data_6E7L # _entry.id 6E7L # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.389 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6E7L pdb_00006e7l 10.2210/pdb6e7l/pdb WWPDB D_1000235861 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2019-07-31 2 'Structure model' 1 1 2019-10-16 3 'Structure model' 1 2 2019-11-13 4 'Structure model' 1 3 2019-12-11 5 'Structure model' 1 4 2024-03-13 6 'Structure model' 1 5 2024-04-03 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' 'Database references' 4 4 'Structure model' 'Author supporting evidence' 5 5 'Structure model' 'Data collection' 6 5 'Structure model' 'Database references' 7 6 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' citation 4 3 'Structure model' citation_author 5 4 'Structure model' pdbx_audit_support 6 5 'Structure model' chem_comp_atom 7 5 'Structure model' chem_comp_bond 8 5 'Structure model' database_2 9 6 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.journal_volume' 7 2 'Structure model' '_citation.page_first' 8 2 'Structure model' '_citation.page_last' 9 2 'Structure model' '_citation.pdbx_database_id_DOI' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 4 'Structure model' '_pdbx_audit_support.funding_organization' 13 5 'Structure model' '_database_2.pdbx_DOI' 14 5 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6E7L _pdbx_database_status.recvd_initial_deposition_date 2018-07-26 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Montemayor, E.J.' 1 ? 'Butcher, S.E.' 2 ? # loop_ _citation.abstract _citation.abstract_id_CAS _citation.book_id_ISBN _citation.book_publisher _citation.book_publisher_city _citation.book_title _citation.coordinate_linkage _citation.country _citation.database_id_Medline _citation.details _citation.id _citation.journal_abbrev _citation.journal_id_ASTM _citation.journal_id_CSD _citation.journal_id_ISSN _citation.journal_full _citation.journal_issue _citation.journal_volume _citation.language _citation.page_first _citation.page_last _citation.title _citation.year _citation.database_id_CSD _citation.pdbx_database_id_DOI _citation.pdbx_database_id_PubMed _citation.unpublished_flag ? ? ? ? ? ? ? US ? ? primary 'Acta Crystallogr.,Sect.F' ACSFEN ? 2053-230X ? ? 75 ? 652 656 'Structure of an RNA helix with pyrimidine mismatches and cross-strand stacking.' 2019 ? 10.1107/S2053230X19012172 31584014 ? ? ? ? ? ? ? ? US ? ? 1 'Acta Crystallogr.,Sect.F' ACSFEN ? 2053-230X ? ? 75 ? 657 662 'Structure of an RNA helix with pyrimidine mismatches and cross-strand stacking' 2019 ? 10.1107/S2053230X19012160 ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Montemayor, E.J.' 1 0000-0001-7883-7706 primary 'Virta, J.M.' 2 ? primary 'Hagler, L.D.' 3 ? primary 'Zimmerman, S.C.' 4 ? primary 'Butcher, S.E.' 5 ? 1 'Montemayor, E.J.' 6 ? 1 'Virta, J.M.' 7 ? 1 'Hagler, L.D.' 8 ? 1 'Zimmerman, S.C.' 9 ? 1 'Butcher, S.E.' 10 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*GP*GP*GP*CP*UP*GP*CP*AP*CP*UP*UP*CP*GP*GP*UP*GP*CP*UP*GP*CP*CP*C)-3') ; 7018.178 1 ? ? ? ? 2 water nat water 18.015 11 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGCUGCACUUCGGUGCUGCCC _entity_poly.pdbx_seq_one_letter_code_can GGGCUGCACUUCGGUGCUGCCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name water _pdbx_entity_nonpoly.comp_id HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 C n 1 5 U n 1 6 G n 1 7 C n 1 8 A n 1 9 C n 1 10 U n 1 11 U n 1 12 C n 1 13 G n 1 14 G n 1 15 U n 1 16 G n 1 17 C n 1 18 U n 1 19 G n 1 20 C n 1 21 C n 1 22 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 22 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 C 7 7 7 C C A . n A 1 8 A 8 8 8 A A A . n A 1 9 C 9 9 9 C C A . n A 1 10 U 10 10 10 U U A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 U 15 15 15 U U A . n A 1 16 G 16 16 16 G G A . n A 1 17 C 17 17 17 C C A . n A 1 18 U 18 18 18 U U A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 HOH 1 101 4 HOH HOH A . B 2 HOH 2 102 7 HOH HOH A . B 2 HOH 3 103 3 HOH HOH A . B 2 HOH 4 104 10 HOH HOH A . B 2 HOH 5 105 11 HOH HOH A . B 2 HOH 6 106 8 HOH HOH A . B 2 HOH 7 107 5 HOH HOH A . B 2 HOH 8 108 9 HOH HOH A . B 2 HOH 9 109 2 HOH HOH A . B 2 HOH 10 110 1 HOH HOH A . B 2 HOH 11 111 6 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.13-2998 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? 20180409 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? 0.7.1 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? 2.8.1 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 6E7L _cell.details ? _cell.formula_units_Z ? _cell.length_a 42.041 _cell.length_a_esd ? _cell.length_b 42.041 _cell.length_b_esd ? _cell.length_c 77.860 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 6E7L _symmetry.cell_setting ? _symmetry.Int_Tables_number 92 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 41 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6E7L _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.45 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 49.82 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 289 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;20 mM bis-tris pH 6.5 100 mM sodium HEPES pH 7.4 20 % PEG 3,350 20 % glycerol 10 % MPD ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment ? # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2018-03-22 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9792 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 24-ID-E' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.9792 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 24-ID-E _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 6E7L _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.59 _reflns.d_resolution_low 77.86 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 2473 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 100 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 23.7 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 20.0 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.022 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.000 _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 2.59 _reflns_shell.d_res_low 2.71 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 1.3 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 294 _reflns_shell.percent_possible_all 100 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 25.3 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.593 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.530 _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 6E7L _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.590 _refine.ls_d_res_low 36.993 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4149 _refine.ls_number_reflns_R_free 416 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.90 _refine.ls_percent_reflns_R_free 10.03 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1792 _refine.ls_R_factor_R_free 0.2102 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1757 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.98 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 'ideal A-form RNA, single stranded' _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 28.98 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.58 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 463 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.number_atoms_solvent 11 _refine_hist.number_atoms_total 474 _refine_hist.d_res_high 2.590 _refine_hist.d_res_low 36.993 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.012 ? 515 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.940 ? 801 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 9.777 ? 260 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.086 ? 109 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.015 ? 22 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.5901 2.9647 . . 138 1259 100.00 . . . 0.4601 . 0.3528 . . . . . . . . . . 'X-RAY DIFFRACTION' 2.9647 3.7347 . . 142 1222 100.00 . . . 0.2482 . 0.2154 . . . . . . . . . . 'X-RAY DIFFRACTION' 3.7347 36.9965 . . 136 1252 100.00 . . . 0.1610 . 0.1284 . . . . . . . . . . # _struct.entry_id 6E7L _struct.title 'Structure of a dimerized UUCG motif' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6E7L _struct_keywords.text 'UUCG tetraloop dimer, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6E7L _struct_ref.pdbx_db_accession 6E7L _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6E7L _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 22 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6E7L _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 22 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 22 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2200 ? 1 MORE -20 ? 1 'SSA (A^2)' 7760 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 7_375 y-2,x+2,-z 0.0000000000 1.0000000000 0.0000000000 -84.0820000000 1.0000000000 0.0000000000 0.0000000000 84.0820000000 0.0000000000 0.0000000000 -1.0000000000 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 1 A C 22 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 1 A C 22 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 1 A C 22 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 2 A C 21 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 2 A C 21 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 2 A C 21 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 3 A C 20 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 3 A C 20 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 3 A C 20 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 4 A G 19 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 4 A G 19 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 4 A G 19 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A U 18 O4 ? ? A U 5 A U 18 7_375 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog14 hydrog ? ? A U 5 O2 ? ? ? 1_555 A U 18 N3 ? ? A U 5 A U 18 7_375 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 17 N3 ? ? A G 6 A C 17 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 17 O2 ? ? A G 6 A C 17 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 17 N4 ? ? A G 6 A C 17 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 7 A G 16 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 7 A G 16 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 7 A G 16 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 15 N3 ? ? A A 8 A U 15 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 15 O4 ? ? A A 8 A U 15 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 14 N1 ? ? A C 9 A G 14 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 14 O6 ? ? A C 9 A G 14 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 9 A G 14 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 10 N3 ? ? ? 1_555 A G 13 O6 ? ? A U 10 A G 13 7_375 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog27 hydrog ? ? A U 10 O2 ? ? ? 1_555 A G 13 N1 ? ? A U 10 A G 13 7_375 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog28 hydrog ? ? A U 11 O2 ? ? ? 1_555 A C 12 N4 ? ? A U 11 A C 12 7_375 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog29 hydrog ? ? A C 12 N4 ? ? ? 1_555 A U 11 O2 ? ? A C 12 A U 11 7_375 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog30 hydrog ? ? A G 13 N1 ? ? ? 1_555 A U 10 O2 ? ? A G 13 A U 10 7_375 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog31 hydrog ? ? A G 13 O6 ? ? ? 1_555 A U 10 N3 ? ? A G 13 A U 10 7_375 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog32 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 9 N3 ? ? A G 14 A C 9 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 9 O2 ? ? A G 14 A C 9 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 9 N4 ? ? A G 14 A C 9 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 8 N1 ? ? A U 15 A A 8 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 8 N6 ? ? A U 15 A A 8 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 7 N3 ? ? A G 16 A C 7 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 7 O2 ? ? A G 16 A C 7 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 7 N4 ? ? A G 16 A C 7 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 6 N1 ? ? A C 17 A G 6 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 6 O6 ? ? A C 17 A G 6 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 6 N2 ? ? A C 17 A G 6 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A U 18 N3 ? ? ? 1_555 A U 5 O2 ? ? A U 18 A U 5 7_375 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog44 hydrog ? ? A U 18 O4 ? ? ? 1_555 A U 5 N3 ? ? A U 18 A U 5 7_375 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog45 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 4 N3 ? ? A G 19 A C 4 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 4 O2 ? ? A G 19 A C 4 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 4 N4 ? ? A G 19 A C 4 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 3 N1 ? ? A C 20 A G 3 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 3 O6 ? ? A C 20 A G 3 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 3 N2 ? ? A C 20 A G 3 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 2 N1 ? ? A C 21 A G 2 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 2 O6 ? ? A C 21 A G 2 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 2 N2 ? ? A C 21 A G 2 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 1 N1 ? ? A C 22 A G 1 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 1 O6 ? ? A C 22 A G 1 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 1 N2 ? ? A C 22 A G 1 7_375 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 1 _pdbx_validate_rmsd_bond.auth_atom_id_1 C2 _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 U _pdbx_validate_rmsd_bond.auth_seq_id_1 10 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 N3 _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 U _pdbx_validate_rmsd_bond.auth_seq_id_2 10 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.329 _pdbx_validate_rmsd_bond.bond_target_value 1.373 _pdbx_validate_rmsd_bond.bond_deviation -0.044 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.007 _pdbx_validate_rmsd_bond.linker_flag N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A U 11 ? ? "C1'" A U 11 ? ? N1 A U 11 ? ? 113.12 108.50 4.62 0.70 N 2 1 "O5'" A G 14 ? ? P A G 14 ? ? OP1 A G 14 ? ? 98.49 105.70 -7.21 0.90 N 3 1 C5 A G 14 ? ? N7 A G 14 ? ? C8 A G 14 ? ? 101.10 104.30 -3.20 0.50 N 4 1 N7 A G 14 ? ? C8 A G 14 ? ? N9 A G 14 ? ? 116.53 113.10 3.43 0.50 N 5 1 C2 A C 21 ? ? N3 A C 21 ? ? C4 A C 21 ? ? 116.56 119.90 -3.34 0.50 N 6 1 N3 A C 21 ? ? C4 A C 21 ? ? C5 A C 21 ? ? 124.53 121.90 2.63 0.40 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 U OP3 O N N 114 U P P N N 115 U OP1 O N N 116 U OP2 O N N 117 U "O5'" O N N 118 U "C5'" C N N 119 U "C4'" C N R 120 U "O4'" O N N 121 U "C3'" C N S 122 U "O3'" O N N 123 U "C2'" C N R 124 U "O2'" O N N 125 U "C1'" C N R 126 U N1 N N N 127 U C2 C N N 128 U O2 O N N 129 U N3 N N N 130 U C4 C N N 131 U O4 O N N 132 U C5 C N N 133 U C6 C N N 134 U HOP3 H N N 135 U HOP2 H N N 136 U "H5'" H N N 137 U "H5''" H N N 138 U "H4'" H N N 139 U "H3'" H N N 140 U "HO3'" H N N 141 U "H2'" H N N 142 U "HO2'" H N N 143 U "H1'" H N N 144 U H3 H N N 145 U H5 H N N 146 U H6 H N N 147 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6E7L 'double helix' 6E7L 'a-form double helix' 6E7L 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 22 7_375 0.176 -0.130 -0.178 -6.044 -11.851 -1.134 1 A_G1:C22_A A 1 ? A 22 ? 19 1 1 A G 2 1_555 A C 21 7_375 -0.053 -0.115 -0.138 -7.715 -9.823 3.669 2 A_G2:C21_A A 2 ? A 21 ? 19 1 1 A G 3 1_555 A C 20 7_375 -0.385 0.091 -0.170 -7.786 -7.732 -2.124 3 A_G3:C20_A A 3 ? A 20 ? 19 1 1 A C 4 1_555 A G 19 7_375 0.081 -0.026 0.100 -1.642 -8.522 2.866 4 A_C4:G19_A A 4 ? A 19 ? 19 1 1 A U 5 1_555 A U 18 7_375 1.911 -1.507 0.367 -1.982 -12.786 5.706 5 A_U5:U18_A A 5 ? A 18 ? 16 1 1 A G 6 1_555 A C 17 7_375 -0.439 -0.329 -0.012 1.232 -8.627 1.100 6 A_G6:C17_A A 6 ? A 17 ? 19 1 1 A C 7 1_555 A G 16 7_375 0.886 -0.586 0.013 3.101 -10.427 -0.601 7 A_C7:G16_A A 7 ? A 16 ? 19 1 1 A A 8 1_555 A U 15 7_375 -0.070 -0.163 0.304 4.959 -6.863 4.368 8 A_A8:U15_A A 8 ? A 15 ? 20 1 1 A C 9 1_555 A G 14 7_375 0.238 -0.149 0.109 2.209 -3.194 -0.581 9 A_C9:G14_A A 9 ? A 14 ? 19 1 1 A U 10 1_555 A G 13 7_375 2.471 -0.550 -0.079 8.368 -3.860 -2.958 10 A_U10:G13_A A 10 ? A 13 ? 28 1 1 A U 11 1_555 A C 12 7_375 6.624 -4.742 -0.010 21.607 1.279 -38.974 11 A_U11:C12_A A 11 ? A 12 ? ? 4 1 A C 12 1_555 A U 11 7_375 -6.624 -4.742 -0.010 -21.607 1.279 -38.974 12 A_C12:U11_A A 12 ? A 11 ? ? 4 1 A G 13 1_555 A U 10 7_375 -2.471 -0.550 -0.079 -8.368 -3.860 -2.958 13 A_G13:U10_A A 13 ? A 10 ? 28 1 1 A G 14 1_555 A C 9 7_375 -0.238 -0.149 0.109 -2.209 -3.194 -0.581 14 A_G14:C9_A A 14 ? A 9 ? 19 1 1 A U 15 1_555 A A 8 7_375 0.070 -0.163 0.304 -4.959 -6.863 4.368 15 A_U15:A8_A A 15 ? A 8 ? 20 1 1 A G 16 1_555 A C 7 7_375 -0.886 -0.586 0.013 -3.101 -10.427 -0.601 16 A_G16:C7_A A 16 ? A 7 ? 19 1 1 A C 17 1_555 A G 6 7_375 0.439 -0.329 -0.012 -1.232 -8.627 1.100 17 A_C17:G6_A A 17 ? A 6 ? 19 1 1 A U 18 1_555 A U 5 7_375 -1.911 -1.507 0.367 1.982 -12.786 5.706 18 A_U18:U5_A A 18 ? A 5 ? 16 1 1 A G 19 1_555 A C 4 7_375 -0.081 -0.026 0.100 1.642 -8.522 2.866 19 A_G19:C4_A A 19 ? A 4 ? 19 1 1 A C 20 1_555 A G 3 7_375 0.385 0.091 -0.170 7.786 -7.732 -2.124 20 A_C20:G3_A A 20 ? A 3 ? 19 1 1 A C 21 1_555 A G 2 7_375 0.053 -0.115 -0.138 7.715 -9.823 3.669 21 A_C21:G2_A A 21 ? A 2 ? 19 1 1 A C 22 1_555 A G 1 7_375 -0.176 -0.130 -0.178 6.044 -11.851 -1.134 22 A_C22:G1_A A 22 ? A 1 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 22 7_375 A G 2 1_555 A C 21 7_375 0.313 -1.532 3.227 -1.194 7.255 33.308 -3.693 -0.711 2.828 12.469 2.052 34.088 1 AA_G1G2:C21C22_AA A 1 ? A 22 ? A 2 ? A 21 ? 1 A G 2 1_555 A C 21 7_375 A G 3 1_555 A C 20 7_375 -0.543 -2.101 3.190 -0.976 11.482 28.579 -5.888 0.860 2.217 22.155 1.884 30.770 2 AA_G2G3:C20C21_AA A 2 ? A 21 ? A 3 ? A 20 ? 1 A G 3 1_555 A C 20 7_375 A C 4 1_555 A G 19 7_375 0.218 -1.108 3.150 -1.807 10.871 31.960 -3.510 -0.641 2.628 19.050 3.166 33.759 3 AA_G3C4:G19C20_AA A 3 ? A 20 ? A 4 ? A 19 ? 1 A C 4 1_555 A G 19 7_375 A U 5 1_555 A U 18 7_375 0.588 -0.955 3.249 0.628 7.702 41.997 -2.063 -0.747 3.044 10.638 -0.868 42.670 4 AA_C4U5:U18G19_AA A 4 ? A 19 ? A 5 ? A 18 ? 1 A U 5 1_555 A U 18 7_375 A G 6 1_555 A C 17 7_375 0.102 -1.433 2.922 5.272 13.864 26.394 -4.987 0.654 1.931 27.751 -10.553 30.212 5 AA_U5G6:C17U18_AA A 5 ? A 18 ? A 6 ? A 17 ? 1 A G 6 1_555 A C 17 7_375 A C 7 1_555 A G 16 7_375 -0.484 -0.982 3.242 -0.975 3.585 41.016 -1.776 0.584 3.159 5.103 1.389 41.177 6 AA_G6C7:G16C17_AA A 6 ? A 17 ? A 7 ? A 16 ? 1 A C 7 1_555 A G 16 7_375 A A 8 1_555 A U 15 7_375 -0.361 -1.695 3.005 -4.897 12.569 27.026 -5.359 -0.125 2.063 25.013 9.746 30.149 7 AA_C7A8:U15G16_AA A 7 ? A 16 ? A 8 ? A 15 ? 1 A A 8 1_555 A U 15 7_375 A C 9 1_555 A G 14 7_375 -0.472 -1.699 3.324 0.100 9.936 32.381 -4.429 0.826 2.698 17.315 -0.174 33.832 8 AA_A8C9:G14U15_AA A 8 ? A 15 ? A 9 ? A 14 ? 1 A C 9 1_555 A G 14 7_375 A U 10 1_555 A G 13 7_375 0.228 -1.548 3.130 2.008 4.780 40.439 -2.714 -0.120 2.944 6.881 -2.891 40.756 9 AA_C9U10:G13G14_AA A 9 ? A 14 ? A 10 ? A 13 ? 1 A U 10 1_555 A G 13 7_375 A U 11 1_555 A C 12 7_375 -2.654 -1.573 3.145 4.701 6.477 45.587 -2.494 3.735 2.638 8.283 -6.012 46.247 10 AA_U10U11:C12G13_AA A 10 ? A 13 ? A 11 ? A 12 ? 1 A U 11 1_555 A C 12 7_375 A C 12 1_555 A U 11 7_375 0.000 -0.080 4.307 0.000 1.010 3.135 -24.302 0.000 4.075 17.868 0.000 3.294 11 AA_U11C12:U11C12_AA A 11 ? A 12 ? A 12 ? A 11 ? 1 A C 12 1_555 A U 11 7_375 A G 13 1_555 A U 10 7_375 2.654 -1.573 3.145 -4.701 6.477 45.587 -2.494 -3.735 2.638 8.283 6.012 46.247 12 AA_C12G13:U10U11_AA A 12 ? A 11 ? A 13 ? A 10 ? 1 A G 13 1_555 A U 10 7_375 A G 14 1_555 A C 9 7_375 -0.228 -1.548 3.130 -2.008 4.780 40.439 -2.714 0.120 2.944 6.881 2.891 40.756 13 AA_G13G14:C9U10_AA A 13 ? A 10 ? A 14 ? A 9 ? 1 A G 14 1_555 A C 9 7_375 A U 15 1_555 A A 8 7_375 0.472 -1.699 3.324 -0.100 9.936 32.381 -4.429 -0.826 2.698 17.315 0.174 33.832 14 AA_G14U15:A8C9_AA A 14 ? A 9 ? A 15 ? A 8 ? 1 A U 15 1_555 A A 8 7_375 A G 16 1_555 A C 7 7_375 0.361 -1.695 3.005 4.897 12.569 27.026 -5.359 0.125 2.063 25.013 -9.746 30.149 15 AA_U15G16:C7A8_AA A 15 ? A 8 ? A 16 ? A 7 ? 1 A G 16 1_555 A C 7 7_375 A C 17 1_555 A G 6 7_375 0.484 -0.982 3.242 0.975 3.585 41.016 -1.776 -0.584 3.159 5.103 -1.389 41.177 16 AA_G16C17:G6C7_AA A 16 ? A 7 ? A 17 ? A 6 ? 1 A C 17 1_555 A G 6 7_375 A U 18 1_555 A U 5 7_375 -0.102 -1.433 2.922 -5.272 13.864 26.394 -4.987 -0.654 1.931 27.751 10.553 30.212 17 AA_C17U18:U5G6_AA A 17 ? A 6 ? A 18 ? A 5 ? 1 A U 18 1_555 A U 5 7_375 A G 19 1_555 A C 4 7_375 -0.588 -0.955 3.249 -0.628 7.702 41.997 -2.063 0.747 3.044 10.638 0.868 42.670 18 AA_U18G19:C4U5_AA A 18 ? A 5 ? A 19 ? A 4 ? 1 A G 19 1_555 A C 4 7_375 A C 20 1_555 A G 3 7_375 -0.218 -1.108 3.150 1.807 10.871 31.960 -3.510 0.641 2.628 19.050 -3.166 33.759 19 AA_G19C20:G3C4_AA A 19 ? A 4 ? A 20 ? A 3 ? 1 A C 20 1_555 A G 3 7_375 A C 21 1_555 A G 2 7_375 0.543 -2.101 3.190 0.976 11.482 28.579 -5.888 -0.860 2.217 22.155 -1.884 30.770 20 AA_C20C21:G2G3_AA A 20 ? A 3 ? A 21 ? A 2 ? 1 A C 21 1_555 A G 2 7_375 A C 22 1_555 A G 1 7_375 -0.313 -1.532 3.227 1.194 7.255 33.308 -3.693 0.711 2.828 12.469 -2.052 34.088 21 AA_C21C22:G1G2_AA A 21 ? A 2 ? A 22 ? A 1 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'R35 GM118131' 1 'National Institutes of Health/National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIH/NIAMS)' 'United States' 'R01 AR069645' 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'P41 GM103403' 3 # _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'in silico model' _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.details 'ideal A-form RNA, single stranded' # _atom_sites.entry_id 6E7L _atom_sites.fract_transf_matrix[1][1] 0.023786 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.023786 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.012844 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P # loop_