data_5NZ6 # _entry.id 5NZ6 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 5NZ6 pdb_00005nz6 10.2210/pdb5nz6/pdb WWPDB D_1200004947 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2017-10-18 2 'Structure model' 1 1 2017-11-29 3 'Structure model' 1 2 2024-01-17 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' chem_comp_atom 3 3 'Structure model' chem_comp_bond 4 3 'Structure model' database_2 5 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 3 'Structure model' '_database_2.pdbx_DOI' 5 3 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 5NZ6 _pdbx_database_status.recvd_initial_deposition_date 2017-05-12 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Huang, L.' 1 ? 'Wang, J.' 2 ? 'Lilley, D.M.J.' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Cell Chem Biol' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2451-9456 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 24 _citation.language ? _citation.page_first 1407 _citation.page_last 1415.e2 _citation.title 'Structure of the Guanidine III Riboswitch.' _citation.year 2017 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1016/j.chembiol.2017.08.021 _citation.pdbx_database_id_PubMed 28988949 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Huang, L.' 1 ? primary 'Wang, J.' 2 ? primary 'Wilson, T.J.' 3 ? primary 'Lilley, D.M.J.' 4 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (41-MER)' 13420.789 1 ? ? ? ? 2 non-polymer syn GUANIDINE 59.070 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'C(CBV)GGACGAGGUGCGCCGUACCCGGUCACGACAAGACGG(CBV)GC' _entity_poly.pdbx_seq_one_letter_code_can CCGGACGAGGUGCGCCGUACCCGGUCACGACAAGACGGCGC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name GUANIDINE _pdbx_entity_nonpoly.comp_id GAI # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 CBV n 1 3 G n 1 4 G n 1 5 A n 1 6 C n 1 7 G n 1 8 A n 1 9 G n 1 10 G n 1 11 U n 1 12 G n 1 13 C n 1 14 G n 1 15 C n 1 16 C n 1 17 G n 1 18 U n 1 19 A n 1 20 C n 1 21 C n 1 22 C n 1 23 G n 1 24 G n 1 25 U n 1 26 C n 1 27 A n 1 28 C n 1 29 G n 1 30 A n 1 31 C n 1 32 A n 1 33 A n 1 34 G n 1 35 A n 1 36 C n 1 37 G n 1 38 G n 1 39 CBV n 1 40 G n 1 41 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 41 _pdbx_entity_src_syn.organism_scientific 'Thermobifida fusca' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 2021 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CBV 'RNA linking' n ;5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) ; ? 'C9 H13 Br N3 O8 P' 402.093 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GAI non-polymer . GUANIDINE ? 'C H5 N3' 59.070 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 1 1 C C A . n A 1 2 CBV 2 2 2 CBV CBV A . n A 1 3 G 3 3 3 G G A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 C 6 6 6 C C A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 G 14 14 14 G G A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 A 19 19 19 A A A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n A 1 23 G 23 23 23 G G A . n A 1 24 G 24 24 24 G G A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 A 27 27 27 A A A . n A 1 28 C 28 28 28 C C A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 C 31 31 31 C C A . n A 1 32 A 32 32 32 A A A . n A 1 33 A 33 33 33 A A A . n A 1 34 G 34 34 34 G G A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 G 38 38 38 G G A . n A 1 39 CBV 39 39 39 CBV CBV A . n A 1 40 G 40 40 40 G G A . n A 1 41 C 41 41 41 C C A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id GAI _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 1 _pdbx_nonpoly_scheme.pdb_mon_id GAI _pdbx_nonpoly_scheme.auth_mon_id GAI _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(dev_2219: ???)' 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 5NZ6 _cell.details ? _cell.formula_units_Z ? _cell.length_a 83.560 _cell.length_a_esd ? _cell.length_b 83.560 _cell.length_b_esd ? _cell.length_c 98.814 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 5NZ6 _symmetry.cell_setting ? _symmetry.Int_Tables_number 153 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32 1 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 5NZ6 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '60% v/v Tacsimate pH 7.0' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2017-04-24 # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.92019 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'DIAMOND BEAMLINE I03' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.92019 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline I03 _diffrn_source.pdbx_synchrotron_site Diamond # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 5NZ6 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.94 _reflns.d_resolution_low 49.41 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 16177 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I 1.7 _reflns.percent_possible_obs 100 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 21.57 _reflns.pdbx_Rmerge_I_obs 0.101 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 18.2 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.023 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.965 _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 2.94 _reflns_shell.d_res_low 2.99 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 1.7 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 434 _reflns_shell.percent_possible_all 100 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 1.658 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 21.1 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.367 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.964 _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 5NZ6 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.940 _refine.ls_d_res_low 32.938 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 16177 _refine.ls_number_reflns_R_free 789 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.56 _refine.ls_percent_reflns_R_free 4.88 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1924 _refine.ls_R_factor_R_free 0.2169 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1912 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.33 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5NWQ _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 30.50 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.49 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 882 _refine_hist.pdbx_number_atoms_ligand 4 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 886 _refine_hist.d_res_high 2.940 _refine_hist.d_res_low 32.938 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.009 ? 993 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.721 ? 1550 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 18.285 ? 469 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.070 ? 202 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.010 ? 42 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.9400 3.1241 . . 149 2488 97.00 . . . 0.4682 . 0.4107 . . . . . . . . . . 'X-RAY DIFFRACTION' 3.1241 3.3651 . . 119 2571 98.00 . . . 0.2567 . 0.2268 . . . . . . . . . . 'X-RAY DIFFRACTION' 3.3651 3.7033 . . 152 2538 99.00 . . . 0.2159 . 0.2101 . . . . . . . . . . 'X-RAY DIFFRACTION' 3.7033 4.2383 . . 148 2551 99.00 . . . 0.2014 . 0.2007 . . . . . . . . . . 'X-RAY DIFFRACTION' 4.2383 5.3361 . . 90 2616 99.00 . . . 0.2228 . 0.1647 . . . . . . . . . . 'X-RAY DIFFRACTION' 5.3361 32.9400 . . 131 2624 100.00 . . . 0.1721 . 0.1574 . . . . . . . . . . # _struct.entry_id 5NZ6 _struct.title 'The structure of the thermobifida fusca guanidine III riboswitch with guanidine in space group P3212.' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 5NZ6 _struct_keywords.text 'guanidine III riboswitch, stem-loop, pseudoknot, RNA, gene regulation' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 5NZ6 _struct_ref.pdbx_db_accession 5NZ6 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 5NZ6 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 41 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 5NZ6 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 41 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 41 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 1240 ? 1 MORE -0 ? 1 'SSA (A^2)' 6640 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A C 1 "O3'" ? ? ? 1_555 A CBV 2 P ? ? A C 1 A CBV 2 1_555 ? ? ? ? ? ? ? 1.621 ? ? covale2 covale both ? A G 38 "O3'" ? ? ? 1_555 A CBV 39 P ? ? A G 38 A CBV 39 1_555 ? ? ? ? ? ? ? 1.604 ? ? covale3 covale one ? A CBV 39 "O3'" ? ? ? 1_555 A G 40 P ? ? A CBV 39 A G 40 1_555 ? ? ? ? ? ? ? 1.576 ? ? hydrog1 hydrog ? ? A C 1 N3 ? ? ? 1_555 A G 24 N1 ? ? A C 1 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 1 N4 ? ? ? 1_555 A G 24 O6 ? ? A C 1 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 1 O2 ? ? ? 1_555 A G 24 N2 ? ? A C 1 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A CBV 2 N3 ? ? ? 1_555 A G 23 N1 ? ? A CBV 2 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A CBV 2 N4 ? ? ? 1_555 A G 23 O6 ? ? A CBV 2 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A CBV 2 O2 ? ? ? 1_555 A G 23 N2 ? ? A CBV 2 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 3 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 3 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 3 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 4 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 4 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 4 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N1 ? ? ? 1_555 A A 19 N6 ? ? A A 5 A A 19 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog14 hydrog ? ? A A 5 N6 ? ? ? 1_555 A A 19 N7 ? ? A A 5 A A 19 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A U 18 O4 ? ? A C 6 A U 18 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog16 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 34 N2 ? ? A C 6 A G 34 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog17 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 34 N1 ? ? A C 6 A G 34 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog18 hydrog ? ? A G 7 N1 ? ? ? 1_555 A A 35 N7 ? ? A G 7 A A 35 1_555 ? ? ? ? ? ? TYPE_9_PAIR ? ? ? hydrog19 hydrog ? ? A G 7 O6 ? ? ? 1_555 A A 35 N6 ? ? A G 7 A A 35 1_555 ? ? ? ? ? ? TYPE_9_PAIR ? ? ? hydrog20 hydrog ? ? A A 8 N1 ? ? ? 1_555 A C 36 N4 ? ? A A 8 A C 36 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog21 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 16 N4 ? ? A G 9 A C 16 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A G 37 O6 ? ? A G 9 A G 37 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A G 9 N2 ? ? ? 1_555 A G 37 N7 ? ? A G 9 A G 37 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 15 N4 ? ? A G 10 A C 15 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog25 hydrog ? ? A G 10 N1 ? ? ? 1_555 A G 38 O6 ? ? A G 10 A G 38 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A G 10 N2 ? ? ? 1_555 A G 38 N7 ? ? A G 10 A G 38 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A U 11 N3 ? ? ? 1_555 A G 14 O6 ? ? A U 11 A G 14 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog28 hydrog ? ? A U 11 O4 ? ? ? 1_555 A CBV 39 N4 ? ? A U 11 A CBV 39 1_555 ? ? ? ? ? ? 'U-CBV MISPAIR' ? ? ? hydrog29 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 41 O2 ? ? A G 12 A C 41 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog30 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 41 N3 ? ? A G 12 A C 41 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog31 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 40 N1 ? ? A C 13 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 40 O6 ? ? A C 13 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 40 N2 ? ? A C 13 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 14 N1 ? ? ? 1_555 A CBV 39 N3 ? ? A G 14 A CBV 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 14 N2 ? ? ? 1_555 A CBV 39 O2 ? ? A G 14 A CBV 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 14 O6 ? ? ? 1_555 A CBV 39 N4 ? ? A G 14 A CBV 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 15 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 15 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 15 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 16 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 16 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 16 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 17 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 17 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 17 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 35 N1 ? ? A U 18 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 35 N6 ? ? A U 18 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A A 19 N6 ? ? ? 1_555 A G 34 N3 ? ? A A 19 A G 34 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog49 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 20 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 20 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 20 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 23 N2 ? ? ? 1_555 A A 27 N3 ? ? A G 23 A A 27 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id GAI _struct_site.pdbx_auth_seq_id 101 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 4 _struct_site.details 'binding site for residue GAI A 101' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 4 C A 6 ? C A 6 . ? 1_555 ? 2 AC1 4 G A 7 ? G A 7 . ? 1_555 ? 3 AC1 4 A A 8 ? A A 8 . ? 1_555 ? 4 AC1 4 G A 17 ? G A 17 . ? 1_555 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O3'" A C 1 ? ? O3P A CBV 2 ? ? 0.34 2 1 "O3'" A G 38 ? ? O3P A CBV 39 ? ? 0.40 3 1 O6 A G 12 ? ? H42 A C 41 ? ? 0.81 4 1 "HO3'" A CBV 39 ? ? P A G 40 ? ? 1.02 5 1 H1 A G 12 ? ? N3 A C 41 ? ? 1.09 6 1 "HO2'" A A 35 ? ? H6 A C 36 ? ? 1.16 7 1 "HO2'" A G 40 ? ? "H5'" A C 41 ? ? 1.16 8 1 C6 A G 12 ? ? H42 A C 41 ? ? 1.42 9 1 H21 A G 12 ? ? O2 A C 41 ? ? 1.46 10 1 O4 A U 11 ? ? HN42 A CBV 39 ? ? 1.55 11 1 O6 A G 12 ? ? N4 A C 41 ? ? 1.67 12 1 "C3'" A C 1 ? ? O3P A CBV 2 ? ? 1.77 13 1 N1 A G 12 ? ? N3 A C 41 ? ? 1.93 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N3 A G 4 ? ? C4 A G 4 ? ? C5 A G 4 ? ? 132.09 128.60 3.49 0.50 N 2 1 C8 A G 4 ? ? N9 A G 4 ? ? C4 A G 4 ? ? 109.18 106.40 2.78 0.40 N 3 1 N1 A A 5 ? ? C6 A A 5 ? ? N6 A A 5 ? ? 122.70 118.60 4.10 0.60 N 4 1 N3 A G 14 ? ? C4 A G 14 ? ? C5 A G 14 ? ? 131.70 128.60 3.10 0.50 N 5 1 C8 A G 29 ? ? N9 A G 29 ? ? C4 A G 29 ? ? 103.84 106.40 -2.56 0.40 N 6 1 N3 A G 29 ? ? C4 A G 29 ? ? N9 A G 29 ? ? 121.64 126.00 -4.36 0.60 N 7 1 N3 A G 29 ? ? C2 A G 29 ? ? N2 A G 29 ? ? 115.55 119.90 -4.35 0.70 N 8 1 C8 A G 38 ? ? N9 A G 38 ? ? C4 A G 38 ? ? 109.44 106.40 3.04 0.40 N # _pdbx_validate_polymer_linkage.id 1 _pdbx_validate_polymer_linkage.PDB_model_num 1 _pdbx_validate_polymer_linkage.auth_atom_id_1 "O3'" _pdbx_validate_polymer_linkage.auth_asym_id_1 A _pdbx_validate_polymer_linkage.auth_comp_id_1 CBV _pdbx_validate_polymer_linkage.auth_seq_id_1 2 _pdbx_validate_polymer_linkage.PDB_ins_code_1 ? _pdbx_validate_polymer_linkage.label_alt_id_1 ? _pdbx_validate_polymer_linkage.auth_atom_id_2 P _pdbx_validate_polymer_linkage.auth_asym_id_2 A _pdbx_validate_polymer_linkage.auth_comp_id_2 G _pdbx_validate_polymer_linkage.auth_seq_id_2 3 _pdbx_validate_polymer_linkage.PDB_ins_code_2 ? _pdbx_validate_polymer_linkage.label_alt_id_2 ? _pdbx_validate_polymer_linkage.dist 5.00 # loop_ _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][3] 'X-RAY DIFFRACTION' 1 ? refined -15.9453 -11.5367 13.3855 1.0534 1.0217 0.8361 -0.4480 -0.1971 0.1308 1.0117 7.8488 0.6486 -1.0100 -0.7340 -0.4022 0.1168 -0.9113 0.3122 0.2831 -0.0993 1.1979 -0.3561 0.2593 -0.0137 'X-RAY DIFFRACTION' 2 ? refined -19.9275 -19.8592 15.2363 1.1593 0.9236 0.9338 -0.4348 -0.0906 0.0017 2.0028 3.2444 1.4766 1.7060 0.0464 -0.3404 -0.0980 -0.4993 -0.1275 -0.1730 -0.0857 -0.2104 -0.3518 0.4247 0.2232 'X-RAY DIFFRACTION' 3 ? refined -9.8593 2.0031 11.1299 1.4416 0.9645 1.1012 -0.4805 -0.1727 0.0029 4.9682 7.3736 4.3941 -0.3633 -1.5910 -1.1503 1.1341 -1.0148 -0.0633 0.3373 -0.7924 -0.3976 -0.8561 0.9552 -0.2907 'X-RAY DIFFRACTION' 4 ? refined -11.9178 -1.6722 4.0350 0.9085 1.0174 0.5251 -0.5316 -0.2416 -0.0103 6.7589 1.3726 8.6557 0.7068 -3.9319 0.0683 -0.2059 1.0512 0.9416 0.8404 0.0581 -0.7922 -0.6338 0.5787 -0.1605 'X-RAY DIFFRACTION' 5 ? refined -5.8553 -15.6292 11.8538 0.9279 1.0551 0.8867 -0.2521 -0.1550 0.2582 3.1091 1.3616 4.5677 1.0782 -1.2553 -0.9433 0.2311 -0.4317 -0.7938 0.8089 -1.0965 -1.2338 0.7385 -0.2333 0.6469 'X-RAY DIFFRACTION' 6 ? refined -24.7248 -21.4474 20.0191 1.3779 0.6761 0.8887 -0.4424 0.1745 0.0250 6.6749 6.5967 5.4475 -0.2094 0.1144 -0.6593 0.9484 -0.5779 -0.3942 0.2163 -0.4467 1.8989 0.1375 0.5010 -0.2436 # loop_ _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 'X-RAY DIFFRACTION' 1 1 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 1 through 10 ) ; 'X-RAY DIFFRACTION' 2 2 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 11 through 20 ) ; 'X-RAY DIFFRACTION' 3 3 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 21 through 25 ) ; 'X-RAY DIFFRACTION' 4 4 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 26 through 30 ) ; 'X-RAY DIFFRACTION' 5 5 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 31 through 35 ) ; 'X-RAY DIFFRACTION' 6 6 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 36 through 41 ) ; # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CBV O3P O N N 73 CBV P P N N 74 CBV O1P O N N 75 CBV O2P O N N 76 CBV "O5'" O N N 77 CBV "C5'" C N N 78 CBV "C4'" C N R 79 CBV "O4'" O N N 80 CBV "C3'" C N S 81 CBV "O3'" O N N 82 CBV "C2'" C N R 83 CBV "O2'" O N N 84 CBV "C1'" C N R 85 CBV N1 N N N 86 CBV C2 C N N 87 CBV O2 O N N 88 CBV N3 N N N 89 CBV C4 C N N 90 CBV N4 N N N 91 CBV C5 C N N 92 CBV C6 C N N 93 CBV BR BR N N 94 CBV HO3P H N N 95 CBV HO1P H N N 96 CBV "H5'1" H N N 97 CBV "H5'2" H N N 98 CBV "H4'" H N N 99 CBV "H3'" H N N 100 CBV "HO3'" H N N 101 CBV "H2'" H N N 102 CBV "HO2'" H N N 103 CBV "H1'" H N N 104 CBV HN41 H N N 105 CBV HN42 H N N 106 CBV H6 H N N 107 G OP3 O N N 108 G P P N N 109 G OP1 O N N 110 G OP2 O N N 111 G "O5'" O N N 112 G "C5'" C N N 113 G "C4'" C N R 114 G "O4'" O N N 115 G "C3'" C N S 116 G "O3'" O N N 117 G "C2'" C N R 118 G "O2'" O N N 119 G "C1'" C N R 120 G N9 N Y N 121 G C8 C Y N 122 G N7 N Y N 123 G C5 C Y N 124 G C6 C N N 125 G O6 O N N 126 G N1 N N N 127 G C2 C N N 128 G N2 N N N 129 G N3 N N N 130 G C4 C Y N 131 G HOP3 H N N 132 G HOP2 H N N 133 G "H5'" H N N 134 G "H5''" H N N 135 G "H4'" H N N 136 G "H3'" H N N 137 G "HO3'" H N N 138 G "H2'" H N N 139 G "HO2'" H N N 140 G "H1'" H N N 141 G H8 H N N 142 G H1 H N N 143 G H21 H N N 144 G H22 H N N 145 GAI C C N N 146 GAI N1 N N N 147 GAI N2 N N N 148 GAI N3 N N N 149 GAI HN1 H N N 150 GAI HN21 H N N 151 GAI HN22 H N N 152 GAI HN31 H N N 153 GAI HN32 H N N 154 U OP3 O N N 155 U P P N N 156 U OP1 O N N 157 U OP2 O N N 158 U "O5'" O N N 159 U "C5'" C N N 160 U "C4'" C N R 161 U "O4'" O N N 162 U "C3'" C N S 163 U "O3'" O N N 164 U "C2'" C N R 165 U "O2'" O N N 166 U "C1'" C N R 167 U N1 N N N 168 U C2 C N N 169 U O2 O N N 170 U N3 N N N 171 U C4 C N N 172 U O4 O N N 173 U C5 C N N 174 U C6 C N N 175 U HOP3 H N N 176 U HOP2 H N N 177 U "H5'" H N N 178 U "H5''" H N N 179 U "H4'" H N N 180 U "H3'" H N N 181 U "HO3'" H N N 182 U "H2'" H N N 183 U "HO2'" H N N 184 U "H1'" H N N 185 U H3 H N N 186 U H5 H N N 187 U H6 H N N 188 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 CBV O3P P sing N N 76 CBV O3P HO3P sing N N 77 CBV P O1P sing N N 78 CBV P O2P doub N N 79 CBV P "O5'" sing N N 80 CBV O1P HO1P sing N N 81 CBV "O5'" "C5'" sing N N 82 CBV "C5'" "C4'" sing N N 83 CBV "C5'" "H5'1" sing N N 84 CBV "C5'" "H5'2" sing N N 85 CBV "C4'" "O4'" sing N N 86 CBV "C4'" "C3'" sing N N 87 CBV "C4'" "H4'" sing N N 88 CBV "O4'" "C1'" sing N N 89 CBV "C3'" "O3'" sing N N 90 CBV "C3'" "C2'" sing N N 91 CBV "C3'" "H3'" sing N N 92 CBV "O3'" "HO3'" sing N N 93 CBV "C2'" "O2'" sing N N 94 CBV "C2'" "C1'" sing N N 95 CBV "C2'" "H2'" sing N N 96 CBV "O2'" "HO2'" sing N N 97 CBV "C1'" N1 sing N N 98 CBV "C1'" "H1'" sing N N 99 CBV N1 C2 sing N N 100 CBV N1 C6 sing N N 101 CBV C2 O2 doub N N 102 CBV C2 N3 sing N N 103 CBV N3 C4 doub N N 104 CBV C4 N4 sing N N 105 CBV C4 C5 sing N N 106 CBV N4 HN41 sing N N 107 CBV N4 HN42 sing N N 108 CBV C5 C6 doub N N 109 CBV C5 BR sing N N 110 CBV C6 H6 sing N N 111 G OP3 P sing N N 112 G OP3 HOP3 sing N N 113 G P OP1 doub N N 114 G P OP2 sing N N 115 G P "O5'" sing N N 116 G OP2 HOP2 sing N N 117 G "O5'" "C5'" sing N N 118 G "C5'" "C4'" sing N N 119 G "C5'" "H5'" sing N N 120 G "C5'" "H5''" sing N N 121 G "C4'" "O4'" sing N N 122 G "C4'" "C3'" sing N N 123 G "C4'" "H4'" sing N N 124 G "O4'" "C1'" sing N N 125 G "C3'" "O3'" sing N N 126 G "C3'" "C2'" sing N N 127 G "C3'" "H3'" sing N N 128 G "O3'" "HO3'" sing N N 129 G "C2'" "O2'" sing N N 130 G "C2'" "C1'" sing N N 131 G "C2'" "H2'" sing N N 132 G "O2'" "HO2'" sing N N 133 G "C1'" N9 sing N N 134 G "C1'" "H1'" sing N N 135 G N9 C8 sing Y N 136 G N9 C4 sing Y N 137 G C8 N7 doub Y N 138 G C8 H8 sing N N 139 G N7 C5 sing Y N 140 G C5 C6 sing N N 141 G C5 C4 doub Y N 142 G C6 O6 doub N N 143 G C6 N1 sing N N 144 G N1 C2 sing N N 145 G N1 H1 sing N N 146 G C2 N2 sing N N 147 G C2 N3 doub N N 148 G N2 H21 sing N N 149 G N2 H22 sing N N 150 G N3 C4 sing N N 151 GAI C N1 doub N N 152 GAI C N2 sing N N 153 GAI C N3 sing N N 154 GAI N1 HN1 sing N N 155 GAI N2 HN21 sing N N 156 GAI N2 HN22 sing N N 157 GAI N3 HN31 sing N N 158 GAI N3 HN32 sing N N 159 U OP3 P sing N N 160 U OP3 HOP3 sing N N 161 U P OP1 doub N N 162 U P OP2 sing N N 163 U P "O5'" sing N N 164 U OP2 HOP2 sing N N 165 U "O5'" "C5'" sing N N 166 U "C5'" "C4'" sing N N 167 U "C5'" "H5'" sing N N 168 U "C5'" "H5''" sing N N 169 U "C4'" "O4'" sing N N 170 U "C4'" "C3'" sing N N 171 U "C4'" "H4'" sing N N 172 U "O4'" "C1'" sing N N 173 U "C3'" "O3'" sing N N 174 U "C3'" "C2'" sing N N 175 U "C3'" "H3'" sing N N 176 U "O3'" "HO3'" sing N N 177 U "C2'" "O2'" sing N N 178 U "C2'" "C1'" sing N N 179 U "C2'" "H2'" sing N N 180 U "O2'" "HO2'" sing N N 181 U "C1'" N1 sing N N 182 U "C1'" "H1'" sing N N 183 U N1 C2 sing N N 184 U N1 C6 sing N N 185 U C2 O2 doub N N 186 U C2 N3 sing N N 187 U N3 C4 sing N N 188 U N3 H3 sing N N 189 U C4 O4 doub N N 190 U C4 C5 sing N N 191 U C5 C6 doub N N 192 U C5 H5 sing N N 193 U C6 H6 sing N N 194 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 5NZ6 'double helix' 5NZ6 'a-form double helix' 5NZ6 'bulge loop' 5NZ6 'mismatched base pair' 5NZ6 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 1 1_555 A G 24 1_555 0.219 -0.344 0.017 0.176 -0.527 -2.368 1 A_C1:G24_A A 1 ? A 24 ? 19 1 1 A CBV 2 1_555 A G 23 1_555 -0.638 -0.232 0.649 2.038 -9.704 -7.915 2 A_CBV2:G23_A A 2 ? A 23 ? 19 1 1 A G 3 1_555 A C 22 1_555 -0.108 -0.277 -0.015 -1.656 -1.871 3.361 3 A_G3:C22_A A 3 ? A 22 ? 19 1 1 A G 4 1_555 A C 21 1_555 -0.161 -0.364 -0.060 4.094 -1.494 -2.402 4 A_G4:C21_A A 4 ? A 21 ? 19 1 1 A G 29 1_555 A C 20 1_555 0.016 -0.200 0.088 -11.626 -4.458 2.888 5 A_G29:C20_A A 29 ? A 20 ? 19 1 1 A A 5 1_555 A A 19 1_555 4.754 0.571 -0.862 -7.978 -13.122 -101.159 6 A_A5:A19_A A 5 ? A 19 ? 5 4 1 A A 35 1_555 A U 18 1_555 0.109 -0.232 0.270 10.929 -1.182 -5.856 7 A_A35:U18_A A 35 ? A 18 ? 20 1 1 A C 36 1_555 A G 17 1_555 0.383 -0.337 0.563 -1.836 -5.122 -0.584 8 A_C36:G17_A A 36 ? A 17 ? 19 1 1 A G 37 1_555 A C 16 1_555 -0.405 -0.393 -0.064 -0.544 -0.890 0.037 9 A_G37:C16_A A 37 ? A 16 ? 19 1 1 A G 38 1_555 A C 15 1_555 -0.216 -0.464 0.054 -1.087 0.609 -4.755 10 A_G38:C15_A A 38 ? A 15 ? 19 1 1 A CBV 39 1_555 A G 14 1_555 -0.532 -0.138 -0.062 2.230 -5.349 -0.706 11 A_CBV39:G14_A A 39 ? A 14 ? 19 1 1 A G 40 1_555 A C 13 1_555 -0.219 -0.393 0.319 -0.870 -8.966 -0.745 12 A_G40:C13_A A 40 ? A 13 ? 19 1 1 A C 41 1_555 A G 12 1_555 -0.566 -1.169 0.062 -2.251 -13.400 -10.109 13 A_C41:G12_A A 41 ? A 12 ? 22 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 1 1_555 A G 24 1_555 A CBV 2 1_555 A G 23 1_555 0.400 -2.074 3.037 -3.523 4.402 32.022 -4.383 -1.258 2.677 7.903 6.324 32.501 1 AA_C1CBV2:G23G24_AA A 1 ? A 24 ? A 2 ? A 23 ? 1 A CBV 2 1_555 A G 23 1_555 A G 3 1_555 A C 22 1_555 -0.163 -2.266 3.078 1.710 7.854 30.933 -5.339 0.562 2.432 14.423 -3.140 31.935 2 AA_CBV2G3:C22G23_AA A 2 ? A 23 ? A 3 ? A 22 ? 1 A G 3 1_555 A C 22 1_555 A G 4 1_555 A C 21 1_555 0.049 -2.068 3.097 -2.271 5.167 30.401 -4.776 -0.486 2.706 9.748 4.285 30.909 3 AA_G3G4:C21C22_AA A 3 ? A 22 ? A 4 ? A 21 ? 1 A G 4 1_555 A C 21 1_555 A G 29 1_555 A C 20 1_555 -0.998 -1.431 3.489 -3.644 0.615 43.946 -1.969 0.961 3.537 0.820 4.859 44.094 4 AA_G4G29:C20C21_AA A 4 ? A 21 ? A 29 ? A 20 ? 1 A G 29 1_555 A C 20 1_555 A A 5 1_555 A A 19 1_555 -3.157 -1.960 3.397 7.640 8.180 34.190 -4.196 6.070 2.154 13.474 -12.584 35.924 5 AA_G29A5:A19C20_AA A 29 ? A 20 ? A 5 ? A 19 ? 1 A A 5 1_555 A A 19 1_555 A A 35 1_555 A U 18 1_555 -1.528 -0.866 3.355 9.752 3.376 71.986 -0.842 1.609 3.117 2.858 -8.255 72.623 6 AA_A5A35:U18A19_AA A 5 ? A 19 ? A 35 ? A 18 ? 1 A A 35 1_555 A U 18 1_555 A C 36 1_555 A G 17 1_555 -0.456 -1.455 3.558 -7.394 -0.015 33.588 -2.460 -0.503 3.576 -0.025 12.606 34.369 7 AA_A35C36:G17U18_AA A 35 ? A 18 ? A 36 ? A 17 ? 1 A C 36 1_555 A G 17 1_555 A G 37 1_555 A C 16 1_555 0.449 -2.246 3.300 0.963 -2.305 31.140 -3.719 -0.644 3.465 -4.286 -1.790 31.238 8 AA_C36G37:C16G17_AA A 36 ? A 17 ? A 37 ? A 16 ? 1 A G 37 1_555 A C 16 1_555 A G 38 1_555 A C 15 1_555 -0.658 -2.350 3.288 -3.312 2.284 24.664 -6.103 0.547 3.121 5.301 7.687 24.985 9 AA_G37G38:C15C16_AA A 37 ? A 16 ? A 38 ? A 15 ? 1 A G 38 1_555 A C 15 1_555 A CBV 39 1_555 A G 14 1_555 0.322 -2.289 3.118 -0.584 1.018 28.930 -4.789 -0.766 3.030 2.037 1.168 28.954 10 AA_G38CBV39:G14C15_AA A 38 ? A 15 ? A 39 ? A 14 ? 1 A CBV 39 1_555 A G 14 1_555 A G 40 1_555 A C 13 1_555 -1.048 -2.155 3.348 -3.868 0.634 34.255 -3.739 1.146 3.403 1.073 6.541 34.471 11 AA_CBV39G40:C13G14_AA A 39 ? A 14 ? A 40 ? A 13 ? 1 A G 40 1_555 A C 13 1_555 A C 41 1_555 A G 12 1_555 0.471 -1.807 3.336 6.120 3.881 22.204 -5.783 0.912 3.001 9.750 -15.374 23.342 12 AA_G40C41:G12C13_AA A 40 ? A 13 ? A 41 ? A 12 ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5NWQ _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 5NZ6 _atom_sites.fract_transf_matrix[1][1] 0.011967 _atom_sites.fract_transf_matrix[1][2] 0.006909 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013819 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010120 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol BR C H N O P # loop_