A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n A 1 23 G 23 23 23 G G A . n A 1 24 A 24 24 24 A A A . n A 1 25 C 25 25 25 C C A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 C 29 29 29 C C A . n A 1 30 G 30 30 30 G G A . n A 1 31 C 31 31 31 C C A . n A 1 32 G 32 32 32 G G A . n A 1 33 A 33 33 33 A A A . n A 1 34 A 34 34 34 A A A . n A 1 35 G 35 35 35 G G A . n A 1 36 A 36 36 36 A A A . n A 1 37 C 37 37 37 C C A . n A 1 38 C 38 38 38 C C A . n A 1 39 C 39 39 39 C C A . n A 1 40 C 40 40 40 C C A . n A 1 41 C 41 41 41 C C A . n A 1 42 G 42 42 42 G G A . n A 1 43 G 43 43 43 G G A . n A 1 44 C 44 44 44 C C A . n A 1 45 A 45 45 45 A A A . n A 1 46 A 46 46 46 A A A . n A 1 47 C 47 47 47 C C A . n A 1 48 C 48 48 48 C C A . n A 1 49 A 49 49 49 A A A . n A 1 50 G 50 50 50 G G A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 A 53 53 53 A A A . n A 1 54 U 54 54 54 U U A . n A 1 55 G 55 55 55 G G A . n A 1 56 G 56 56 56 G G A . n A 1 57 U 57 57 57 U U A . n A 1 58 G 58 58 58 G G A . n A 1 59 C 59 59 59 C C A . n A 1 60 C 60 60 60 C C A . n A 1 61 A 61 61 61 A A A . n A 1 62 A 62 62 62 A A A . n A 1 63 U 63 63 63 U U A . n A 1 64 U 64 64 64 U U A . n A 1 65 C 65 65 65 C C A . n A 1 66 C 66 66 66 C C A . n A 1 67 U 67 67 67 U U A . n A 1 68 G 68 68 68 G G A . n A 1 69 C 69 69 69 C C A . n A 1 70 A 70 70 70 A A A . n A 1 71 G 71 71 71 G G A . n A 1 72 C 72 72 72 C C A . n A 1 73 G 73 73 73 G G A . n A 1 74 G 74 74 74 G G A . n A 1 75 A 75 75 75 A A A . n A 1 76 A 76 76 76 A A A . n A 1 77 A 77 77 77 A A A . n A 1 78 C 78 78 78 C C A . n A 1 79 G 79 79 79 G G A . n A 1 80 U 80 80 80 U U A . n A 1 81 U 81 81 81 U U A . n A 1 82 G 82 82 82 G G A . n A 1 83 A 83 83 83 A A A . n A 1 84 A 84 84 84 A A A . n A 1 85 A 85 85 85 A A A . n A 1 86 G 86 86 86 G G A . n A 1 87 A 87 87 87 A A A . n A 1 88 U 88 88 88 U U A . n A 1 89 G 89 89 89 G G A . n A 1 90 A 90 90 90 A A A . n A 1 91 G 91 91 91 G G A . n A 1 92 C 92 92 92 C C A . n A 1 93 C 93 93 93 C C A . n A 1 94 G 94 94 94 G G A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 SAM 1 1095 1095 SAM SAM A . C 3 BA 1 1096 1096 BA BA A . D 3 BA 1 1097 1097 BA BA A . E 3 BA 1 1098 1098 BA BA A . F 3 BA 1 1099 1099 BA BA A . G 3 BA 1 1100 1100 BA BA A . H 3 BA 1 1101 1101 BA BA A . I 3 BA 1 1102 1102 BA BA A . J 3 BA 1 1103 1103 BA BA A . K 3 BA 1 1104 1104 BA BA A . L 3 BA 1 1105 1105 BA BA A . M 3 BA 1 1106 1106 BA BA A . N 3 BA 1 1107 1107 BA BA A . O 3 BA 1 1108 1108 BA BA A . P 3 BA 1 1109 1109 BA BA A . Q 3 BA 1 1110 1110 BA BA A . R 4 K 1 1111 1111 K K A . S 4 K 1 1112 1112 K K A . T 4 K 1 1113 1113 K K A . U 5 HOH 1 2001 2001 HOH HOH A . U 5 HOH 2 2002 2002 HOH HOH A . U 5 HOH 3 2003 2003 HOH HOH A . U 5 HOH 4 2004 2004 HOH HOH A . U 5 HOH 5 2005 2005 HOH HOH A . U 5 HOH 6 2006 2006 HOH HOH A . U 5 HOH 7 2007 2007 HOH HOH A . U 5 HOH 8 2008 2008 HOH HOH A . U 5 HOH 9 2009 2009 HOH HOH A . U 5 HOH 10 2010 2010 HOH HOH A . U 5 HOH 11 2011 2011 HOH HOH A . U 5 HOH 12 2012 2012 HOH HOH A . U 5 HOH 13 2013 2013 HOH HOH A . U 5 HOH 14 2014 2014 HOH HOH A . # loop_ _software.name _software.classification _software.version _software.citation_id _software.pdbx_ordinal PHENIX refinement '(PHENIX.REFINE)' ? 1 iMOSFLM 'data reduction' . ? 2 Aimless 'data scaling' . ? 3 PHASER phasing . ? 4 # _cell.entry_id 5FK3 _cell.length_a 62.262 _cell.length_b 62.262 _cell.length_c 153.780 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 90.00 _cell.Z_PDB 8 _cell.pdbx_unique_axis ? # _symmetry.entry_id 5FK3 _symmetry.space_group_name_H-M 'P 43 21 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 96 # _exptl.entry_id 5FK3 _exptl.method 'X-RAY DIFFRACTION' _exptl.crystals_number 1 # _exptl_crystal.id 1 _exptl_crystal.density_meas ? _exptl_crystal.density_Matthews 2.03 _exptl_crystal.density_percent_sol 39.45 _exptl_crystal.description NONE # _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.method ? _exptl_crystal_grow.temp ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.pH 7 _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.pdbx_details '40 MM NA-CACODYLATE (PH 7.0), 80 MM KCL, 10 MM BACL2, 12 MM SPERMINE-HCL, 14% (V/V) MPD' # _diffrn.id 1 _diffrn.ambient_temp 173 _diffrn.ambient_temp_details ? _diffrn.crystal_id 1 # _diffrn_detector.diffrn_id 1 _diffrn_detector.detector PIXEL _diffrn_detector.type 'DECTRIS PIXEL' _diffrn_detector.pdbx_collection_date 2013-08-05 _diffrn_detector.details ? # _diffrn_radiation.diffrn_id 1 _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.monochromator ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9794 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.diffrn_id 1 _diffrn_source.source SYNCHROTRON _diffrn_source.type 'DIAMOND BEAMLINE I03' _diffrn_source.pdbx_synchrotron_site Diamond _diffrn_source.pdbx_synchrotron_beamline I03 _diffrn_source.pdbx_wavelength 0.9794 _diffrn_source.pdbx_wavelength_list ? # _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.entry_id 5FK3 _reflns.observed_criterion_sigma_I 1.9 _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 76.89 _reflns.d_resolution_high 2.50 _reflns.number_obs 11159 _reflns.number_all ? _reflns.percent_possible_obs 100.0 _reflns.pdbx_Rmerge_I_obs 0.09 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI 13.10 _reflns.B_iso_Wilson_estimate 71.11 _reflns.pdbx_redundancy 11.3 # _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_ordinal 1 _reflns_shell.d_res_high 2.50 _reflns_shell.d_res_low 2.60 _reflns_shell.percent_possible_all 100.0 _reflns_shell.Rmerge_I_obs 0.09 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.meanI_over_sigI_obs 1.90 _reflns_shell.pdbx_redundancy 11.3 # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 5FK3 _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 11084 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.33 _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 57.711 _refine.ls_d_res_high 2.500 _refine.ls_percent_reflns_obs 99.86 _refine.ls_R_factor_obs 0.2095 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.2063 _refine.ls_R_factor_R_free 0.2678 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 5.2 _refine.ls_number_reflns_R_free 1034 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model 'WWPDB ENTRY 5FK2' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML 0.43 _refine.pdbx_overall_phase_error 36.84 _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 2028 _refine_hist.pdbx_number_atoms_ligand 45 _refine_hist.number_atoms_solvent 14 _refine_hist.number_atoms_total 2087 _refine_hist.d_res_high 2.500 _refine_hist.d_res_low 57.711 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function f_bond_d 0.002 ? ? 2328 'X-RAY DIFFRACTION' ? f_angle_d 0.677 ? ? 3632 'X-RAY DIFFRACTION' ? f_dihedral_angle_d 15.770 ? ? 1154 'X-RAY DIFFRACTION' ? f_chiral_restr 0.035 ? ? 480 'X-RAY DIFFRACTION' ? f_plane_restr 0.005 ? ? 97 'X-RAY DIFFRACTION' ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_R_work _refine_ls_shell.R_factor_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_all _refine_ls_shell.R_factor_all 'X-RAY DIFFRACTION' . 2.5004 2.6322 2700 0.3882 100.00 0.4223 . . 136 . . 'X-RAY DIFFRACTION' . 2.6322 2.7971 2703 0.3705 100.00 0.4442 . . 145 . . 'X-RAY DIFFRACTION' . 2.7971 3.0131 2719 0.3106 100.00 0.3894 . . 125 . . 'X-RAY DIFFRACTION' . 3.0131 3.3162 2696 0.2358 100.00 0.3272 . . 160 . . 'X-RAY DIFFRACTION' . 3.3162 3.7960 2703 0.2030 100.00 0.2919 . . 139 . . 'X-RAY DIFFRACTION' . 3.7960 4.7822 2682 0.1688 100.00 0.2317 . . 177 . . 'X-RAY DIFFRACTION' . 4.7822 57.7268 2702 0.1651 100.00 0.2039 . . 152 . . # _database_PDB_matrix.entry_id 5FK3 _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 5FK3 _struct.title 'SAM-I riboswitch bearing the H. marismortui Kt-7 variant 3bn is CC' _struct.pdbx_model_details ? _struct.pdbx_CASP_flag ? _struct.pdbx_model_type_details ? # _struct_keywords.entry_id 5FK3 _struct_keywords.pdbx_keywords RNA _struct_keywords.text 'RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 3 ? J N N 3 ? K N N 3 ? L N N 3 ? M N N 3 ? N N N 3 ? O N N 3 ? P N N 3 ? Q N N 3 ? R N N 4 ? S N N 4 ? T N N 4 ? U N N 5 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 5FK3 _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin ? _struct_ref.pdbx_db_accession 5FK3 _struct_ref.pdbx_db_isoform ? # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 5FK3 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 94 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 5FK3 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 94 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 94 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R,S,T,U # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _struct_biol.id 1 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A G 1 OP2 ? ? ? 1_555 H BA . BA ? ? A G 1 A BA 1101 1_555 ? ? ? ? ? ? ? 3.242 ? ? metalc2 metalc ? ? A G 1 "O5'" ? ? ? 1_555 H BA . BA ? ? A G 1 A BA 1101 1_555 ? ? ? ? ? ? ? 3.505 ? ? metalc3 metalc ? ? A G 1 OP1 ? ? ? 1_555 H BA . BA ? ? A G 1 A BA 1101 1_555 ? ? ? ? ? ? ? 3.345 ? ? metalc4 metalc ? ? A G 1 N7 ? ? ? 1_555 I BA . BA ? ? A G 1 A BA 1102 1_555 ? ? ? ? ? ? ? 2.737 ? ? metalc5 metalc ? ? A U 5 O4 ? ? ? 1_555 R K . K ? ? A U 5 A K 1111 1_555 ? ? ? ? ? ? ? 3.201 ? ? metalc6 metalc ? ? A G 11 O6 ? ? ? 1_555 E BA . BA ? ? A G 11 A BA 1098 1_555 ? ? ? ? ? ? ? 2.886 ? ? metalc7 metalc ? ? A G 32 N7 ? ? ? 1_555 F BA . BA ? ? A G 32 A BA 1099 1_555 ? ? ? ? ? ? ? 3.128 ? ? metalc8 metalc ? ? A G 32 O6 ? ? ? 1_555 F BA . BA ? ? A G 32 A BA 1099 1_555 ? ? ? ? ? ? ? 2.824 ? ? metalc9 metalc ? ? A G 32 O6 ? ? ? 8_665 F BA . BA ? ? A G 32 A BA 1099 1_555 ? ? ? ? ? ? ? 3.592 ? ? metalc10 metalc ? ? A G 32 N7 ? ? ? 8_665 F BA . BA ? ? A G 32 A BA 1099 1_555 ? ? ? ? ? ? ? 2.664 ? ? metalc11 metalc ? ? A A 36 OP1 ? ? ? 1_555 P BA . BA ? ? A A 36 A BA 1109 1_555 ? ? ? ? ? ? ? 3.496 ? ? metalc12 metalc ? ? A G 43 O6 ? ? ? 1_555 L BA . BA ? ? A G 43 A BA 1105 1_555 ? ? ? ? ? ? ? 3.527 ? ? metalc13 metalc ? ? A G 50 N7 ? ? ? 1_555 N BA . BA ? ? A G 50 A BA 1107 1_555 ? ? ? ? ? ? ? 2.834 ? ? metalc14 metalc ? ? A G 50 O6 ? ? ? 1_555 N BA . BA ? ? A G 50 A BA 1107 1_555 ? ? ? ? ? ? ? 2.917 ? ? metalc15 metalc ? ? A A 62 OP2 ? ? ? 1_555 T K . K ? ? A A 62 A K 1113 1_555 ? ? ? ? ? ? ? 2.815 ? ? metalc16 metalc ? ? A U 64 O2 ? ? ? 1_555 J BA . BA ? ? A U 64 A BA 1103 1_555 ? ? ? ? ? ? ? 3.254 ? ? metalc17 metalc ? ? A U 64 "O2'" ? ? ? 1_555 J BA . BA ? ? A U 64 A BA 1103 1_555 ? ? ? ? ? ? ? 2.831 ? ? metalc18 metalc ? ? A U 64 OP2 ? ? ? 1_555 T K . K ? ? A U 64 A K 1113 1_555 ? ? ? ? ? ? ? 3.274 ? ? metalc19 metalc ? ? A C 65 OP2 ? ? ? 1_555 T K . K ? ? A C 65 A K 1113 1_555 ? ? ? ? ? ? ? 3.032 ? ? metalc20 metalc ? ? A U 67 O4 ? ? ? 1_555 J BA . BA ? ? A U 67 A BA 1103 1_555 ? ? ? ? ? ? ? 3.288 ? ? metalc21 metalc ? ? A G 74 O6 ? ? ? 1_555 D BA . BA ? ? A G 74 A BA 1097 1_555 ? ? ? ? ? ? ? 2.646 ? ? metalc22 metalc ? ? A G 74 N7 ? ? ? 1_555 D BA . BA ? ? A G 74 A BA 1097 1_555 ? ? ? ? ? ? ? 2.956 ? ? metalc23 metalc ? ? A G 79 O6 ? ? ? 1_555 S K . K ? ? A G 79 A K 1112 1_555 ? ? ? ? ? ? ? 3.331 ? ? metalc24 metalc ? ? A U 80 O4 ? ? ? 1_555 S K . K ? ? A U 80 A K 1112 1_555 ? ? ? ? ? ? ? 3.356 ? ? metalc25 metalc ? ? A U 81 O4 ? ? ? 1_555 O BA . BA ? ? A U 81 A BA 1108 1_555 ? ? ? ? ? ? ? 3.288 ? ? metalc26 metalc ? ? A G 82 O6 ? ? ? 1_555 O BA . BA ? ? A G 82 A BA 1108 1_555 ? ? ? ? ? ? ? 3.179 ? ? metalc27 metalc ? ? A G 86 N7 ? ? ? 1_555 G BA . BA ? ? A G 86 A BA 1100 1_555 ? ? ? ? ? ? ? 3.048 ? ? metalc28 metalc ? ? A G 86 O6 ? ? ? 1_555 G BA . BA ? ? A G 86 A BA 1100 1_555 ? ? ? ? ? ? ? 3.043 ? ? metalc29 metalc ? ? A U 88 O4 ? ? ? 1_555 R K . K ? ? A U 88 A K 1111 1_555 ? ? ? ? ? ? ? 2.888 ? ? metalc30 metalc ? ? A G 89 O6 ? ? ? 1_555 R K . K ? ? A G 89 A K 1111 1_555 ? ? ? ? ? ? ? 2.950 ? ? metalc31 metalc ? ? B SAM . O ? ? ? 1_555 E BA . BA ? ? A SAM 1095 A BA 1098 1_555 ? ? ? ? ? ? ? 3.418 ? ? metalc32 metalc ? ? D BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1097 A HOH 2010 1_555 ? ? ? ? ? ? ? 2.620 ? ? metalc33 metalc ? ? D BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1097 A HOH 2011 1_555 ? ? ? ? ? ? ? 2.872 ? ? metalc34 metalc ? ? F BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1099 A HOH 2006 1_555 ? ? ? ? ? ? ? 2.922 ? ? metalc35 metalc ? ? F BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1099 A HOH 2006 8_665 ? ? ? ? ? ? ? 3.321 ? ? metalc36 metalc ? ? F BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1099 A HOH 2007 8_665 ? ? ? ? ? ? ? 2.630 ? ? metalc37 metalc ? ? G BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1100 A HOH 2014 1_555 ? ? ? ? ? ? ? 2.626 ? ? metalc38 metalc ? ? I BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1102 A HOH 2001 1_555 ? ? ? ? ? ? ? 3.179 ? ? metalc39 metalc ? ? J BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1103 A HOH 2005 1_555 ? ? ? ? ? ? ? 2.565 ? ? metalc40 metalc ? ? J BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1103 A HOH 2009 1_555 ? ? ? ? ? ? ? 2.616 ? ? metalc41 metalc ? ? K BA . BA ? ? ? 1_555 M BA . BA ? ? A BA 1104 A BA 1106 1_555 ? ? ? ? ? ? ? 3.168 ? ? metalc42 metalc ? ? P BA . BA ? ? ? 1_555 U HOH . O ? ? A BA 1109 A HOH 2004 1_555 ? ? ? ? ? ? ? 2.868 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 93 N3 ? ? A G 1 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 93 O2 ? ? A G 1 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 93 N4 ? ? A G 1 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 92 N3 ? ? A G 2 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 92 O2 ? ? A G 2 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 92 N4 ? ? A G 2 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 91 N1 ? ? A C 3 A G 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 91 O6 ? ? A C 3 A G 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 91 N2 ? ? A C 3 A G 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 90 N1 ? ? A U 4 A A 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 90 N6 ? ? A U 4 A A 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 89 O6 ? ? A U 5 A G 89 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 89 N1 ? ? A U 5 A G 89 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 88 N3 ? ? A A 6 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 88 O4 ? ? A A 6 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 87 N1 ? ? A U 7 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 87 N6 ? ? A U 7 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 86 N1 ? ? A C 8 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 86 O6 ? ? A C 8 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 86 N2 ? ? A C 8 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 44 O2 ? ? A G 11 A C 44 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog22 hydrog ? ? A A 12 N3 ? ? ? 1_555 A G 43 N2 ? ? A A 12 A G 43 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog23 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 13 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 13 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 13 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 15 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 15 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 15 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 39 N3 ? ? A G 16 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 39 O2 ? ? A G 16 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 16 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 17 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 17 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 17 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 18 N3 ? ? ? 1_555 A C 37 N4 ? ? A C 18 A C 37 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog36 hydrog ? ? A G 19 N2 ? ? ? 1_555 A A 36 N7 ? ? A G 19 A A 36 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog37 hydrog ? ? A A 20 N6 ? ? ? 1_555 A G 35 N3 ? ? A A 20 A G 35 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog38 hydrog ? ? A A 20 N7 ? ? ? 1_555 A G 35 N2 ? ? A A 20 A G 35 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog39 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 21 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 21 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 21 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 21 N2 ? ? ? 1_555 A A 36 N3 ? ? A G 21 A A 36 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog43 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 30 N1 ? ? A C 22 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 30 O6 ? ? A C 22 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 30 N2 ? ? A C 22 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 23 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 23 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 23 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 23 N2 ? ? ? 1_555 A A 62 N1 ? ? A G 23 A A 62 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog50 hydrog ? ? A A 24 N6 ? ? ? 1_555 A A 85 N3 ? ? A A 24 A A 85 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog51 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 68 N1 ? ? A C 25 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 68 O6 ? ? A C 25 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 68 N2 ? ? A C 25 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A U 26 N3 ? ? ? 1_555 A U 67 O2 ? ? A U 26 A U 67 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog55 hydrog ? ? A U 26 O4 ? ? ? 1_555 A U 67 N3 ? ? A U 26 A U 67 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog56 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 66 N3 ? ? A G 27 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 66 O2 ? ? A G 27 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 66 N4 ? ? A G 27 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 65 N3 ? ? A G 28 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 65 O2 ? ? A G 28 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 65 N4 ? ? A G 28 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 30 N3 ? ? ? 1_555 A A 61 N6 ? ? A G 30 A A 61 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog63 hydrog ? ? A G 42 N1 ? ? ? 1_555 A C 60 N3 ? ? A G 42 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 42 N2 ? ? ? 1_555 A C 60 O2 ? ? A G 42 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 60 N4 ? ? A G 42 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 43 N1 ? ? ? 1_555 A C 59 N3 ? ? A G 43 A C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 43 N2 ? ? ? 1_555 A C 59 O2 ? ? A G 43 A C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 43 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 43 A C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 58 N1 ? ? A C 44 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 58 O6 ? ? A C 44 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 58 N2 ? ? A C 44 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 47 N3 ? ? ? 1_555 A G 56 N1 ? ? A C 47 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 47 N4 ? ? ? 1_555 A G 56 O6 ? ? A C 47 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 47 O2 ? ? ? 1_555 A G 56 N2 ? ? A C 47 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 48 N3 ? ? ? 1_555 A G 55 N1 ? ? A C 48 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A C 48 N4 ? ? ? 1_555 A G 55 O6 ? ? A C 48 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A C 48 O2 ? ? ? 1_555 A G 55 N2 ? ? A C 48 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A A 49 N1 ? ? ? 1_555 A U 54 N3 ? ? A A 49 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A A 49 N6 ? ? ? 1_555 A U 54 O4 ? ? A A 49 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 50 N2 ? ? ? 1_555 A A 53 N7 ? ? A G 50 A A 53 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog81 hydrog ? ? A U 64 N3 ? ? ? 1_555 A A 85 N1 ? ? A U 64 A A 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A U 64 O4 ? ? ? 1_555 A A 85 N6 ? ? A U 64 A A 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 69 N3 ? ? ? 1_555 A G 82 N1 ? ? A C 69 A G 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 69 N4 ? ? ? 1_555 A G 82 O6 ? ? A C 69 A G 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A C 69 O2 ? ? ? 1_555 A G 82 N2 ? ? A C 69 A G 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A A 70 N1 ? ? ? 1_555 A U 81 N3 ? ? A A 70 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A A 70 N6 ? ? ? 1_555 A U 81 O4 ? ? A A 70 A U 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 71 N1 ? ? ? 1_555 A U 80 O2 ? ? A G 71 A U 80 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog89 hydrog ? ? A G 71 O6 ? ? ? 1_555 A U 80 N3 ? ? A G 71 A U 80 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog90 hydrog ? ? A C 72 N3 ? ? ? 1_555 A G 79 N1 ? ? A C 72 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 72 N4 ? ? ? 1_555 A G 79 O6 ? ? A C 72 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A C 72 O2 ? ? ? 1_555 A G 79 N2 ? ? A C 72 A G 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 73 N1 ? ? ? 1_555 A C 78 N3 ? ? A G 73 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 73 N2 ? ? ? 1_555 A C 78 O2 ? ? A G 73 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A G 73 O6 ? ? ? 1_555 A C 78 N4 ? ? A G 73 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A G 74 N2 ? ? ? 1_555 A A 77 N7 ? ? A G 74 A A 77 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP2 ? A G 1 ? A G 1 ? 1_555 BA ? H BA . ? A BA 1101 ? 1_555 "O5'" ? A G 1 ? A G 1 ? 1_555 42.9 ? 2 OP2 ? A G 1 ? A G 1 ? 1_555 BA ? H BA . ? A BA 1101 ? 1_555 OP1 ? A G 1 ? A G 1 ? 1_555 45.6 ? 3 "O5'" ? A G 1 ? A G 1 ? 1_555 BA ? H BA . ? A BA 1101 ? 1_555 OP1 ? A G 1 ? A G 1 ? 1_555 42.2 ? 4 N7 ? A G 1 ? A G 1 ? 1_555 BA ? I BA . ? A BA 1102 ? 1_555 O ? U HOH . ? A HOH 2001 ? 1_555 104.6 ? 5 O4 ? A U 5 ? A U 5 ? 1_555 K ? R K . ? A K 1111 ? 1_555 O4 ? A U 88 ? A U 88 ? 1_555 101.5 ? 6 O4 ? A U 5 ? A U 5 ? 1_555 K ? R K . ? A K 1111 ? 1_555 O6 ? A G 89 ? A G 89 ? 1_555 65.7 ? 7 O4 ? A U 88 ? A U 88 ? 1_555 K ? R K . ? A K 1111 ? 1_555 O6 ? A G 89 ? A G 89 ? 1_555 78.0 ? 8 O6 ? A G 11 ? A G 11 ? 1_555 BA ? E BA . ? A BA 1098 ? 1_555 O ? B SAM . ? A SAM 1095 ? 1_555 73.6 ? 9 N7 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O6 ? A G 32 ? A G 32 ? 1_555 62.5 ? 10 N7 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O6 ? A G 32 ? A G 32 ? 8_665 55.9 ? 11 O6 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O6 ? A G 32 ? A G 32 ? 8_665 90.6 ? 12 N7 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 N7 ? A G 32 ? A G 32 ? 8_665 93.7 ? 13 O6 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 N7 ? A G 32 ? A G 32 ? 8_665 70.7 ? 14 O6 ? A G 32 ? A G 32 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 N7 ? A G 32 ? A G 32 ? 8_665 57.0 ? 15 N7 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 1_555 97.9 ? 16 O6 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 1_555 104.2 ? 17 O6 ? A G 32 ? A G 32 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 1_555 139.6 ? 18 N7 ? A G 32 ? A G 32 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 1_555 163.3 ? 19 N7 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 8_665 117.9 ? 20 O6 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 8_665 169.4 ? 21 O6 ? A G 32 ? A G 32 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 8_665 81.9 ? 22 N7 ? A G 32 ? A G 32 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 8_665 98.8 ? 23 O ? U HOH . ? A HOH 2006 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2006 ? 8_665 86.3 ? 24 N7 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2007 ? 8_665 160.0 ? 25 O6 ? A G 32 ? A G 32 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2007 ? 8_665 101.3 ? 26 O6 ? A G 32 ? A G 32 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2007 ? 8_665 140.5 ? 27 N7 ? A G 32 ? A G 32 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2007 ? 8_665 91.4 ? 28 O ? U HOH . ? A HOH 2006 ? 1_555 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2007 ? 8_665 73.7 ? 29 O ? U HOH . ? A HOH 2006 ? 8_665 BA ? F BA . ? A BA 1099 ? 1_555 O ? U HOH . ? A HOH 2007 ? 8_665 80.3 ? 30 OP1 ? A A 36 ? A A 36 ? 1_555 BA ? P BA . ? A BA 1109 ? 1_555 O ? U HOH . ? A HOH 2004 ? 1_555 113.5 ? 31 N7 ? A G 50 ? A G 50 ? 1_555 BA ? N BA . ? A BA 1107 ? 1_555 O6 ? A G 50 ? A G 50 ? 1_555 65.6 ? 32 OP2 ? A A 62 ? A A 62 ? 1_555 K ? T K . ? A K 1113 ? 1_555 OP2 ? A U 64 ? A U 64 ? 1_555 92.7 ? 33 OP2 ? A A 62 ? A A 62 ? 1_555 K ? T K . ? A K 1113 ? 1_555 OP2 ? A C 65 ? A C 65 ? 1_555 124.1 ? 34 OP2 ? A U 64 ? A U 64 ? 1_555 K ? T K . ? A K 1113 ? 1_555 OP2 ? A C 65 ? A C 65 ? 1_555 98.3 ? 35 O2 ? A U 64 ? A U 64 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 "O2'" ? A U 64 ? A U 64 ? 1_555 70.1 ? 36 O2 ? A U 64 ? A U 64 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O4 ? A U 67 ? A U 67 ? 1_555 145.5 ? 37 "O2'" ? A U 64 ? A U 64 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O4 ? A U 67 ? A U 67 ? 1_555 123.0 ? 38 O2 ? A U 64 ? A U 64 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O ? U HOH . ? A HOH 2005 ? 1_555 79.3 ? 39 "O2'" ? A U 64 ? A U 64 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O ? U HOH . ? A HOH 2005 ? 1_555 81.8 ? 40 O4 ? A U 67 ? A U 67 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O ? U HOH . ? A HOH 2005 ? 1_555 131.2 ? 41 O2 ? A U 64 ? A U 64 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O ? U HOH . ? A HOH 2009 ? 1_555 89.2 ? 42 "O2'" ? A U 64 ? A U 64 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O ? U HOH . ? A HOH 2009 ? 1_555 57.4 ? 43 O4 ? A U 67 ? A U 67 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O ? U HOH . ? A HOH 2009 ? 1_555 76.4 ? 44 O ? U HOH . ? A HOH 2005 ? 1_555 BA ? J BA . ? A BA 1103 ? 1_555 O ? U HOH . ? A HOH 2009 ? 1_555 139.1 ? 45 O6 ? A G 74 ? A G 74 ? 1_555 BA ? D BA . ? A BA 1097 ? 1_555 N7 ? A G 74 ? A G 74 ? 1_555 67.9 ? 46 O6 ? A G 74 ? A G 74 ? 1_555 BA ? D BA . ? A BA 1097 ? 1_555 O ? U HOH . ? A HOH 2010 ? 1_555 117.1 ? 47 N7 ? A G 74 ? A G 74 ? 1_555 BA ? D BA . ? A BA 1097 ? 1_555 O ? U HOH . ? A HOH 2010 ? 1_555 54.7 ? 48 O6 ? A G 74 ? A G 74 ? 1_555 BA ? D BA . ? A BA 1097 ? 1_555 O ? U HOH . ? A HOH 2011 ? 1_555 58.2 ? 49 N7 ? A G 74 ? A G 74 ? 1_555 BA ? D BA . ? A BA 1097 ? 1_555 O ? U HOH . ? A HOH 2011 ? 1_555 123.7 ? 50 O ? U HOH . ? A HOH 2010 ? 1_555 BA ? D BA . ? A BA 1097 ? 1_555 O ? U HOH . ? A HOH 2011 ? 1_555 171.6 ? 51 O6 ? A G 79 ? A G 79 ? 1_555 K ? S K . ? A K 1112 ? 1_555 O4 ? A U 80 ? A U 80 ? 1_555 58.1 ? 52 O4 ? A U 81 ? A U 81 ? 1_555 BA ? O BA . ? A BA 1108 ? 1_555 O6 ? A G 82 ? A G 82 ? 1_555 63.5 ? 53 N7 ? A G 86 ? A G 86 ? 1_555 BA ? G BA . ? A BA 1100 ? 1_555 O6 ? A G 86 ? A G 86 ? 1_555 59.9 ? 54 N7 ? A G 86 ? A G 86 ? 1_555 BA ? G BA . ? A BA 1100 ? 1_555 O ? U HOH . ? A HOH 2014 ? 1_555 74.7 ? 55 O6 ? A G 86 ? A G 86 ? 1_555 BA ? G BA . ? A BA 1100 ? 1_555 O ? U HOH . ? A HOH 2014 ? 1_555 64.5 ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A SAM 1095 ? 13 'BINDING SITE FOR RESIDUE SAM A 1095' AC2 Software A BA 1096 ? 2 'BINDING SITE FOR RESIDUE BA A 1096' AC3 Software A BA 1097 ? 3 'BINDING SITE FOR RESIDUE BA A 1097' AC4 Software A BA 1098 ? 2 'BINDING SITE FOR RESIDUE BA A 1098' AC5 Software A BA 1099 ? 4 'BINDING SITE FOR RESIDUE BA A 1099' AC6 Software A BA 1100 ? 2 'BINDING SITE FOR RESIDUE BA A 1100' AC7 Software A BA 1101 ? 1 'BINDING SITE FOR RESIDUE BA A 1101' AC8 Software A BA 1102 ? 1 'BINDING SITE FOR RESIDUE BA A 1102' AC9 Software A BA 1103 ? 4 'BINDING SITE FOR RESIDUE BA A 1103' BC1 Software A BA 1104 ? 2 'BINDING SITE FOR RESIDUE BA A 1104' BC2 Software A BA 1105 ? 1 'BINDING SITE FOR RESIDUE BA A 1105' BC3 Software A BA 1106 ? 3 'BINDING SITE FOR RESIDUE BA A 1106' BC4 Software A BA 1107 ? 1 'BINDING SITE FOR RESIDUE BA A 1107' BC5 Software A BA 1108 ? 2 'BINDING SITE FOR RESIDUE BA A 1108' BC6 Software A BA 1109 ? 2 'BINDING SITE FOR RESIDUE BA A 1109' BC7 Software A K 1111 ? 4 'BINDING SITE FOR RESIDUE K A 1111' BC8 Software A K 1112 ? 4 'BINDING SITE FOR RESIDUE K A 1112' BC9 Software A K 1113 ? 3 'BINDING SITE FOR RESIDUE K A 1113' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 13 A A 6 ? A A 6 . ? 1_555 ? 2 AC1 13 U A 7 ? U A 7 . ? 1_555 ? 3 AC1 13 C A 8 ? C A 8 . ? 1_555 ? 4 AC1 13 G A 11 ? G A 11 . ? 1_555 ? 5 AC1 13 A A 45 ? A A 45 . ? 1_555 ? 6 AC1 13 A A 46 ? A A 46 . ? 1_555 ? 7 AC1 13 C A 47 ? C A 47 . ? 1_555 ? 8 AC1 13 U A 57 ? U A 57 . ? 1_555 ? 9 AC1 13 G A 58 ? G A 58 . ? 1_555 ? 10 AC1 13 C A 59 ? C A 59 . ? 1_555 ? 11 AC1 13 U A 88 ? U A 88 . ? 1_555 ? 12 AC1 13 G A 89 ? G A 89 . ? 1_555 ? 13 AC1 13 BA E . ? BA A 1098 . ? 1_555 ? 14 AC2 2 C A 25 ? C A 25 . ? 1_555 ? 15 AC2 2 C A 65 ? C A 65 . ? 1_555 ? 16 AC3 3 G A 74 ? G A 74 . ? 1_555 ? 17 AC3 3 HOH U . ? HOH A 2010 . ? 1_555 ? 18 AC3 3 HOH U . ? HOH A 2011 . ? 1_555 ? 19 AC4 2 G A 11 ? G A 11 . ? 1_555 ? 20 AC4 2 SAM B . ? SAM A 1095 . ? 1_555 ? 21 AC5 4 G A 32 ? G A 32 . ? 1_555 ? 22 AC5 4 G A 32 ? G A 32 . ? 8_665 ? 23 AC5 4 HOH U . ? HOH A 2006 . ? 1_555 ? 24 AC5 4 HOH U . ? HOH A 2007 . ? 8_665 ? 25 AC6 2 G A 86 ? G A 86 . ? 1_555 ? 26 AC6 2 HOH U . ? HOH A 2014 . ? 1_555 ? 27 AC7 1 G A 1 ? G A 1 . ? 1_555 ? 28 AC8 1 G A 1 ? G A 1 . ? 1_555 ? 29 AC9 4 U A 64 ? U A 64 . ? 1_555 ? 30 AC9 4 U A 67 ? U A 67 . ? 1_555 ? 31 AC9 4 HOH U . ? HOH A 2005 . ? 1_555 ? 32 AC9 4 HOH U . ? HOH A 2009 . ? 1_555 ? 33 BC1 2 A A 45 ? A A 45 . ? 1_555 ? 34 BC1 2 BA M . ? BA A 1106 . ? 1_555 ? 35 BC2 1 G A 43 ? G A 43 . ? 1_555 ? 36 BC3 3 A A 46 ? A A 46 . ? 1_555 ? 37 BC3 3 G A 55 ? G A 55 . ? 1_555 ? 38 BC3 3 BA K . ? BA A 1104 . ? 1_555 ? 39 BC4 1 G A 50 ? G A 50 . ? 1_555 ? 40 BC5 2 U A 81 ? U A 81 . ? 1_555 ? 41 BC5 2 G A 82 ? G A 82 . ? 1_555 ? 42 BC6 2 A A 36 ? A A 36 . ? 1_555 ? 43 BC6 2 HOH U . ? HOH A 2004 . ? 1_555 ? 44 BC7 4 U A 4 ? U A 4 . ? 1_555 ? 45 BC7 4 U A 5 ? U A 5 . ? 1_555 ? 46 BC7 4 U A 88 ? U A 88 . ? 1_555 ? 47 BC7 4 G A 89 ? G A 89 . ? 1_555 ? 48 BC8 4 A A 70 ? A A 70 . ? 1_555 ? 49 BC8 4 G A 71 ? G A 71 . ? 1_555 ? 50 BC8 4 G A 79 ? G A 79 . ? 1_555 ? 51 BC8 4 U A 80 ? U A 80 . ? 1_555 ? 52 BC9 3 A A 62 ? A A 62 . ? 1_555 ? 53 BC9 3 U A 64 ? U A 64 . ? 1_555 ? 54 BC9 3 C A 65 ? C A 65 . ? 1_555 ? # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 1 _pdbx_validate_rmsd_bond.auth_atom_id_1 P _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 G _pdbx_validate_rmsd_bond.auth_seq_id_1 1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 OP3 _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 G _pdbx_validate_rmsd_bond.auth_seq_id_2 1 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.480 _pdbx_validate_rmsd_bond.bond_target_value 1.607 _pdbx_validate_rmsd_bond.bond_deviation -0.127 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.012 _pdbx_validate_rmsd_bond.linker_flag N # loop_ _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][3] 'X-RAY DIFFRACTION' 1 ? refined -0.5485 48.8437 1.0540 1.0055 0.7928 1.0673 0.3805 -0.1110 -0.1231 5.0307 0.9187 6.3698 -2.5523 -4.2188 2.2758 -1.3807 0.2844 0.7090 2.9244 1.1651 -2.0825 -0.6968 -3.0685 0.3003 'X-RAY DIFFRACTION' 2 ? refined 14.0410 48.0307 3.7532 0.5277 1.0290 0.6744 0.2391 -0.0772 0.0568 0.1426 3.0128 5.7716 0.1654 -0.8778 1.1705 1.0755 -0.7879 -0.8129 0.3799 -1.1397 -0.5447 1.5267 -0.5713 0.7172 'X-RAY DIFFRACTION' 3 ? refined 22.6069 53.4434 15.8872 0.8248 0.8977 0.5788 0.1361 -0.2682 0.0220 5.1520 3.6716 8.4041 2.5835 -3.1513 -1.2848 0.2965 1.4842 -0.1791 -1.2211 0.6856 0.0989 -0.8899 0.6173 -0.4977 'X-RAY DIFFRACTION' 4 ? refined 17.8977 71.0652 27.3425 1.5698 1.0267 0.8964 0.0519 -0.1731 -0.0664 1.4256 4.7358 5.5338 0.2587 -0.2072 4.9015 0.3224 1.1192 1.1815 0.6617 -0.2463 -1.0350 0.4239 2.6879 0.0855 'X-RAY DIFFRACTION' 5 ? refined 1.9862 70.6693 30.8730 1.8521 1.1445 0.5023 0.4572 0.0568 0.0205 5.8153 6.4369 4.7016 -4.6763 -2.9581 0.0777 -0.8711 0.1973 1.1691 0.5695 1.1460 -0.7346 -3.2515 -2.5188 -0.8303 'X-RAY DIFFRACTION' 6 ? refined 1.8451 54.2833 26.4440 0.8880 0.6641 0.4867 -0.1842 -0.0460 0.0151 6.6795 3.7422 3.9468 -2.8853 2.7592 1.1969 -1.1524 -1.5215 -0.1517 0.1290 0.8602 0.3186 0.8228 -0.4812 0.4439 'X-RAY DIFFRACTION' 7 ? refined 2.2540 42.8524 27.0909 0.8383 1.0602 0.5634 -0.3054 -0.0490 0.0308 8.7602 9.1464 7.2316 -1.2779 -1.5988 -0.6384 -0.5467 -0.1583 0.8095 0.6555 0.9391 -0.0181 0.7637 -0.8921 -0.2246 'X-RAY DIFFRACTION' 8 ? refined 7.6100 54.9539 35.0197 0.8135 0.7835 0.3789 -0.1353 -0.0193 -0.0254 5.4892 6.6604 7.7180 -0.8142 2.4445 3.0643 0.0984 0.3898 -0.2951 0.7722 -0.1361 -0.0472 0.1064 -0.0250 -0.0683 'X-RAY DIFFRACTION' 9 ? refined 6.4161 65.7423 29.9139 1.1899 0.6571 0.5225 -0.1392 0.0285 0.0356 7.1126 0.2319 5.0642 0.5410 4.7812 0.4787 -0.2680 0.2942 0.3736 -0.0113 -0.3666 -0.4316 -1.6776 1.8083 0.5555 'X-RAY DIFFRACTION' 10 ? refined 17.4094 69.3991 15.8772 1.3083 0.8376 0.5997 -0.2572 -0.0601 0.0490 5.1672 4.7291 3.4977 -3.4091 -0.0841 3.2597 0.7913 1.2553 0.4967 -0.6723 -1.0280 -0.0353 -1.9891 0.1743 0.0460 'X-RAY DIFFRACTION' 11 ? refined 17.2650 62.1047 0.4369 1.1133 1.1697 0.4501 -0.1157 -0.0735 0.2182 7.0696 3.2565 4.7513 1.8614 3.3379 -1.1163 -0.8943 0.8845 0.1628 -0.1340 0.4912 -0.3067 -1.9227 2.1408 0.5611 'X-RAY DIFFRACTION' 12 ? refined 19.0044 71.3884 -1.2877 1.7929 2.2131 0.7111 -0.4027 0.1929 0.2758 4.7414 6.5878 7.6833 1.4458 -5.9376 -2.0911 -0.4890 0.3535 0.4109 -0.5651 0.2179 -0.8960 -2.5350 4.1673 -0.0997 'X-RAY DIFFRACTION' 13 ? refined 12.1431 62.4334 12.3984 1.0539 0.8214 0.4213 0.0090 0.0897 0.0259 9.5147 9.5060 6.6716 -2.5710 7.9958 -1.9330 0.0199 -0.5552 0.4740 0.6450 0.0793 0.0015 -1.9093 -0.4703 -0.2096 'X-RAY DIFFRACTION' 14 ? refined 15.3008 51.0654 22.6404 0.7729 0.5772 0.7752 -0.0392 -0.1507 0.0566 1.8049 5.3360 8.2888 -0.0511 -0.5020 -2.7157 0.2921 0.6991 -0.5412 1.1481 0.0080 -0.7955 -1.6474 0.3187 0.1471 'X-RAY DIFFRACTION' 15 ? refined 9.0417 40.1297 21.6825 0.7950 0.7551 0.5451 -0.2206 -0.1826 -0.0603 7.5049 4.0469 7.2652 1.5762 0.9105 2.2391 -0.1414 0.1844 0.3524 0.2056 0.3611 0.3399 1.2638 -1.5836 -0.0677 'X-RAY DIFFRACTION' 16 ? refined 14.5056 25.6244 15.3195 1.6999 0.8030 0.7852 -0.1206 -0.2284 -0.1372 3.5640 2.0684 6.1175 1.9031 3.0707 -0.1518 0.0028 -0.5595 0.2956 0.2418 -0.6922 0.9684 1.9534 -0.1283 0.6348 'X-RAY DIFFRACTION' 17 ? refined 17.6910 26.0996 25.4106 1.3385 0.7041 0.7033 -0.2181 -0.2598 0.1076 0.6716 2.9275 2.0057 0.2895 -0.0351 -2.2307 0.8347 -0.2932 -0.5179 -0.8395 -0.7399 -0.2464 0.8916 0.5519 -0.1713 'X-RAY DIFFRACTION' 18 ? refined 12.4625 36.3384 11.2646 0.9196 0.6836 0.7215 -0.1208 -0.0916 0.0552 4.8083 0.8646 1.9912 0.7136 0.7331 1.0019 -0.5288 -0.6350 0.2328 -0.0233 0.1962 0.3654 0.9032 -0.3875 0.2424 'X-RAY DIFFRACTION' 19 ? refined 6.8632 51.6384 7.7434 0.4987 0.7046 0.5380 0.0842 -0.0956 0.0305 5.1276 6.9041 7.2939 4.0846 -0.7996 -1.8593 -0.0838 0.3633 -0.2625 -0.5478 0.3597 0.3716 0.1817 0.1697 -0.2606 'X-RAY DIFFRACTION' 20 ? refined -0.9895 54.0661 -6.1211 0.6482 1.3306 0.6934 0.2531 -0.0384 -0.2110 8.3988 9.8490 8.8250 3.1952 7.6729 -0.6755 -0.1532 1.5009 -0.5510 1.4813 0.5582 1.1390 -1.3573 -0.0034 0.1106 # loop_ _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 'X-RAY DIFFRACTION' 1 1 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 1:4)' 'X-RAY DIFFRACTION' 2 2 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 5:8)' 'X-RAY DIFFRACTION' 3 3 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 9:12)' 'X-RAY DIFFRACTION' 4 4 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 13:16)' 'X-RAY DIFFRACTION' 5 5 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 17:20)' 'X-RAY DIFFRACTION' 6 6 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 21:24)' 'X-RAY DIFFRACTION' 7 7 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 25:28)' 'X-RAY DIFFRACTION' 8 8 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 29:33)' 'X-RAY DIFFRACTION' 9 9 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 34:39)' 'X-RAY DIFFRACTION' 10 10 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 40:45)' 'X-RAY DIFFRACTION' 11 11 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 46:49)' 'X-RAY DIFFRACTION' 12 12 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 50:56)' 'X-RAY DIFFRACTION' 13 13 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 57:60)' 'X-RAY DIFFRACTION' 14 14 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 61:64)' 'X-RAY DIFFRACTION' 15 15 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 65:69)' 'X-RAY DIFFRACTION' 16 16 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 70:73)' 'X-RAY DIFFRACTION' 17 17 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 74:80)' 'X-RAY DIFFRACTION' 18 18 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 81:84)' 'X-RAY DIFFRACTION' 19 19 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 85:90)' 'X-RAY DIFFRACTION' 20 20 ? ? ? ? ? ? ? ? ? '(CHAIN A AND RESID 91:94)' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 BA BA BA N N 38 C OP3 O N N 39 C P P N N 40 C OP1 O N N 41 C OP2 O N N 42 C "O5'" O N N 43 C "C5'" C N N 44 C "C4'" C N R 45 C "O4'" O N N 46 C "C3'" C N S 47 C "O3'" O N N 48 C "C2'" C N R 49 C "O2'" O N N 50 C "C1'" C N R 51 C N1 N N N 52 C C2 C N N 53 C O2 O N N 54 C N3 N N N 55 C C4 C N N 56 C N4 N N N 57 C C5 C N N 58 C C6 C N N 59 C HOP3 H N N 60 C HOP2 H N N 61 C "H5'" H N N 62 C "H5''" H N N 63 C "H4'" H N N 64 C "H3'" H N N 65 C "HO3'" H N N 66 C "H2'" H N N 67 C "HO2'" H N N 68 C "H1'" H N N 69 C H41 H N N 70 C H42 H N N 71 C H5 H N N 72 C H6 H N N 73 G OP3 O N N 74 G P P N N 75 G OP1 O N N 76 G OP2 O N N 77 G "O5'" O N N 78 G "C5'" C N N 79 G "C4'" C N R 80 G "O4'" O N N 81 G "C3'" C N S 82 G "O3'" O N N 83 G "C2'" C N R 84 G "O2'" O N N 85 G "C1'" C N R 86 G N9 N Y N 87 G C8 C Y N 88 G N7 N Y N 89 G C5 C Y N 90 G C6 C N N 91 G O6 O N N 92 G N1 N N N 93 G C2 C N N 94 G N2 N N N 95 G N3 N N N 96 G C4 C Y N 97 G HOP3 H N N 98 G HOP2 H N N 99 G "H5'" H N N 100 G "H5''" H N N 101 G "H4'" H N N 102 G "H3'" H N N 103 G "HO3'" H N N 104 G "H2'" H N N 105 G "HO2'" H N N 106 G "H1'" H N N 107 G H8 H N N 108 G H1 H N N 109 G H21 H N N 110 G H22 H N N 111 HOH O O N N 112 HOH H1 H N N 113 HOH H2 H N N 114 K K K N N 115 SAM N N N N 116 SAM CA C N S 117 SAM C C N N 118 SAM O O N N 119 SAM OXT O N N 120 SAM CB C N N 121 SAM CG C N N 122 SAM SD S N S 123 SAM CE C N N 124 SAM "C5'" C N N 125 SAM "C4'" C N S 126 SAM "O4'" O N N 127 SAM "C3'" C N S 128 SAM "O3'" O N N 129 SAM "C2'" C N R 130 SAM "O2'" O N N 131 SAM "C1'" C N R 132 SAM N9 N Y N 133 SAM C8 C Y N 134 SAM N7 N Y N 135 SAM C5 C Y N 136 SAM C6 C Y N 137 SAM N6 N N N 138 SAM N1 N Y N 139 SAM C2 C Y N 140 SAM N3 N Y N 141 SAM C4 C Y N 142 SAM HN1 H N N 143 SAM HN2 H N N 144 SAM HA H N N 145 SAM HB1 H N N 146 SAM HB2 H N N 147 SAM HG1 H N N 148 SAM HG2 H N N 149 SAM HE1 H N N 150 SAM HE2 H N N 151 SAM HE3 H N N 152 SAM "H5'1" H N N 153 SAM "H5'2" H N N 154 SAM "H4'" H N N 155 SAM "H3'" H N N 156 SAM "HO3'" H N N 157 SAM "H2'" H N N 158 SAM "HO2'" H N N 159 SAM "H1'" H N N 160 SAM H8 H N N 161 SAM HN61 H N N 162 SAM HN62 H N N 163 SAM H2 H N N 164 U OP3 O N N 165 U P P N N 166 U OP1 O N N 167 U OP2 O N N 168 U "O5'" O N N 169 U "C5'" C N N 170 U "C4'" C N R 171 U "O4'" O N N 172 U "C3'" C N S 173 U "O3'" O N N 174 U "C2'" C N R 175 U "O2'" O N N 176 U "C1'" C N R 177 U N1 N N N 178 U C2 C N N 179 U O2 O N N 180 U N3 N N N 181 U C4 C N N 182 U O4 O N N 183 U C5 C N N 184 U C6 C N N 185 U HOP3 H N N 186 U HOP2 H N N 187 U "H5'" H N N 188 U "H5''" H N N 189 U "H4'" H N N 190 U "H3'" H N N 191 U "HO3'" H N N 192 U "H2'" H N N 193 U "HO2'" H N N 194 U "H1'" H N N 195 U H3 H N N 196 U H5 H N N 197 U H6 H N N 198 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 SAM N CA sing N N 118 SAM N HN1 sing N N 119 SAM N HN2 sing N N 120 SAM CA C sing N N 121 SAM CA CB sing N N 122 SAM CA HA sing N N 123 SAM C O doub N N 124 SAM C OXT sing N N 125 SAM CB CG sing N N 126 SAM CB HB1 sing N N 127 SAM CB HB2 sing N N 128 SAM CG SD sing N N 129 SAM CG HG1 sing N N 130 SAM CG HG2 sing N N 131 SAM SD CE sing N N 132 SAM SD "C5'" sing N N 133 SAM CE HE1 sing N N 134 SAM CE HE2 sing N N 135 SAM CE HE3 sing N N 136 SAM "C5'" "C4'" sing N N 137 SAM "C5'" "H5'1" sing N N 138 SAM "C5'" "H5'2" sing N N 139 SAM "C4'" "O4'" sing N N 140 SAM "C4'" "C3'" sing N N 141 SAM "C4'" "H4'" sing N N 142 SAM "O4'" "C1'" sing N N 143 SAM "C3'" "O3'" sing N N 144 SAM "C3'" "C2'" sing N N 145 SAM "C3'" "H3'" sing N N 146 SAM "O3'" "HO3'" sing N N 147 SAM "C2'" "O2'" sing N N 148 SAM "C2'" "C1'" sing N N 149 SAM "C2'" "H2'" sing N N 150 SAM "O2'" "HO2'" sing N N 151 SAM "C1'" N9 sing N N 152 SAM "C1'" "H1'" sing N N 153 SAM N9 C8 sing Y N 154 SAM N9 C4 sing Y N 155 SAM C8 N7 doub Y N 156 SAM C8 H8 sing N N 157 SAM N7 C5 sing Y N 158 SAM C5 C6 sing Y N 159 SAM C5 C4 doub Y N 160 SAM C6 N6 sing N N 161 SAM C6 N1 doub Y N 162 SAM N6 HN61 sing N N 163 SAM N6 HN62 sing N N 164 SAM N1 C2 sing Y N 165 SAM C2 N3 doub Y N 166 SAM C2 H2 sing N N 167 SAM N3 C4 sing Y N 168 U OP3 P sing N N 169 U OP3 HOP3 sing N N 170 U P OP1 doub N N 171 U P OP2 sing N N 172 U P "O5'" sing N N 173 U OP2 HOP2 sing N N 174 U "O5'" "C5'" sing N N 175 U "C5'" "C4'" sing N N 176 U "C5'" "H5'" sing N N 177 U "C5'" "H5''" sing N N 178 U "C4'" "O4'" sing N N 179 U "C4'" "C3'" sing N N 180 U "C4'" "H4'" sing N N 181 U "O4'" "C1'" sing N N 182 U "C3'" "O3'" sing N N 183 U "C3'" "C2'" sing N N 184 U "C3'" "H3'" sing N N 185 U "O3'" "HO3'" sing N N 186 U "C2'" "O2'" sing N N 187 U "C2'" "C1'" sing N N 188 U "C2'" "H2'" sing N N 189 U "O2'" "HO2'" sing N N 190 U "C1'" N1 sing N N 191 U "C1'" "H1'" sing N N 192 U N1 C2 sing N N 193 U N1 C6 sing N N 194 U C2 O2 doub N N 195 U C2 N3 sing N N 196 U N3 C4 sing N N 197 U N3 H3 sing N N 198 U C4 O4 doub N N 199 U C4 C5 sing N N 200 U C5 C6 doub N N 201 U C5 H5 sing N N 202 U C6 H6 sing N N 203 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5FK3 'double helix' 5FK3 'a-form double helix' 5FK3 tetraloop 5FK3 'mismatched base pair' 5FK3 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 93 1_555 -0.110 -0.177 0.589 4.038 -5.954 -2.494 1 A_G1:C93_A A 1 ? A 93 ? 19 1 1 A G 2 1_555 A C 92 1_555 -0.214 -0.113 0.387 1.479 -8.423 -0.017 2 A_G2:C92_A A 2 ? A 92 ? 19 1 1 A C 3 1_555 A G 91 1_555 0.119 -0.119 0.431 -2.597 -3.277 1.073 3 A_C3:G91_A A 3 ? A 91 ? 19 1 1 A U 4 1_555 A A 90 1_555 -0.062 -0.103 0.501 -3.749 -0.889 2.795 4 A_U4:A90_A A 4 ? A 90 ? 20 1 1 A U 5 1_555 A G 89 1_555 1.545 -0.428 0.563 -0.130 0.392 2.428 5 A_U5:G89_A A 5 ? A 89 ? 28 1 1 A A 6 1_555 A U 88 1_555 -0.063 -0.160 0.042 -0.763 -3.023 3.877 6 A_A6:U88_A A 6 ? A 88 ? 20 1 1 A U 7 1_555 A A 87 1_555 0.003 -0.170 0.303 -0.656 -0.216 6.081 7 A_U7:A87_A A 7 ? A 87 ? 20 1 1 A C 8 1_555 A G 86 1_555 0.255 -0.182 0.455 -1.333 -3.536 -1.220 8 A_C8:G86_A A 8 ? A 86 ? 19 1 1 A U 64 1_555 A A 85 1_555 -0.006 -0.169 0.208 -1.742 -6.304 2.264 9 A_U64:A85_A A 64 ? A 85 ? 20 1 1 A G 35 1_555 A A 20 1_555 6.299 -3.723 1.129 21.908 18.500 6.302 10 A_G35:A20_A A 35 ? A 20 ? 11 9 1 A A 36 1_555 A G 19 1_555 -7.542 -4.745 0.480 -16.874 -1.674 -46.330 11 A_A36:G19_A A 36 ? A 19 ? ? ? 1 A C 37 1_555 A C 18 1_555 -3.693 -1.610 0.488 0.110 12.144 -21.901 12 A_C37:C18_A A 37 ? A 18 ? ? 1 1 A C 38 1_555 A G 17 1_555 0.141 -0.118 -0.253 12.177 1.538 0.972 13 A_C38:G17_A A 38 ? A 17 ? 19 1 1 A C 39 1_555 A G 16 1_555 0.176 -0.133 -0.007 1.341 0.901 0.336 14 A_C39:G16_A A 39 ? A 16 ? 19 1 1 A C 40 1_555 A G 15 1_555 0.160 -0.181 -0.315 -1.088 4.138 -0.078 15 A_C40:G15_A A 40 ? A 15 ? 19 1 1 A C 41 1_555 A G 13 1_555 0.131 -0.146 0.319 -4.227 -3.074 0.180 16 A_C41:G13_A A 41 ? A 13 ? 19 1 1 A G 42 1_555 A C 60 1_555 -0.225 -0.153 0.123 4.848 -3.008 1.135 17 A_G42:C60_A A 42 ? A 60 ? 19 1 1 A G 43 1_555 A C 59 1_555 -0.226 -0.115 0.136 -4.078 -13.374 3.535 18 A_G43:C59_A A 43 ? A 59 ? 19 1 1 A C 44 1_555 A G 58 1_555 0.083 -0.135 0.460 -13.091 -13.101 -3.758 19 A_C44:G58_A A 44 ? A 58 ? 19 1 1 A G 21 1_555 A C 31 1_555 -0.207 -0.187 -0.358 -1.881 -4.325 1.907 20 A_G21:C31_A A 21 ? A 31 ? 19 1 1 A C 22 1_555 A G 30 1_555 0.245 -0.183 -0.172 -2.678 -1.645 0.249 21 A_C22:G30_A A 22 ? A 30 ? 19 1 1 A G 23 1_555 A C 29 1_555 -0.155 -0.117 -0.016 3.857 5.163 0.707 22 A_G23:C29_A A 23 ? A 29 ? 19 1 1 A C 65 1_555 A G 28 1_555 0.183 -0.174 0.272 2.635 -2.103 -0.564 23 A_C65:G28_A A 65 ? A 28 ? 19 1 1 A C 66 1_555 A G 27 1_555 0.183 -0.211 0.092 1.788 -2.132 -0.785 24 A_C66:G27_A A 66 ? A 27 ? 19 1 1 A U 67 1_555 A U 26 1_555 2.155 -1.812 0.678 4.481 -9.711 7.625 25 A_U67:U26_A A 67 ? A 26 ? 16 1 1 A G 68 1_555 A C 25 1_555 -0.135 -0.247 0.421 0.101 -9.370 0.719 26 A_G68:C25_A A 68 ? A 25 ? 19 1 1 A C 47 1_555 A G 56 1_555 0.161 -0.148 0.029 4.707 -0.108 0.669 27 A_C47:G56_A A 47 ? A 56 ? 19 1 1 A C 48 1_555 A G 55 1_555 0.188 -0.155 0.387 2.144 -6.697 0.151 28 A_C48:G55_A A 48 ? A 55 ? 19 1 1 A A 49 1_555 A U 54 1_555 0.038 -0.121 0.295 2.382 14.026 4.126 29 A_A49:U54_A A 49 ? A 54 ? 20 1 1 A G 50 1_555 A A 53 1_555 7.344 -5.510 0.500 27.931 4.658 -8.150 30 A_G50:A53_A A 50 ? A 53 ? ? 10 1 A C 69 1_555 A G 82 1_555 0.192 -0.125 0.366 -2.130 -5.061 0.891 31 A_C69:G82_A A 69 ? A 82 ? 19 1 1 A A 70 1_555 A U 81 1_555 -0.014 -0.113 0.236 4.929 -7.160 1.796 32 A_A70:U81_A A 70 ? A 81 ? 20 1 1 A G 71 1_555 A U 80 1_555 -1.949 -0.560 0.055 1.255 -2.167 1.285 33 A_G71:U80_A A 71 ? A 80 ? 28 1 1 A C 72 1_555 A G 79 1_555 0.179 -0.131 0.067 2.556 -6.080 1.421 34 A_C72:G79_A A 72 ? A 79 ? 19 1 1 A G 73 1_555 A C 78 1_555 -0.149 -0.110 -0.513 -5.191 3.549 1.916 35 A_G73:C78_A A 73 ? A 78 ? 19 1 1 A G 74 1_555 A A 77 1_555 7.350 -5.506 1.282 9.968 -14.730 -19.337 36 A_G74:A77_A A 74 ? A 77 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 93 1_555 A G 2 1_555 A C 92 1_555 0.354 -1.571 3.056 -1.430 3.429 35.185 -3.046 -0.774 2.879 5.654 2.357 35.375 1 AA_G1G2:C92C93_AA A 1 ? A 93 ? A 2 ? A 92 ? 1 A G 2 1_555 A C 92 1_555 A C 3 1_555 A G 91 1_555 -0.685 -1.946 3.235 -4.597 1.540 34.378 -3.495 0.451 3.210 2.589 7.730 34.708 2 AA_G2C3:G91C92_AA A 2 ? A 92 ? A 3 ? A 91 ? 1 A C 3 1_555 A G 91 1_555 A U 4 1_555 A A 90 1_555 0.069 -1.600 3.134 -0.920 6.761 30.629 -4.114 -0.284 2.724 12.602 1.716 31.362 3 AA_C3U4:A90G91_AA A 3 ? A 91 ? A 4 ? A 90 ? 1 A U 4 1_555 A A 90 1_555 A U 5 1_555 A G 89 1_555 0.165 -1.073 3.179 1.455 6.283 38.168 -2.351 -0.080 2.976 9.525 -2.206 38.689 4 AA_U4U5:G89A90_AA A 4 ? A 90 ? A 5 ? A 89 ? 1 A U 5 1_555 A G 89 1_555 A A 6 1_555 A U 88 1_555 -0.314 -1.440 3.005 4.109 15.753 28.473 -4.751 1.131 1.906 29.206 -7.619 32.715 5 AA_U5A6:U88G89_AA A 5 ? A 89 ? A 6 ? A 88 ? 1 A A 6 1_555 A U 88 1_555 A U 7 1_555 A A 87 1_555 0.337 -1.490 3.358 -4.133 5.409 29.756 -3.886 -1.446 2.974 10.363 7.918 30.508 6 AA_A6U7:A87U88_AA A 6 ? A 88 ? A 7 ? A 87 ? 1 A U 7 1_555 A A 87 1_555 A C 8 1_555 A G 86 1_555 -0.163 -2.286 3.092 2.646 11.237 31.698 -5.461 0.639 2.159 19.771 -4.656 33.684 7 AA_U7C8:G86A87_AA A 7 ? A 87 ? A 8 ? A 86 ? 1 A C 8 1_555 A G 86 1_555 A U 64 1_555 A A 85 1_555 -1.426 -1.915 2.974 0.686 1.311 38.970 -3.011 2.210 2.886 1.965 -1.028 38.997 8 AA_C8U64:A85G86_AA A 8 ? A 86 ? A 64 ? A 85 ? 1 A G 35 1_555 A A 20 1_555 A A 36 1_555 A G 19 1_555 -2.779 0.021 4.138 -5.982 -24.631 -16.193 5.931 -6.817 1.718 56.305 -13.674 -30.006 9 AA_G35A36:G19A20_AA A 35 ? A 20 ? A 36 ? A 19 ? 1 A A 36 1_555 A G 19 1_555 A C 37 1_555 A C 18 1_555 0.354 -1.083 3.249 -12.963 3.719 59.065 -1.253 -0.968 3.052 3.720 12.966 60.450 10 AA_A36C37:C18G19_AA A 36 ? A 19 ? A 37 ? A 18 ? 1 A C 37 1_555 A C 18 1_555 A C 38 1_555 A G 17 1_555 1.432 -1.008 3.103 0.086 8.909 51.099 -1.708 -1.633 2.904 10.239 -0.099 51.818 11 AA_C37C38:G17C18_AA A 37 ? A 18 ? A 38 ? A 17 ? 1 A C 38 1_555 A G 17 1_555 A C 39 1_555 A G 16 1_555 -0.266 -2.340 3.372 -2.822 10.532 33.135 -5.396 0.046 2.546 17.875 4.790 34.835 12 AA_C38C39:G16G17_AA A 38 ? A 17 ? A 39 ? A 16 ? 1 A C 39 1_555 A G 16 1_555 A C 40 1_555 A G 15 1_555 -0.347 -2.075 3.318 0.044 1.592 31.054 -4.175 0.657 3.210 2.971 -0.083 31.094 13 AA_C39C40:G15G16_AA A 39 ? A 16 ? A 40 ? A 15 ? 1 A C 40 1_555 A G 15 1_555 A C 41 1_555 A G 13 1_555 1.670 -1.590 3.037 -0.697 7.327 45.613 -2.584 -2.183 2.740 9.379 0.893 46.172 14 AA_C40C41:G13G15_AA A 40 ? A 15 ? A 41 ? A 13 ? 1 A C 41 1_555 A G 13 1_555 A G 42 1_555 A C 60 1_555 2.264 -1.289 3.152 -5.080 2.686 46.104 -1.842 -3.264 2.826 3.414 6.457 46.441 15 AA_C41G42:C60G13_AA A 41 ? A 13 ? A 42 ? A 60 ? 1 A G 42 1_555 A C 60 1_555 A G 43 1_555 A C 59 1_555 0.470 -1.752 3.270 0.235 6.744 33.770 -3.959 -0.760 2.880 11.467 -0.399 34.418 16 AA_G42G43:C59C60_AA A 42 ? A 60 ? A 43 ? A 59 ? 1 A G 43 1_555 A C 59 1_555 A C 44 1_555 A G 58 1_555 -0.906 -1.546 3.284 -2.522 0.102 38.043 -2.379 1.064 3.331 0.156 3.864 38.124 17 AA_G43C44:G58C59_AA A 43 ? A 59 ? A 44 ? A 58 ? 1 A G 21 1_555 A C 31 1_555 A C 22 1_555 A G 30 1_555 0.179 -2.045 3.429 -0.155 1.633 35.530 -3.594 -0.317 3.334 2.674 0.253 35.566 18 AA_G21C22:G30C31_AA A 21 ? A 31 ? A 22 ? A 30 ? 1 A C 22 1_555 A G 30 1_555 A G 23 1_555 A C 29 1_555 0.116 -2.378 3.491 1.080 -3.557 22.824 -4.540 0.133 3.814 -8.913 -2.706 23.121 19 AA_C22G23:C29G30_AA A 22 ? A 30 ? A 23 ? A 29 ? 1 A G 23 1_555 A C 29 1_555 A C 65 1_555 A G 28 1_555 -2.846 -0.869 3.341 -3.450 -0.394 55.916 -0.901 2.824 3.502 -0.420 3.675 56.015 20 AA_G23C65:G28C29_AA A 23 ? A 29 ? A 65 ? A 28 ? 1 A C 65 1_555 A G 28 1_555 A C 66 1_555 A G 27 1_555 -0.826 -2.023 3.076 -1.101 7.464 30.960 -4.877 1.330 2.558 13.728 2.026 31.844 21 AA_C65C66:G27G28_AA A 65 ? A 28 ? A 66 ? A 27 ? 1 A C 66 1_555 A G 27 1_555 A U 67 1_555 A U 26 1_555 1.053 -1.169 2.983 0.974 8.897 43.308 -2.288 -1.319 2.725 11.904 -1.303 44.180 22 AA_C66U67:U26G27_AA A 66 ? A 27 ? A 67 ? A 26 ? 1 A U 67 1_555 A U 26 1_555 A G 68 1_555 A C 25 1_555 -0.120 -1.345 3.012 10.903 11.830 31.103 -3.758 1.600 2.210 20.438 -18.837 34.926 23 AA_U67G68:C25U26_AA A 67 ? A 26 ? A 68 ? A 25 ? 1 A C 47 1_555 A G 56 1_555 A C 48 1_555 A G 55 1_555 0.259 -2.178 3.091 -4.183 6.669 37.273 -4.089 -0.867 2.633 10.294 6.456 38.067 24 AA_C47C48:G55G56_AA A 47 ? A 56 ? A 48 ? A 55 ? 1 A C 48 1_555 A G 55 1_555 A A 49 1_555 A U 54 1_555 0.038 -2.095 3.176 -0.817 2.496 29.201 -4.649 -0.241 2.988 4.938 1.616 29.317 25 AA_C48A49:U54G55_AA A 48 ? A 55 ? A 49 ? A 54 ? 1 A A 49 1_555 A U 54 1_555 A G 50 1_555 A A 53 1_555 -1.385 -0.956 2.708 0.746 4.809 57.611 -1.199 1.466 2.611 4.981 -0.773 57.799 26 AA_A49G50:A53U54_AA A 49 ? A 54 ? A 50 ? A 53 ? 1 A C 69 1_555 A G 82 1_555 A A 70 1_555 A U 81 1_555 -0.274 -1.683 2.740 0.514 8.072 28.053 -4.689 0.629 2.175 16.230 -1.034 29.174 27 AA_C69A70:U81G82_AA A 69 ? A 82 ? A 70 ? A 81 ? 1 A A 70 1_555 A U 81 1_555 A G 71 1_555 A U 80 1_555 -0.486 -1.757 2.975 -6.234 8.686 28.725 -4.787 -0.126 2.405 16.792 12.052 30.611 28 AA_A70G71:U80U81_AA A 70 ? A 81 ? A 71 ? A 80 ? 1 A G 71 1_555 A U 80 1_555 A C 72 1_555 A G 79 1_555 -0.191 -1.174 3.157 -1.993 6.033 40.471 -2.299 0.068 2.966 8.656 2.860 40.946 29 AA_G71C72:G79U80_AA A 71 ? A 80 ? A 72 ? A 79 ? 1 A C 72 1_555 A G 79 1_555 A G 73 1_555 A C 78 1_555 -0.075 -2.035 3.479 -0.155 10.835 29.735 -5.661 0.110 2.597 20.285 0.290 31.606 30 AA_C72G73:C78G79_AA A 72 ? A 79 ? A 73 ? A 78 ? 1 A G 73 1_555 A C 78 1_555 A G 74 1_555 A A 77 1_555 -2.506 -0.931 2.864 -3.666 12.556 56.903 -1.533 2.406 2.763 12.988 3.793 58.265 31 AA_G73G74:A77C78_AA A 73 ? A 78 ? A 74 ? A 77 ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5FK2 _pdbx_initial_refinement_model.details 'WWPDB ENTRY 5FK2' # _atom_sites.entry_id 5FK3 _atom_sites.fract_transf_matrix[1][1] 0.016061 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016061 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.006503 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol BA C K N O P S # loop_