data_6OD9 # _entry.id 6OD9 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6OD9 pdb_00006od9 10.2210/pdb6od9/pdb WWPDB D_1000240436 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.details '5BTP contains the same RNA, structure solved by traditional synchrotron radiation.' _pdbx_database_related.db_id 5BTP _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6OD9 _pdbx_database_status.recvd_initial_deposition_date 2019-03-26 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Jones, C.P.' 1 ? 'Tran, B.' 2 ? ;Ferre-D'Amare, A.R. ; 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Acta Crystallogr.,Sect.F' _citation.journal_id_ASTM ACSFEN _citation.journal_id_CSD ? _citation.journal_id_ISSN 2053-230X _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 75 _citation.language ? _citation.page_first 496 _citation.page_last 500 _citation.title 'Co-crystal structure of the Fusobacterium ulcerans ZTP riboswitch using an X-ray free-electron laser.' _citation.year 2019 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1107/S2053230X19008549 _citation.pdbx_database_id_PubMed 31282869 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Jones, C.' 1 ? primary 'Tran, B.' 2 ? primary 'Conrad, C.' 3 ? primary 'Stagno, J.' 4 ? primary 'Trachman 3rd, R.' 5 ? primary 'Fischer, P.' 6 ? primary 'Meents, A.' 7 ? primary ;Ferre-D'Amare, A. ; 8 ? # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 6OD9 _cell.details ? _cell.formula_units_Z ? _cell.length_a 92.740 _cell.length_a_esd ? _cell.length_b 92.740 _cell.length_b_esd ? _cell.length_c 120.480 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 6OD9 _symmetry.cell_setting ? _symmetry.Int_Tables_number 154 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (75-MER)' 24197.434 2 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 3 non-polymer syn 'AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE' 338.211 2 ? ? ? ? 4 non-polymer syn 'POTASSIUM ION' 39.098 5 ? ? ? ? 5 non-polymer syn 'CESIUM ION' 132.905 2 ? ? ? ? 6 water nat water 18.015 6 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UAUCAGUUAUAUGACUGACGGAACGUGGAAUUAACCACAUGAAGUAUAACGAUGACAAUGCCGACCGUCUGGGCG _entity_poly.pdbx_seq_one_letter_code_can UAUCAGUUAUAUGACUGACGGAACGUGGAAUUAACCACAUGAAGUAUAACGAUGACAAUGCCGACCGUCUGGGCG _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 A n 1 3 U n 1 4 C n 1 5 A n 1 6 G n 1 7 U n 1 8 U n 1 9 A n 1 10 U n 1 11 A n 1 12 U n 1 13 G n 1 14 A n 1 15 C n 1 16 U n 1 17 G n 1 18 A n 1 19 C n 1 20 G n 1 21 G n 1 22 A n 1 23 A n 1 24 C n 1 25 G n 1 26 U n 1 27 G n 1 28 G n 1 29 A n 1 30 A n 1 31 U n 1 32 U n 1 33 A n 1 34 A n 1 35 C n 1 36 C n 1 37 A n 1 38 C n 1 39 A n 1 40 U n 1 41 G n 1 42 A n 1 43 A n 1 44 G n 1 45 U n 1 46 A n 1 47 U n 1 48 A n 1 49 A n 1 50 C n 1 51 G n 1 52 A n 1 53 U n 1 54 G n 1 55 A n 1 56 C n 1 57 A n 1 58 A n 1 59 U n 1 60 G n 1 61 C n 1 62 C n 1 63 G n 1 64 A n 1 65 C n 1 66 C n 1 67 G n 1 68 U n 1 69 C n 1 70 U n 1 71 G n 1 72 G n 1 73 G n 1 74 C n 1 75 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 75 _pdbx_entity_src_syn.organism_scientific 'Fusobacterium ulcerans' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 861 _pdbx_entity_src_syn.details 'Transcribed from T7 RNA polymerase and denaturing gel purified' # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6OD9 _struct_ref.pdbx_db_accession 6OD9 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 6OD9 A 1 ? 75 ? 6OD9 1 ? 75 ? 1 75 2 1 6OD9 B 1 ? 75 ? 6OD9 1 ? 75 ? 1 75 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 AMZ non-polymer . 'AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE' AICAR 'C9 H15 N4 O8 P' 338.211 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CS non-polymer . 'CESIUM ION' ? 'Cs 1' 132.905 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6OD9 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.09 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 60.20 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '28-32% PEG 4000, 0.2 M lithium sulfate, 0.1 M Bis-Tris-HCl, pH 7' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 293 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'CS-PAD XPP' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2018-03-20 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.303 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source 'FREE ELECTRON LASER' _diffrn_source.target ? _diffrn_source.type 'SLAC LCLS BEAMLINE MFX' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.303 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline MFX _diffrn_source.pdbx_synchrotron_site 'SLAC LCLS' # _reflns.B_iso_Wilson_estimate 100.750 _reflns.entry_id 6OD9 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 4.10 _reflns.d_resolution_low 48.2 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 9078 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.1 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.0 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 3.5 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.43 _reflns.pdbx_R_split 0.762 # _reflns_shell.d_res_high 4.10 _reflns_shell.d_res_low 4.25 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 2.0 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 492 _reflns_shell.percent_possible_all 97.8 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 7.1 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.16 _reflns_shell.pdbx_R_split 1.316 # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 220.440 _refine.B_iso_mean 83.5603 _refine.B_iso_min 11.120 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 6OD9 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 4.1020 _refine.ls_d_res_low 48.1910 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 9078 _refine.ls_number_reflns_R_free 383 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.9000 _refine.ls_percent_reflns_R_free 4.2200 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2603 _refine.ls_R_factor_R_free 0.3079 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2582 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.340 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5BTP _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 31.4500 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.6700 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 4.1020 _refine_hist.d_res_low 48.1910 _refine_hist.number_atoms_solvent 6 _refine_hist.number_atoms_total 2710 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 124 _refine_hist.pdbx_B_iso_mean_ligand 56.30 _refine_hist.pdbx_B_iso_mean_solvent 49.16 _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 2651 _refine_hist.pdbx_number_atoms_ligand 53 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.001 ? 3012 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.394 ? 4687 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.019 ? 626 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.003 ? 128 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 11.934 ? 1478 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_restr_ncs.pdbx_refine_id _refine_ls_restr_ncs.dom_id _refine_ls_restr_ncs.ncs_model_details _refine_ls_restr_ncs.rms_dev_B_iso _refine_ls_restr_ncs.rms_dev_position _refine_ls_restr_ncs.weight_B_iso _refine_ls_restr_ncs.weight_position _refine_ls_restr_ncs.pdbx_ordinal _refine_ls_restr_ncs.pdbx_type _refine_ls_restr_ncs.pdbx_asym_id _refine_ls_restr_ncs.pdbx_auth_asym_id _refine_ls_restr_ncs.pdbx_number _refine_ls_restr_ncs.pdbx_rms _refine_ls_restr_ncs.pdbx_weight _refine_ls_restr_ncs.pdbx_ens_id 'X-RAY DIFFRACTION' 1 ? ? ? ? ? 1 TORSIONAL ? A 1426 7.831 ? 1 'X-RAY DIFFRACTION' 2 ? ? ? ? ? 2 TORSIONAL ? B 1426 7.831 ? 1 # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 4.1016 4.6947 3027 . 120 2907 100.0000 . . . 0.3886 0.0000 0.3269 . . . . . . 3 . . . 'X-RAY DIFFRACTION' 4.6947 5.9132 3022 . 128 2894 100.0000 . . . 0.3036 0.0000 0.2454 . . . . . . 3 . . . 'X-RAY DIFFRACTION' 5.9132 48.1943 3029 . 135 2894 100.0000 . . . 0.2635 0.0000 0.2251 . . . . . . 3 . . . # loop_ _struct_ncs_dom.pdbx_ens_id _struct_ncs_dom.id _struct_ncs_dom.details 1 1 '(chain A and (resid 6 through 49 or resid 60 through 75))' 1 2 ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; # loop_ _struct_ncs_dom_lim.pdbx_ens_id _struct_ncs_dom_lim.dom_id _struct_ncs_dom_lim.pdbx_component_id _struct_ncs_dom_lim.beg_label_asym_id _struct_ncs_dom_lim.beg_label_comp_id _struct_ncs_dom_lim.beg_label_seq_id _struct_ncs_dom_lim.beg_label_alt_id _struct_ncs_dom_lim.end_label_asym_id _struct_ncs_dom_lim.end_label_comp_id _struct_ncs_dom_lim.end_label_seq_id _struct_ncs_dom_lim.end_label_alt_id _struct_ncs_dom_lim.beg_auth_asym_id _struct_ncs_dom_lim.beg_auth_comp_id _struct_ncs_dom_lim.beg_auth_seq_id _struct_ncs_dom_lim.end_auth_asym_id _struct_ncs_dom_lim.end_auth_comp_id _struct_ncs_dom_lim.end_auth_seq_id _struct_ncs_dom_lim.pdbx_refine_code _struct_ncs_dom_lim.selection_details 1 1 1 A G 6 . A A 49 . A G 6 A A 49 ? '(chain A and (resid 6 through 49 or resid 60 through 75))' 1 1 2 A G 60 . A G 75 . A G 60 A G 75 ? '(chain A and (resid 6 through 49 or resid 60 through 75))' 1 2 1 B G 6 . B G 6 . B G 6 B G 6 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 2 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 3 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 4 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 5 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 6 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 7 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 8 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 9 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 10 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 11 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 12 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 13 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 14 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 15 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 16 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 17 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 18 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 19 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; 1 2 20 B G 6 . B G 75 . B G 6 B G 75 ? ;(chain B and ((resid 6 and (name O5 or name C5 or name C4 or name O4 or name C3 or name O3 or name C2 or name O2 or name C1 or name N9 or name C8 or name N7 or name C5 or name C6 or name O6 or name N1 or name C2 or name N2 or name N3 or name C4 )) or resid 7 through 49 or resid 60 through 75)) ; # _struct_ncs_ens.id 1 _struct_ncs_ens.details ? # _struct.entry_id 6OD9 _struct.title 'Co-crystal structure of the Fusobacterium ulcerans ZTP riboswitch using an X-ray free-electron laser' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6OD9 _struct_keywords.text 'Complex, riboswitch, x-ray free-electron diffraction, XFEL, ZMP, ZTP, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 3 ? E N N 4 ? F N N 4 ? G N N 5 ? H N N 2 ? I N N 3 ? J N N 4 ? K N N 4 ? L N N 4 ? M N N 5 ? N N N 6 ? O N N 6 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A U 16 OP1 ? ? ? 1_555 C MG . MG ? ? A U 16 A MG 101 1_555 ? ? ? ? ? ? ? 1.991 ? ? metalc2 metalc ? ? A G 25 N7 ? ? ? 1_555 G CS . CS ? ? A G 25 A CS 105 1_555 ? ? ? ? ? ? ? 3.222 ? ? metalc3 metalc ? ? A U 31 OP1 ? ? ? 1_555 F K . K ? ? A U 31 A K 104 1_555 ? ? ? ? ? ? ? 3.493 ? ? metalc4 metalc ? ? A C 35 OP2 ? ? ? 1_555 C MG . MG ? ? A C 35 A MG 101 1_555 ? ? ? ? ? ? ? 1.996 ? ? metalc5 metalc ? ? C MG . MG ? ? ? 1_555 D AMZ . O5 ? ? A MG 101 A AMZ 102 1_555 ? ? ? ? ? ? ? 2.412 ? ? metalc6 metalc ? ? C MG . MG ? ? ? 1_555 N HOH . O ? ? A MG 101 A HOH 201 1_555 ? ? ? ? ? ? ? 2.134 ? ? metalc7 metalc ? ? C MG . MG ? ? ? 1_555 N HOH . O ? ? A MG 101 A HOH 202 1_555 ? ? ? ? ? ? ? 2.123 ? ? metalc8 metalc ? ? C MG . MG ? ? ? 1_555 N HOH . O ? ? A MG 101 A HOH 203 1_555 ? ? ? ? ? ? ? 2.121 ? ? metalc9 metalc ? ? B U 16 OP1 ? ? ? 1_555 H MG . MG ? ? B U 16 B MG 101 1_555 ? ? ? ? ? ? ? 2.025 ? ? metalc10 metalc ? ? B G 25 N7 ? ? ? 1_555 M CS . CS ? ? B G 25 B CS 106 1_555 ? ? ? ? ? ? ? 3.255 ? ? metalc11 metalc ? ? B C 35 OP2 ? ? ? 1_555 H MG . MG ? ? B C 35 B MG 101 1_555 ? ? ? ? ? ? ? 2.251 ? ? metalc12 metalc ? ? H MG . MG ? ? ? 1_555 I AMZ . O5 ? ? B MG 101 B AMZ 102 1_555 ? ? ? ? ? ? ? 2.023 ? ? metalc13 metalc ? ? H MG . MG ? ? ? 1_555 O HOH . O ? ? B MG 101 B HOH 201 1_555 ? ? ? ? ? ? ? 2.207 ? ? metalc14 metalc ? ? H MG . MG ? ? ? 1_555 O HOH . O ? ? B MG 101 B HOH 202 1_555 ? ? ? ? ? ? ? 2.270 ? ? metalc15 metalc ? ? H MG . MG ? ? ? 1_555 O HOH . O ? ? B MG 101 B HOH 203 1_555 ? ? ? ? ? ? ? 2.055 ? ? hydrog1 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 50 N3 ? ? A G 6 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 50 O2 ? ? A G 6 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 50 N4 ? ? A G 6 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 49 N1 ? ? A U 7 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 49 N6 ? ? A U 7 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 48 N1 ? ? A U 8 A A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 48 N6 ? ? A U 8 A A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 47 N3 ? ? A A 9 A U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 47 O4 ? ? A A 9 A U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 46 N1 ? ? A U 10 A A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 10 O4 ? ? ? 1_555 A A 46 N6 ? ? A U 10 A A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 45 N3 ? ? A A 11 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 45 O4 ? ? A A 11 A U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 12 N3 ? ? ? 1_555 A G 44 O6 ? ? A U 12 A G 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A U 12 O2 ? ? ? 1_555 A G 44 N1 ? ? A U 12 A G 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog16 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 43 N7 ? ? A G 13 A A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog17 hydrog ? ? A G 13 N3 ? ? ? 1_555 A A 43 N6 ? ? A G 13 A A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog18 hydrog ? ? A A 14 N6 ? ? ? 1_555 A A 42 N3 ? ? A A 14 A A 42 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog19 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 41 N1 ? ? A C 15 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 41 O6 ? ? A C 15 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 41 N2 ? ? A C 15 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 16 N3 ? ? ? 1_555 A U 40 O4 ? ? A U 16 A U 40 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog23 hydrog ? ? A U 16 O2 ? ? ? 1_555 A U 40 N3 ? ? A U 16 A U 40 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog24 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 69 N3 ? ? A G 17 A C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 69 O2 ? ? A G 17 A C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 69 N4 ? ? A G 17 A C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 18 N1 ? ? ? 1_555 A U 68 N3 ? ? A A 18 A U 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 18 N6 ? ? ? 1_555 A U 68 O4 ? ? A A 18 A U 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 19 N3 ? ? ? 1_555 A G 67 N1 ? ? A C 19 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 19 N4 ? ? ? 1_555 A G 67 O6 ? ? A C 19 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 67 N2 ? ? A C 19 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 66 N3 ? ? A G 20 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 66 O2 ? ? A G 20 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 66 N4 ? ? A G 20 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 65 N3 ? ? A G 21 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 65 O2 ? ? A G 21 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 65 N4 ? ? A G 21 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 23 N3 ? ? ? 1_555 B A 64 N6 ? ? A A 23 B A 64 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog39 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 25 A C 38 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog40 hydrog ? ? A U 26 N3 ? ? ? 1_555 A A 37 N1 ? ? A U 26 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 26 O4 ? ? ? 1_555 A A 37 N6 ? ? A U 26 A A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 27 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 27 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 27 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 28 A C 35 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog46 hydrog ? ? A A 43 N3 ? ? ? 1_555 A G 73 N2 ? ? A A 43 A G 73 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog47 hydrog ? ? A G 60 N1 ? ? ? 1_555 A C 74 N3 ? ? A G 60 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 60 N2 ? ? ? 1_555 A C 74 O2 ? ? A G 60 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 60 O6 ? ? ? 1_555 A C 74 N4 ? ? A G 60 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 61 N3 ? ? ? 1_555 A G 73 N1 ? ? A C 61 A G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 61 N4 ? ? ? 1_555 A G 73 O6 ? ? A C 61 A G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 61 O2 ? ? ? 1_555 A G 73 N2 ? ? A C 61 A G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 62 N3 ? ? ? 1_555 A G 72 N1 ? ? A C 62 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 62 N4 ? ? ? 1_555 A G 72 O6 ? ? A C 62 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 62 O2 ? ? ? 1_555 A G 72 N2 ? ? A C 62 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 63 O6 ? ? ? 1_555 A G 72 N1 ? ? A G 63 A G 72 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog57 hydrog ? ? A A 64 N6 ? ? ? 1_555 B A 23 N3 ? ? A A 64 B A 23 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog58 hydrog ? ? B U 7 O4 ? ? ? 1_555 B A 48 N6 ? ? B U 7 B A 48 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog59 hydrog ? ? B U 8 N3 ? ? ? 1_555 B A 48 N1 ? ? B U 8 B A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? B U 8 O4 ? ? ? 1_555 B A 48 N6 ? ? B U 8 B A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B A 9 N1 ? ? ? 1_555 B U 47 N3 ? ? B A 9 B U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B A 9 N6 ? ? ? 1_555 B U 47 O4 ? ? B A 9 B U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B U 10 N3 ? ? ? 1_555 B A 46 N1 ? ? B U 10 B A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? B U 10 O4 ? ? ? 1_555 B A 46 N6 ? ? B U 10 B A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? B A 11 N1 ? ? ? 1_555 B U 45 N3 ? ? B A 11 B U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? B A 11 N6 ? ? ? 1_555 B U 45 O4 ? ? B A 11 B U 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? B U 12 N3 ? ? ? 1_555 B G 44 O6 ? ? B U 12 B G 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog68 hydrog ? ? B U 12 O2 ? ? ? 1_555 B G 44 N1 ? ? B U 12 B G 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog69 hydrog ? ? B G 13 N2 ? ? ? 1_555 B A 43 N7 ? ? B G 13 B A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog70 hydrog ? ? B G 13 N3 ? ? ? 1_555 B A 43 N6 ? ? B G 13 B A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog71 hydrog ? ? B A 14 N6 ? ? ? 1_555 B A 42 N3 ? ? B A 14 B A 42 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog72 hydrog ? ? B C 15 N3 ? ? ? 1_555 B G 41 N1 ? ? B C 15 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? B C 15 N4 ? ? ? 1_555 B G 41 O6 ? ? B C 15 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? B C 15 O2 ? ? ? 1_555 B G 41 N2 ? ? B C 15 B G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? B U 16 N3 ? ? ? 1_555 B U 40 O4 ? ? B U 16 B U 40 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog76 hydrog ? ? B U 16 O2 ? ? ? 1_555 B U 40 N3 ? ? B U 16 B U 40 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog77 hydrog ? ? B G 17 N1 ? ? ? 1_555 B C 69 N3 ? ? B G 17 B C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? B G 17 N2 ? ? ? 1_555 B C 69 O2 ? ? B G 17 B C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? B G 17 O6 ? ? ? 1_555 B C 69 N4 ? ? B G 17 B C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B A 18 N1 ? ? ? 1_555 B U 68 N3 ? ? B A 18 B U 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B A 18 N6 ? ? ? 1_555 B U 68 O4 ? ? B A 18 B U 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B C 19 N3 ? ? ? 1_555 B G 67 N1 ? ? B C 19 B G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B C 19 N4 ? ? ? 1_555 B G 67 O6 ? ? B C 19 B G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? B C 19 O2 ? ? ? 1_555 B G 67 N2 ? ? B C 19 B G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? B G 20 N1 ? ? ? 1_555 B C 66 N3 ? ? B G 20 B C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? B G 20 N2 ? ? ? 1_555 B C 66 O2 ? ? B G 20 B C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B G 20 O6 ? ? ? 1_555 B C 66 N4 ? ? B G 20 B C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B G 21 N1 ? ? ? 1_555 B C 65 N3 ? ? B G 21 B C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B G 21 N2 ? ? ? 1_555 B C 65 O2 ? ? B G 21 B C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? B G 21 O6 ? ? ? 1_555 B C 65 N4 ? ? B G 21 B C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? B G 25 N2 ? ? ? 1_555 B C 38 O2 ? ? B G 25 B C 38 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog92 hydrog ? ? B U 26 N3 ? ? ? 1_555 B A 37 N1 ? ? B U 26 B A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? B U 26 O4 ? ? ? 1_555 B A 37 N6 ? ? B U 26 B A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? B G 27 N1 ? ? ? 1_555 B C 36 N3 ? ? B G 27 B C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? B G 27 N2 ? ? ? 1_555 B C 36 O2 ? ? B G 27 B C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? B G 27 O6 ? ? ? 1_555 B C 36 N4 ? ? B G 27 B C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? B G 28 N2 ? ? ? 1_555 B C 35 O2 ? ? B G 28 B C 35 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog98 hydrog ? ? B U 59 O4 ? ? ? 1_555 B G 75 N1 ? ? B U 59 B G 75 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog99 hydrog ? ? B G 60 N1 ? ? ? 1_555 B C 74 N3 ? ? B G 60 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? B G 60 N2 ? ? ? 1_555 B C 74 O2 ? ? B G 60 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? B G 60 O6 ? ? ? 1_555 B C 74 N4 ? ? B G 60 B C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? B C 61 N3 ? ? ? 1_555 B G 73 N1 ? ? B C 61 B G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? B C 61 N4 ? ? ? 1_555 B G 73 O6 ? ? B C 61 B G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? B C 61 O2 ? ? ? 1_555 B G 73 N2 ? ? B C 61 B G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? B C 62 N3 ? ? ? 1_555 B G 72 N1 ? ? B C 62 B G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? B C 62 N4 ? ? ? 1_555 B G 72 O6 ? ? B C 62 B G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? B C 62 O2 ? ? ? 1_555 B G 72 N2 ? ? B C 62 B G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? B G 63 O6 ? ? ? 1_555 B G 71 N2 ? ? B G 63 B G 71 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog109 hydrog ? ? B G 63 O6 ? ? ? 1_555 B G 72 N1 ? ? B G 63 B G 72 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A MG 101 ? 6 'binding site for residue MG A 101' AC2 Software A AMZ 102 ? 10 'binding site for residue AMZ A 102' AC3 Software A K 103 ? 1 'binding site for residue K A 103' AC4 Software A K 104 ? 1 'binding site for residue K A 104' AC5 Software A CS 105 ? 1 'binding site for residue CS A 105' AC6 Software B MG 101 ? 6 'binding site for residue MG B 101' AC7 Software B AMZ 102 ? 9 'binding site for residue AMZ B 102' AC8 Software B CS 106 ? 1 'binding site for residue CS B 106' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 6 U A 16 ? U A 16 . ? 1_555 ? 2 AC1 6 C A 35 ? C A 35 . ? 1_555 ? 3 AC1 6 AMZ D . ? AMZ A 102 . ? 1_555 ? 4 AC1 6 HOH N . ? HOH A 201 . ? 1_555 ? 5 AC1 6 HOH N . ? HOH A 202 . ? 1_555 ? 6 AC1 6 HOH N . ? HOH A 203 . ? 1_555 ? 7 AC2 10 U A 16 ? U A 16 . ? 1_555 ? 8 AC2 10 G A 17 ? G A 17 . ? 1_555 ? 9 AC2 10 A A 34 ? A A 34 . ? 1_555 ? 10 AC2 10 C A 35 ? C A 35 . ? 1_555 ? 11 AC2 10 G A 63 ? G A 63 . ? 1_555 ? 12 AC2 10 C A 69 ? C A 69 . ? 1_555 ? 13 AC2 10 U A 70 ? U A 70 . ? 1_555 ? 14 AC2 10 G A 71 ? G A 71 . ? 1_555 ? 15 AC2 10 MG C . ? MG A 101 . ? 1_555 ? 16 AC2 10 HOH N . ? HOH A 202 . ? 1_555 ? 17 AC3 1 A B 23 ? A B 23 . ? 1_555 ? 18 AC4 1 U A 31 ? U A 31 . ? 1_555 ? 19 AC5 1 G A 25 ? G A 25 . ? 1_555 ? 20 AC6 6 U B 16 ? U B 16 . ? 1_555 ? 21 AC6 6 C B 35 ? C B 35 . ? 1_555 ? 22 AC6 6 AMZ I . ? AMZ B 102 . ? 1_555 ? 23 AC6 6 HOH O . ? HOH B 201 . ? 1_555 ? 24 AC6 6 HOH O . ? HOH B 202 . ? 1_555 ? 25 AC6 6 HOH O . ? HOH B 203 . ? 1_555 ? 26 AC7 9 U B 16 ? U B 16 . ? 1_555 ? 27 AC7 9 G B 17 ? G B 17 . ? 1_555 ? 28 AC7 9 A B 34 ? A B 34 . ? 1_555 ? 29 AC7 9 C B 35 ? C B 35 . ? 1_555 ? 30 AC7 9 G B 63 ? G B 63 . ? 1_555 ? 31 AC7 9 U B 70 ? U B 70 . ? 1_555 ? 32 AC7 9 G B 71 ? G B 71 . ? 1_555 ? 33 AC7 9 MG H . ? MG B 101 . ? 1_555 ? 34 AC7 9 HOH O . ? HOH B 202 . ? 1_555 ? 35 AC8 1 G B 25 ? G B 25 . ? 1_555 ? # _atom_sites.entry_id 6OD9 _atom_sites.fract_transf_matrix[1][1] 0.010783 _atom_sites.fract_transf_matrix[1][2] 0.006225 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.012451 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.008300 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 # loop_ _atom_type.symbol C CS K MG N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 1 ? ? ? A . n A 1 2 A 2 2 ? ? ? A . n A 1 3 U 3 3 ? ? ? A . n A 1 4 C 4 4 ? ? ? A . n A 1 5 A 5 5 ? ? ? A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 U 8 8 8 U U A . n A 1 9 A 9 9 9 A A A . n A 1 10 U 10 10 10 U U A . n A 1 11 A 11 11 11 A A A . n A 1 12 U 12 12 12 U U A . n A 1 13 G 13 13 13 G G A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 U 16 16 16 U U A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 C 19 19 19 C C A . n A 1 20 G 20 20 20 G G A . n A 1 21 G 21 21 21 G G A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 C 24 24 24 C C A . n A 1 25 G 25 25 25 G G A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 A 29 29 29 A A A . n A 1 30 A 30 30 30 A A A . n A 1 31 U 31 31 31 U U A . n A 1 32 U 32 32 32 U U A . n A 1 33 A 33 33 33 A A A . n A 1 34 A 34 34 34 A A A . n A 1 35 C 35 35 35 C C A . n A 1 36 C 36 36 36 C C A . n A 1 37 A 37 37 37 A A A . n A 1 38 C 38 38 38 C C A . n A 1 39 A 39 39 39 A A A . n A 1 40 U 40 40 40 U U A . n A 1 41 G 41 41 41 G G A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 G 44 44 44 G G A . n A 1 45 U 45 45 45 U U A . n A 1 46 A 46 46 46 A A A . n A 1 47 U 47 47 47 U U A . n A 1 48 A 48 48 48 A A A . n A 1 49 A 49 49 49 A A A . n A 1 50 C 50 50 50 C C A . n A 1 51 G 51 51 51 G G A . n A 1 52 A 52 52 ? ? ? A . n A 1 53 U 53 53 ? ? ? A . n A 1 54 G 54 54 ? ? ? A . n A 1 55 A 55 55 ? ? ? A . n A 1 56 C 56 56 ? ? ? A . n A 1 57 A 57 57 ? ? ? A . n A 1 58 A 58 58 ? ? ? A . n A 1 59 U 59 59 ? ? ? A . n A 1 60 G 60 60 60 G G A . n A 1 61 C 61 61 61 C C A . n A 1 62 C 62 62 62 C C A . n A 1 63 G 63 63 63 G G A . n A 1 64 A 64 64 64 A A A . n A 1 65 C 65 65 65 C C A . n A 1 66 C 66 66 66 C C A . n A 1 67 G 67 67 67 G G A . n A 1 68 U 68 68 68 U U A . n A 1 69 C 69 69 69 C C A . n A 1 70 U 70 70 70 U U A . n A 1 71 G 71 71 71 G G A . n A 1 72 G 72 72 72 G G A . n A 1 73 G 73 73 73 G G A . n A 1 74 C 74 74 74 C C A . n A 1 75 G 75 75 75 G G A . n B 1 1 U 1 1 ? ? ? B . n B 1 2 A 2 2 ? ? ? B . n B 1 3 U 3 3 ? ? ? B . n B 1 4 C 4 4 ? ? ? B . n B 1 5 A 5 5 ? ? ? B . n B 1 6 G 6 6 6 G G B . n B 1 7 U 7 7 7 U U B . n B 1 8 U 8 8 8 U U B . n B 1 9 A 9 9 9 A A B . n B 1 10 U 10 10 10 U U B . n B 1 11 A 11 11 11 A A B . n B 1 12 U 12 12 12 U U B . n B 1 13 G 13 13 13 G G B . n B 1 14 A 14 14 14 A A B . n B 1 15 C 15 15 15 C C B . n B 1 16 U 16 16 16 U U B . n B 1 17 G 17 17 17 G G B . n B 1 18 A 18 18 18 A A B . n B 1 19 C 19 19 19 C C B . n B 1 20 G 20 20 20 G G B . n B 1 21 G 21 21 21 G G B . n B 1 22 A 22 22 22 A A B . n B 1 23 A 23 23 23 A A B . n B 1 24 C 24 24 24 C C B . n B 1 25 G 25 25 25 G G B . n B 1 26 U 26 26 26 U U B . n B 1 27 G 27 27 27 G G B . n B 1 28 G 28 28 28 G G B . n B 1 29 A 29 29 29 A A B . n B 1 30 A 30 30 30 A A B . n B 1 31 U 31 31 31 U U B . n B 1 32 U 32 32 32 U U B . n B 1 33 A 33 33 33 A A B . n B 1 34 A 34 34 34 A A B . n B 1 35 C 35 35 35 C C B . n B 1 36 C 36 36 36 C C B . n B 1 37 A 37 37 37 A A B . n B 1 38 C 38 38 38 C C B . n B 1 39 A 39 39 39 A A B . n B 1 40 U 40 40 40 U U B . n B 1 41 G 41 41 41 G G B . n B 1 42 A 42 42 42 A A B . n B 1 43 A 43 43 43 A A B . n B 1 44 G 44 44 44 G G B . n B 1 45 U 45 45 45 U U B . n B 1 46 A 46 46 46 A A B . n B 1 47 U 47 47 47 U U B . n B 1 48 A 48 48 48 A A B . n B 1 49 A 49 49 49 A A B . n B 1 50 C 50 50 50 C C B . n B 1 51 G 51 51 ? ? ? B . n B 1 52 A 52 52 ? ? ? B . n B 1 53 U 53 53 ? ? ? B . n B 1 54 G 54 54 ? ? ? B . n B 1 55 A 55 55 ? ? ? B . n B 1 56 C 56 56 ? ? ? B . n B 1 57 A 57 57 ? ? ? B . n B 1 58 A 58 58 ? ? ? B . n B 1 59 U 59 59 59 U U B . n B 1 60 G 60 60 60 G G B . n B 1 61 C 61 61 61 C C B . n B 1 62 C 62 62 62 C C B . n B 1 63 G 63 63 63 G G B . n B 1 64 A 64 64 64 A A B . n B 1 65 C 65 65 65 C C B . n B 1 66 C 66 66 66 C C B . n B 1 67 G 67 67 67 G G B . n B 1 68 U 68 68 68 U U B . n B 1 69 C 69 69 69 C C B . n B 1 70 U 70 70 70 U U B . n B 1 71 G 71 71 71 G G B . n B 1 72 G 72 72 72 G G B . n B 1 73 G 73 73 73 G G B . n B 1 74 C 74 74 74 C C B . n B 1 75 G 75 75 75 G G B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 MG 1 101 1 MG MG A . D 3 AMZ 1 102 2 AMZ AMZ A . E 4 K 1 103 4 K K A . F 4 K 1 104 5 K K A . G 5 CS 1 105 2 CS CS A . H 2 MG 1 101 2 MG MG B . I 3 AMZ 1 102 1 AMZ AMZ B . J 4 K 1 103 1 K K B . K 4 K 1 104 2 K K B . L 4 K 1 105 3 K K B . M 5 CS 1 106 1 CS CS B . N 6 HOH 1 201 2 HOH HOH A . N 6 HOH 2 202 1 HOH HOH A . N 6 HOH 3 203 3 HOH HOH A . O 6 HOH 1 201 4 HOH HOH B . O 6 HOH 2 202 5 HOH HOH B . O 6 HOH 3 203 6 HOH HOH B . # loop_ _pdbx_struct_assembly.id _pdbx_struct_assembly.details _pdbx_struct_assembly.method_details _pdbx_struct_assembly.oligomeric_details _pdbx_struct_assembly.oligomeric_count 1 author_defined_assembly ? monomeric 1 2 author_defined_assembly ? monomeric 1 # loop_ _pdbx_struct_assembly_gen.assembly_id _pdbx_struct_assembly_gen.oper_expression _pdbx_struct_assembly_gen.asym_id_list 1 1 A,C,D,E,F,G,N 2 1 B,H,I,J,K,L,M,O # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A U 16 ? A U 16 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 OP2 ? A C 35 ? A C 35 ? 1_555 151.6 ? 2 OP1 ? A U 16 ? A U 16 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O5 ? D AMZ . ? A AMZ 102 ? 1_555 76.8 ? 3 OP2 ? A C 35 ? A C 35 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O5 ? D AMZ . ? A AMZ 102 ? 1_555 87.6 ? 4 OP1 ? A U 16 ? A U 16 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 201 ? 1_555 76.1 ? 5 OP2 ? A C 35 ? A C 35 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 201 ? 1_555 79.8 ? 6 O5 ? D AMZ . ? A AMZ 102 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 201 ? 1_555 87.7 ? 7 OP1 ? A U 16 ? A U 16 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 202 ? 1_555 85.9 ? 8 OP2 ? A C 35 ? A C 35 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 202 ? 1_555 113.2 ? 9 O5 ? D AMZ . ? A AMZ 102 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 202 ? 1_555 75.4 ? 10 O ? N HOH . ? A HOH 201 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 202 ? 1_555 157.8 ? 11 OP1 ? A U 16 ? A U 16 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 203 ? 1_555 95.5 ? 12 OP2 ? A C 35 ? A C 35 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 203 ? 1_555 103.4 ? 13 O5 ? D AMZ . ? A AMZ 102 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 203 ? 1_555 167.3 ? 14 O ? N HOH . ? A HOH 201 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 203 ? 1_555 100.3 ? 15 O ? N HOH . ? A HOH 202 ? 1_555 MG ? C MG . ? A MG 101 ? 1_555 O ? N HOH . ? A HOH 203 ? 1_555 94.2 ? 16 OP1 ? B U 16 ? B U 16 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 OP2 ? B C 35 ? B C 35 ? 1_555 143.6 ? 17 OP1 ? B U 16 ? B U 16 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O5 ? I AMZ . ? B AMZ 102 ? 1_555 88.0 ? 18 OP2 ? B C 35 ? B C 35 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O5 ? I AMZ . ? B AMZ 102 ? 1_555 99.9 ? 19 OP1 ? B U 16 ? B U 16 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 201 ? 1_555 65.2 ? 20 OP2 ? B C 35 ? B C 35 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 201 ? 1_555 82.7 ? 21 O5 ? I AMZ . ? B AMZ 102 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 201 ? 1_555 128.5 ? 22 OP1 ? B U 16 ? B U 16 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 202 ? 1_555 70.6 ? 23 OP2 ? B C 35 ? B C 35 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 202 ? 1_555 80.4 ? 24 O5 ? I AMZ . ? B AMZ 102 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 202 ? 1_555 65.6 ? 25 O ? O HOH . ? B HOH 201 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 202 ? 1_555 64.2 ? 26 OP1 ? B U 16 ? B U 16 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 203 ? 1_555 124.0 ? 27 OP2 ? B C 35 ? B C 35 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 203 ? 1_555 75.3 ? 28 O5 ? I AMZ . ? B AMZ 102 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 203 ? 1_555 132.6 ? 29 O ? O HOH . ? B HOH 201 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 203 ? 1_555 98.2 ? 30 O ? O HOH . ? B HOH 202 ? 1_555 MG ? H MG . ? B MG 101 ? 1_555 O ? O HOH . ? B HOH 203 ? 1_555 151.8 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2019-07-17 2 'Structure model' 1 1 2019-07-24 3 'Structure model' 1 2 2023-10-11 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' 'Data collection' 4 3 'Structure model' 'Database references' 5 3 'Structure model' 'Derived calculations' 6 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' database_2 6 3 'Structure model' pdbx_initial_refinement_model 7 3 'Structure model' pdbx_struct_conn_angle 8 3 'Structure model' struct_conn 9 3 'Structure model' struct_ncs_dom_lim # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.pdbx_database_id_PubMed' 5 2 'Structure model' '_citation.title' 6 2 'Structure model' '_citation_author.identifier_ORCID' 7 2 'Structure model' '_citation_author.name' 8 3 'Structure model' '_database_2.pdbx_DOI' 9 3 'Structure model' '_database_2.pdbx_database_accession' 10 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_comp_id' 11 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id' 12 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_asym_id' 13 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_atom_id' 14 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_comp_id' 15 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_comp_id' 16 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id' 17 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_asym_id' 18 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_atom_id' 19 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_comp_id' 20 3 'Structure model' '_pdbx_struct_conn_angle.value' 21 3 'Structure model' '_struct_conn.pdbx_dist_value' 22 3 'Structure model' '_struct_conn.ptnr1_auth_asym_id' 23 3 'Structure model' '_struct_conn.ptnr1_auth_comp_id' 24 3 'Structure model' '_struct_conn.ptnr1_auth_seq_id' 25 3 'Structure model' '_struct_conn.ptnr1_label_asym_id' 26 3 'Structure model' '_struct_conn.ptnr1_label_atom_id' 27 3 'Structure model' '_struct_conn.ptnr1_label_comp_id' 28 3 'Structure model' '_struct_conn.ptnr1_label_seq_id' 29 3 'Structure model' '_struct_conn.ptnr2_auth_asym_id' 30 3 'Structure model' '_struct_conn.ptnr2_auth_comp_id' 31 3 'Structure model' '_struct_conn.ptnr2_auth_seq_id' 32 3 'Structure model' '_struct_conn.ptnr2_label_asym_id' 33 3 'Structure model' '_struct_conn.ptnr2_label_atom_id' 34 3 'Structure model' '_struct_conn.ptnr2_label_comp_id' 35 3 'Structure model' '_struct_ncs_dom_lim.beg_auth_comp_id' 36 3 'Structure model' '_struct_ncs_dom_lim.beg_label_asym_id' 37 3 'Structure model' '_struct_ncs_dom_lim.beg_label_comp_id' 38 3 'Structure model' '_struct_ncs_dom_lim.beg_label_seq_id' 39 3 'Structure model' '_struct_ncs_dom_lim.end_auth_comp_id' 40 3 'Structure model' '_struct_ncs_dom_lim.end_label_asym_id' 41 3 'Structure model' '_struct_ncs_dom_lim.end_label_comp_id' 42 3 'Structure model' '_struct_ncs_dom_lim.end_label_seq_id' # _pdbx_phasing_MR.entry_id 6OD9 _pdbx_phasing_MR.method_rotation ? _pdbx_phasing_MR.method_translation ? _pdbx_phasing_MR.model_details ? _pdbx_phasing_MR.R_factor ? _pdbx_phasing_MR.R_rigid_body ? _pdbx_phasing_MR.correlation_coeff_Fo_to_Fc ? _pdbx_phasing_MR.correlation_coeff_Io_to_Ic ? _pdbx_phasing_MR.d_res_high_rotation 4.100 _pdbx_phasing_MR.d_res_low_rotation 48.190 _pdbx_phasing_MR.d_res_high_translation 4.100 _pdbx_phasing_MR.d_res_low_translation 48.190 _pdbx_phasing_MR.packing ? _pdbx_phasing_MR.reflns_percent_rotation ? _pdbx_phasing_MR.reflns_percent_translation ? _pdbx_phasing_MR.sigma_F_rotation ? _pdbx_phasing_MR.sigma_F_translation ? _pdbx_phasing_MR.sigma_I_rotation ? _pdbx_phasing_MR.sigma_I_translation ? # _phasing.method MR # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? 2.8.0 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.24 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? CrystFEL ? ? ? . 4 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? CrystFEL ? ? ? . 5 # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 6 ? P ? A G 6 P 2 1 Y 1 A G 6 ? OP1 ? A G 6 OP1 3 1 Y 1 A G 6 ? OP2 ? A G 6 OP2 4 1 Y 1 B U 59 ? P ? B U 59 P 5 1 Y 1 B U 59 ? OP1 ? B U 59 OP1 6 1 Y 1 B U 59 ? OP2 ? B U 59 OP2 # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A U 1 ? A U 1 2 1 Y 1 A A 2 ? A A 2 3 1 Y 1 A U 3 ? A U 3 4 1 Y 1 A C 4 ? A C 4 5 1 Y 1 A A 5 ? A A 5 6 1 Y 1 A A 52 ? A A 52 7 1 Y 1 A U 53 ? A U 53 8 1 Y 1 A G 54 ? A G 54 9 1 Y 1 A A 55 ? A A 55 10 1 Y 1 A C 56 ? A C 56 11 1 Y 1 A A 57 ? A A 57 12 1 Y 1 A A 58 ? A A 58 13 1 Y 1 A U 59 ? A U 59 14 1 Y 1 B U 1 ? B U 1 15 1 Y 1 B A 2 ? B A 2 16 1 Y 1 B U 3 ? B U 3 17 1 Y 1 B C 4 ? B C 4 18 1 Y 1 B A 5 ? B A 5 19 1 Y 1 B G 51 ? B G 51 20 1 Y 1 B A 52 ? B A 52 21 1 Y 1 B U 53 ? B U 53 22 1 Y 1 B G 54 ? B G 54 23 1 Y 1 B A 55 ? B A 55 24 1 Y 1 B C 56 ? B C 56 25 1 Y 1 B A 57 ? B A 57 26 1 Y 1 B A 58 ? B A 58 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 AMZ O5 O N N 38 AMZ C6 C N N 39 AMZ N2 N N N 40 AMZ C3A C Y N 41 AMZ C7A C Y N 42 AMZ N3 N N N 43 AMZ N1 N Y N 44 AMZ C5 C Y N 45 AMZ N N Y N 46 AMZ C1 C N R 47 AMZ C2 C N R 48 AMZ C3 C N S 49 AMZ O2 O N N 50 AMZ O1 O N N 51 AMZ O O N N 52 AMZ C C N R 53 AMZ C4 C N N 54 AMZ O3 O N N 55 AMZ P P N N 56 AMZ OP1 O N N 57 AMZ O4 O N N 58 AMZ OP2 O N N 59 AMZ H11 H N N 60 AMZ H12 H N N 61 AMZ H9 H N N 62 AMZ H10 H N N 63 AMZ H13 H N N 64 AMZ H2 H N N 65 AMZ H3 H N N 66 AMZ H4 H N N 67 AMZ H5 H N N 68 AMZ H1 H N N 69 AMZ H6 H N N 70 AMZ H7 H N N 71 AMZ H8 H N N 72 AMZ H15 H N N 73 AMZ H14 H N N 74 C OP3 O N N 75 C P P N N 76 C OP1 O N N 77 C OP2 O N N 78 C "O5'" O N N 79 C "C5'" C N N 80 C "C4'" C N R 81 C "O4'" O N N 82 C "C3'" C N S 83 C "O3'" O N N 84 C "C2'" C N R 85 C "O2'" O N N 86 C "C1'" C N R 87 C N1 N N N 88 C C2 C N N 89 C O2 O N N 90 C N3 N N N 91 C C4 C N N 92 C N4 N N N 93 C C5 C N N 94 C C6 C N N 95 C HOP3 H N N 96 C HOP2 H N N 97 C "H5'" H N N 98 C "H5''" H N N 99 C "H4'" H N N 100 C "H3'" H N N 101 C "HO3'" H N N 102 C "H2'" H N N 103 C "HO2'" H N N 104 C "H1'" H N N 105 C H41 H N N 106 C H42 H N N 107 C H5 H N N 108 C H6 H N N 109 CS CS CS N N 110 G OP3 O N N 111 G P P N N 112 G OP1 O N N 113 G OP2 O N N 114 G "O5'" O N N 115 G "C5'" C N N 116 G "C4'" C N R 117 G "O4'" O N N 118 G "C3'" C N S 119 G "O3'" O N N 120 G "C2'" C N R 121 G "O2'" O N N 122 G "C1'" C N R 123 G N9 N Y N 124 G C8 C Y N 125 G N7 N Y N 126 G C5 C Y N 127 G C6 C N N 128 G O6 O N N 129 G N1 N N N 130 G C2 C N N 131 G N2 N N N 132 G N3 N N N 133 G C4 C Y N 134 G HOP3 H N N 135 G HOP2 H N N 136 G "H5'" H N N 137 G "H5''" H N N 138 G "H4'" H N N 139 G "H3'" H N N 140 G "HO3'" H N N 141 G "H2'" H N N 142 G "HO2'" H N N 143 G "H1'" H N N 144 G H8 H N N 145 G H1 H N N 146 G H21 H N N 147 G H22 H N N 148 HOH O O N N 149 HOH H1 H N N 150 HOH H2 H N N 151 K K K N N 152 MG MG MG N N 153 U OP3 O N N 154 U P P N N 155 U OP1 O N N 156 U OP2 O N N 157 U "O5'" O N N 158 U "C5'" C N N 159 U "C4'" C N R 160 U "O4'" O N N 161 U "C3'" C N S 162 U "O3'" O N N 163 U "C2'" C N R 164 U "O2'" O N N 165 U "C1'" C N R 166 U N1 N N N 167 U C2 C N N 168 U O2 O N N 169 U N3 N N N 170 U C4 C N N 171 U O4 O N N 172 U C5 C N N 173 U C6 C N N 174 U HOP3 H N N 175 U HOP2 H N N 176 U "H5'" H N N 177 U "H5''" H N N 178 U "H4'" H N N 179 U "H3'" H N N 180 U "HO3'" H N N 181 U "H2'" H N N 182 U "HO2'" H N N 183 U "H1'" H N N 184 U H3 H N N 185 U H5 H N N 186 U H6 H N N 187 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 AMZ O5 C6 doub N N 40 AMZ C6 N2 sing N N 41 AMZ C6 C3A sing N N 42 AMZ N2 H11 sing N N 43 AMZ N2 H12 sing N N 44 AMZ C3A C7A doub Y N 45 AMZ C3A N1 sing Y N 46 AMZ C7A N3 sing N N 47 AMZ C7A N sing Y N 48 AMZ N3 H9 sing N N 49 AMZ N3 H10 sing N N 50 AMZ N1 C5 doub Y N 51 AMZ C5 N sing Y N 52 AMZ C5 H13 sing N N 53 AMZ N C1 sing N N 54 AMZ C1 C2 sing N N 55 AMZ C1 O sing N N 56 AMZ C1 H2 sing N N 57 AMZ C2 C3 sing N N 58 AMZ C2 O1 sing N N 59 AMZ C2 H3 sing N N 60 AMZ C3 O2 sing N N 61 AMZ C3 C sing N N 62 AMZ C3 H4 sing N N 63 AMZ O2 H5 sing N N 64 AMZ O1 H1 sing N N 65 AMZ O C sing N N 66 AMZ C C4 sing N N 67 AMZ C H6 sing N N 68 AMZ C4 O3 sing N N 69 AMZ C4 H7 sing N N 70 AMZ C4 H8 sing N N 71 AMZ O3 P sing N N 72 AMZ P OP1 sing N N 73 AMZ P O4 sing N N 74 AMZ P OP2 doub N N 75 AMZ OP1 H15 sing N N 76 AMZ O4 H14 sing N N 77 C OP3 P sing N N 78 C OP3 HOP3 sing N N 79 C P OP1 doub N N 80 C P OP2 sing N N 81 C P "O5'" sing N N 82 C OP2 HOP2 sing N N 83 C "O5'" "C5'" sing N N 84 C "C5'" "C4'" sing N N 85 C "C5'" "H5'" sing N N 86 C "C5'" "H5''" sing N N 87 C "C4'" "O4'" sing N N 88 C "C4'" "C3'" sing N N 89 C "C4'" "H4'" sing N N 90 C "O4'" "C1'" sing N N 91 C "C3'" "O3'" sing N N 92 C "C3'" "C2'" sing N N 93 C "C3'" "H3'" sing N N 94 C "O3'" "HO3'" sing N N 95 C "C2'" "O2'" sing N N 96 C "C2'" "C1'" sing N N 97 C "C2'" "H2'" sing N N 98 C "O2'" "HO2'" sing N N 99 C "C1'" N1 sing N N 100 C "C1'" "H1'" sing N N 101 C N1 C2 sing N N 102 C N1 C6 sing N N 103 C C2 O2 doub N N 104 C C2 N3 sing N N 105 C N3 C4 doub N N 106 C C4 N4 sing N N 107 C C4 C5 sing N N 108 C N4 H41 sing N N 109 C N4 H42 sing N N 110 C C5 C6 doub N N 111 C C5 H5 sing N N 112 C C6 H6 sing N N 113 G OP3 P sing N N 114 G OP3 HOP3 sing N N 115 G P OP1 doub N N 116 G P OP2 sing N N 117 G P "O5'" sing N N 118 G OP2 HOP2 sing N N 119 G "O5'" "C5'" sing N N 120 G "C5'" "C4'" sing N N 121 G "C5'" "H5'" sing N N 122 G "C5'" "H5''" sing N N 123 G "C4'" "O4'" sing N N 124 G "C4'" "C3'" sing N N 125 G "C4'" "H4'" sing N N 126 G "O4'" "C1'" sing N N 127 G "C3'" "O3'" sing N N 128 G "C3'" "C2'" sing N N 129 G "C3'" "H3'" sing N N 130 G "O3'" "HO3'" sing N N 131 G "C2'" "O2'" sing N N 132 G "C2'" "C1'" sing N N 133 G "C2'" "H2'" sing N N 134 G "O2'" "HO2'" sing N N 135 G "C1'" N9 sing N N 136 G "C1'" "H1'" sing N N 137 G N9 C8 sing Y N 138 G N9 C4 sing Y N 139 G C8 N7 doub Y N 140 G C8 H8 sing N N 141 G N7 C5 sing Y N 142 G C5 C6 sing N N 143 G C5 C4 doub Y N 144 G C6 O6 doub N N 145 G C6 N1 sing N N 146 G N1 C2 sing N N 147 G N1 H1 sing N N 148 G C2 N2 sing N N 149 G C2 N3 doub N N 150 G N2 H21 sing N N 151 G N2 H22 sing N N 152 G N3 C4 sing N N 153 HOH O H1 sing N N 154 HOH O H2 sing N N 155 U OP3 P sing N N 156 U OP3 HOP3 sing N N 157 U P OP1 doub N N 158 U P OP2 sing N N 159 U P "O5'" sing N N 160 U OP2 HOP2 sing N N 161 U "O5'" "C5'" sing N N 162 U "C5'" "C4'" sing N N 163 U "C5'" "H5'" sing N N 164 U "C5'" "H5''" sing N N 165 U "C4'" "O4'" sing N N 166 U "C4'" "C3'" sing N N 167 U "C4'" "H4'" sing N N 168 U "O4'" "C1'" sing N N 169 U "C3'" "O3'" sing N N 170 U "C3'" "C2'" sing N N 171 U "C3'" "H3'" sing N N 172 U "O3'" "HO3'" sing N N 173 U "C2'" "O2'" sing N N 174 U "C2'" "C1'" sing N N 175 U "C2'" "H2'" sing N N 176 U "O2'" "HO2'" sing N N 177 U "C1'" N1 sing N N 178 U "C1'" "H1'" sing N N 179 U N1 C2 sing N N 180 U N1 C6 sing N N 181 U C2 O2 doub N N 182 U C2 N3 sing N N 183 U N3 C4 sing N N 184 U N3 H3 sing N N 185 U C4 O4 doub N N 186 U C4 C5 sing N N 187 U C5 C6 doub N N 188 U C5 H5 sing N N 189 U C6 H6 sing N N 190 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6OD9 'double helix' 6OD9 'a-form double helix' 6OD9 'hairpin loop' 6OD9 'bulge loop' 6OD9 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 6 1_555 A C 50 1_555 -0.183 -0.124 -0.268 -6.094 -3.557 0.100 1 A_G6:C50_A A 6 ? A 50 ? 19 1 1 A U 7 1_555 A A 49 1_555 0.762 0.257 0.219 -7.505 -1.913 4.468 2 A_U7:A49_A A 7 ? A 49 ? 20 1 1 A U 8 1_555 A A 48 1_555 0.005 -0.135 0.416 -0.933 2.667 2.213 3 A_U8:A48_A A 8 ? A 48 ? 20 1 1 A A 9 1_555 A U 47 1_555 0.066 -0.063 -0.095 -3.529 -0.715 -0.078 4 A_A9:U47_A A 9 ? A 47 ? 20 1 1 A U 10 1_555 A A 46 1_555 -0.019 -0.111 0.005 -0.314 -0.912 2.184 5 A_U10:A46_A A 10 ? A 46 ? 20 1 1 A A 11 1_555 A U 45 1_555 0.076 -0.077 0.190 3.937 5.367 0.869 6 A_A11:U45_A A 11 ? A 45 ? 20 1 1 A U 12 1_555 A G 44 1_555 1.783 -0.329 -0.182 5.262 1.435 1.294 7 A_U12:G44_A A 12 ? A 44 ? 28 1 1 A G 13 1_555 A A 43 1_555 6.911 -4.705 -0.358 0.713 -3.483 -13.761 8 A_G13:A43_A A 13 ? A 43 ? 11 10 1 A A 14 1_555 A A 42 1_555 -6.450 -3.815 -0.568 -2.371 4.520 -27.161 9 A_A14:A42_A A 14 ? A 42 ? ? 10 1 A C 15 1_555 A G 41 1_555 0.122 -0.149 -0.709 9.757 1.048 0.186 10 A_C15:G41_A A 15 ? A 41 ? 19 1 1 A U 16 1_555 A U 40 1_555 2.548 -1.346 -0.195 15.540 -19.493 16.902 11 A_U16:U40_A A 16 ? A 40 ? 16 1 1 A G 17 1_555 A C 69 1_555 -0.153 -0.133 -0.224 -0.146 -0.712 -0.658 12 A_G17:C69_A A 17 ? A 69 ? 19 1 1 A A 18 1_555 A U 68 1_555 0.091 -0.062 -0.047 -0.987 5.490 -1.339 13 A_A18:U68_A A 18 ? A 68 ? 20 1 1 A C 19 1_555 A G 67 1_555 0.208 -0.113 0.085 3.398 1.888 0.983 14 A_C19:G67_A A 19 ? A 67 ? 19 1 1 A G 20 1_555 A C 66 1_555 -0.148 -0.149 0.357 0.580 5.621 1.555 15 A_G20:C66_A A 20 ? A 66 ? 19 1 1 A G 21 1_555 A C 65 1_555 -0.164 -0.155 0.333 -2.898 -2.135 0.720 16 A_G21:C65_A A 21 ? A 65 ? 19 1 1 B A 23 1_555 A A 64 1_555 6.977 -0.757 -0.674 3.959 -2.607 65.916 17 B_A23:A64_A B 23 ? A 64 ? ? 5 1 B A 64 1_555 A A 23 1_555 -6.870 -1.715 -0.121 9.994 5.873 57.967 18 B_A64:A23_A B 64 ? A 23 ? ? 5 1 B C 65 1_555 B G 21 1_555 0.177 -0.118 -0.037 4.553 -6.282 -0.735 19 B_C65:G21_B B 65 ? B 21 ? 19 1 1 B C 66 1_555 B G 20 1_555 0.166 -0.125 -0.154 3.941 -0.185 -0.075 20 B_C66:G20_B B 66 ? B 20 ? 19 1 1 B G 67 1_555 B C 19 1_555 -0.191 -0.135 0.260 -5.107 3.792 1.866 21 B_G67:C19_B B 67 ? B 19 ? 19 1 1 B U 68 1_555 B A 18 1_555 -0.080 -0.088 0.175 -0.383 6.511 -0.249 22 B_U68:A18_B B 68 ? B 18 ? 20 1 1 B C 69 1_555 B G 17 1_555 0.122 -0.145 -0.190 -1.205 0.881 -1.328 23 B_C69:G17_B B 69 ? B 17 ? 19 1 1 A G 25 1_555 A C 38 1_555 -0.996 0.427 -0.467 10.585 9.774 14.295 24 A_G25:C38_A A 25 ? A 38 ? ? 1 1 A U 26 1_555 A A 37 1_555 -0.454 0.104 -0.811 20.395 2.747 -5.386 25 A_U26:A37_A A 26 ? A 37 ? 20 1 1 A G 27 1_555 A C 36 1_555 0.353 0.400 -0.125 -1.059 11.510 6.374 26 A_G27:C36_A A 27 ? A 36 ? 19 1 1 A G 28 1_555 A C 35 1_555 -0.070 0.858 -0.416 12.432 15.544 4.839 27 A_G28:C35_A A 28 ? A 35 ? ? ? 1 A G 60 1_555 A C 74 1_555 0.422 0.136 -0.434 -5.290 7.582 -2.066 28 A_G60:C74_A A 60 ? A 74 ? 19 1 1 A C 61 1_555 A G 73 1_555 0.173 -0.140 -0.279 0.801 7.359 -0.245 29 A_C61:G73_A A 61 ? A 73 ? 19 1 1 A C 62 1_555 A G 72 1_555 0.184 -0.121 0.189 -0.518 1.906 -0.777 30 A_C62:G72_A A 62 ? A 72 ? 19 1 1 B U 8 1_555 B A 48 1_555 -0.255 -0.504 1.522 1.227 -5.130 -4.964 31 B_U8:A48_B B 8 ? B 48 ? 20 1 1 B A 9 1_555 B U 47 1_555 0.015 -0.107 0.404 -1.372 0.446 -0.394 32 B_A9:U47_B B 9 ? B 47 ? 20 1 1 B U 10 1_555 B A 46 1_555 -0.040 -0.101 0.185 1.832 1.263 3.092 33 B_U10:A46_B B 10 ? B 46 ? 20 1 1 B A 11 1_555 B U 45 1_555 0.045 -0.096 0.199 1.847 1.419 2.193 34 B_A11:U45_B B 11 ? B 45 ? 20 1 1 B U 12 1_555 B G 44 1_555 1.710 -0.330 0.143 3.258 0.018 4.120 35 B_U12:G44_B B 12 ? B 44 ? 28 1 1 B G 13 1_555 B A 43 1_555 6.759 -4.341 -0.127 1.238 -1.587 -6.698 36 B_G13:A43_B B 13 ? B 43 ? 11 10 1 B A 14 1_555 B A 42 1_555 -6.504 -3.886 0.170 -1.207 -2.826 -22.982 37 B_A14:A42_B B 14 ? B 42 ? ? 10 1 B C 15 1_555 B G 41 1_555 0.167 -0.203 -0.869 10.589 -3.752 1.326 38 B_C15:G41_B B 15 ? B 41 ? 19 1 1 B U 16 1_555 B U 40 1_555 2.819 -1.910 0.107 9.584 -28.661 12.177 39 B_U16:U40_B B 16 ? B 40 ? 16 1 1 B G 25 1_555 B C 38 1_555 -0.891 0.655 -0.588 4.829 10.391 8.382 40 B_G25:C38_B B 25 ? B 38 ? ? 1 1 B U 26 1_555 B A 37 1_555 -0.211 0.652 -0.994 15.809 4.605 -3.465 41 B_U26:A37_B B 26 ? B 37 ? 20 1 1 B G 27 1_555 B C 36 1_555 1.676 0.094 0.110 8.635 32.271 -1.375 42 B_G27:C36_B B 27 ? B 36 ? 19 1 1 B G 28 1_555 B C 35 1_555 0.334 0.993 0.327 15.251 19.298 15.088 43 B_G28:C35_B B 28 ? B 35 ? ? 1 1 B U 59 1_555 B G 75 1_555 -2.770 -0.112 0.083 -1.978 6.568 -25.429 44 B_U59:G75_B B 59 ? B 75 ? ? 1 1 B G 60 1_555 B C 74 1_555 -0.151 -0.118 -0.066 -0.891 4.906 -0.378 45 B_G60:C74_B B 60 ? B 74 ? 19 1 1 B C 61 1_555 B G 73 1_555 0.176 -0.131 -0.072 1.694 5.418 1.281 46 B_C61:G73_B B 61 ? B 73 ? 19 1 1 B C 62 1_555 B G 72 1_555 0.188 -0.151 0.244 1.503 1.424 -0.062 47 B_C62:G72_B B 62 ? B 72 ? 19 1 1 B G 63 1_555 B G 71 1_555 -2.647 -2.862 1.719 -13.253 -57.775 102.162 48 B_G63:G71_B B 63 ? B 71 ? ? 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 6 1_555 A C 50 1_555 A U 7 1_555 A A 49 1_555 0.407 -1.760 3.551 -2.513 0.343 35.769 -2.911 -1.050 3.499 0.557 4.086 35.856 1 AA_G6U7:A49C50_AA A 6 ? A 50 ? A 7 ? A 49 ? 1 A U 7 1_555 A A 49 1_555 A U 8 1_555 A A 48 1_555 -0.173 -1.638 3.192 1.201 4.492 29.317 -4.084 0.575 2.905 8.806 -2.355 29.675 2 AA_U7U8:A48A49_AA A 7 ? A 49 ? A 8 ? A 48 ? 1 A U 8 1_555 A A 48 1_555 A A 9 1_555 A U 47 1_555 0.331 -1.368 3.030 5.896 22.569 33.520 -4.028 0.062 1.824 34.440 -8.998 40.646 3 AA_U8A9:U47A48_AA A 8 ? A 48 ? A 9 ? A 47 ? 1 A A 9 1_555 A U 47 1_555 A U 10 1_555 A A 46 1_555 0.002 -1.642 3.326 -0.969 2.423 32.901 -3.302 -0.167 3.199 4.269 1.708 33.001 4 AA_A9U10:A46U47_AA A 9 ? A 47 ? A 10 ? A 46 ? 1 A U 10 1_555 A A 46 1_555 A A 11 1_555 A U 45 1_555 0.139 -1.373 2.938 -0.027 9.706 33.084 -3.590 -0.239 2.449 16.604 0.047 34.440 5 AA_U10A11:U45A46_AA A 10 ? A 46 ? A 11 ? A 45 ? 1 A A 11 1_555 A U 45 1_555 A U 12 1_555 A G 44 1_555 0.742 -1.658 3.240 4.106 1.810 39.772 -2.628 -0.618 3.223 2.650 -6.012 40.014 6 AA_A11U12:G44U45_AA A 11 ? A 45 ? A 12 ? A 44 ? 1 A U 12 1_555 A G 44 1_555 A G 13 1_555 A A 43 1_555 -1.149 -1.480 3.471 4.066 0.800 54.917 -1.651 1.495 3.364 0.866 -4.402 55.061 7 AA_U12G13:A43G44_AA A 12 ? A 44 ? A 13 ? A 43 ? 1 A G 13 1_555 A A 43 1_555 A A 14 1_555 A A 42 1_555 -0.866 -0.673 3.569 1.735 6.365 -22.088 -0.840 -1.481 3.671 -16.156 4.403 -23.040 8 AA_G13A14:A42A43_AA A 13 ? A 43 ? A 14 ? A 42 ? 1 A A 14 1_555 A A 42 1_555 A C 15 1_555 A G 41 1_555 1.498 -1.163 3.238 1.153 1.106 59.742 -1.222 -1.446 3.244 1.110 -1.157 59.761 9 AA_A14C15:G41A42_AA A 14 ? A 42 ? A 15 ? A 41 ? 1 A C 15 1_555 A G 41 1_555 A U 16 1_555 A U 40 1_555 1.882 -1.393 3.415 0.919 5.313 34.064 -3.192 -3.030 3.216 9.000 -1.556 34.475 10 AA_C15U16:U40G41_AA A 15 ? A 41 ? A 16 ? A 40 ? 1 A G 17 1_555 A C 69 1_555 A A 18 1_555 A U 68 1_555 -1.484 -2.516 3.194 -4.963 7.555 26.612 -6.811 1.991 2.623 15.843 10.408 28.079 11 AA_G17A18:U68C69_AA A 17 ? A 69 ? A 18 ? A 68 ? 1 A A 18 1_555 A U 68 1_555 A C 19 1_555 A G 67 1_555 0.521 -1.759 3.148 0.288 5.189 32.846 -3.874 -0.867 2.849 9.106 -0.506 33.243 12 AA_A18C19:G67U68_AA A 18 ? A 68 ? A 19 ? A 67 ? 1 A C 19 1_555 A G 67 1_555 A G 20 1_555 A C 66 1_555 0.239 -1.865 2.924 -0.355 14.216 30.952 -4.953 -0.453 1.906 25.047 0.625 33.990 13 AA_C19G20:C66G67_AA A 19 ? A 67 ? A 20 ? A 66 ? 1 A G 20 1_555 A C 66 1_555 A G 21 1_555 A C 65 1_555 0.589 -1.912 3.096 2.827 7.871 34.758 -4.132 -0.597 2.652 12.944 -4.649 35.720 14 AA_G20G21:C65C66_AA A 20 ? A 66 ? A 21 ? A 65 ? 1 A G 21 1_555 A C 65 1_555 B A 23 1_555 A A 64 1_555 0.693 0.094 3.597 18.118 -0.256 86.013 0.074 -0.061 3.662 -0.186 -13.157 87.535 15 AB_G21A23:A64C65_AA A 21 ? A 65 ? B 23 ? A 64 ? 1 B A 23 1_555 A A 64 1_555 B A 64 1_555 A A 23 1_555 0.629 2.173 5.610 -3.885 51.496 81.948 -0.381 -0.570 5.964 36.322 2.740 94.371 16 BB_A23A64:A23A64_AA B 23 ? A 64 ? B 64 ? A 23 ? 1 B A 64 1_555 A A 23 1_555 B C 65 1_555 B G 21 1_555 -0.106 0.254 3.255 0.324 -0.448 87.695 0.193 0.084 3.253 -0.323 -0.234 87.696 17 BB_A64C65:G21A23_BA B 64 ? A 23 ? B 65 ? B 21 ? 1 B C 65 1_555 B G 21 1_555 B C 66 1_555 B G 20 1_555 -0.274 -1.702 3.082 0.444 8.799 33.584 -4.040 0.520 2.564 14.911 -0.753 34.688 18 BB_C65C66:G20G21_BB B 65 ? B 21 ? B 66 ? B 20 ? 1 B C 66 1_555 B G 20 1_555 B G 67 1_555 B C 19 1_555 0.095 -1.791 3.070 -3.733 20.989 32.129 -4.783 -0.511 1.621 33.693 5.993 38.402 19 BB_C66G67:C19G20_BB B 66 ? B 20 ? B 67 ? B 19 ? 1 B G 67 1_555 B C 19 1_555 B U 68 1_555 B A 18 1_555 -0.533 -1.707 3.145 -0.500 4.749 33.798 -3.608 0.834 2.893 8.117 0.855 34.124 20 BB_G67U68:A18C19_BB B 67 ? B 19 ? B 68 ? B 18 ? 1 B U 68 1_555 B A 18 1_555 B C 69 1_555 B G 17 1_555 1.274 -2.459 3.173 5.444 8.948 27.439 -6.576 -1.469 2.468 18.051 -10.982 29.334 21 BB_U68C69:G17A18_BB B 68 ? B 18 ? B 69 ? B 17 ? 1 A G 25 1_555 A C 38 1_555 A U 26 1_555 A A 37 1_555 -1.120 -1.395 3.232 2.808 2.632 30.919 -3.077 2.597 2.995 4.912 -5.242 31.152 22 AA_G25U26:A37C38_AA A 25 ? A 38 ? A 26 ? A 37 ? 1 A U 26 1_555 A A 37 1_555 A G 27 1_555 A C 36 1_555 0.450 -1.650 3.649 -2.720 31.693 37.364 -4.324 -0.745 1.776 41.504 3.562 48.699 23 AA_U26G27:C36A37_AA A 26 ? A 37 ? A 27 ? A 36 ? 1 A G 27 1_555 A C 36 1_555 A G 28 1_555 A C 35 1_555 0.080 -2.039 2.963 2.788 4.931 28.659 -4.961 0.361 2.580 9.839 -5.563 29.202 24 AA_G27G28:C35C36_AA A 27 ? A 36 ? A 28 ? A 35 ? 1 A G 60 1_555 A C 74 1_555 A C 61 1_555 A G 73 1_555 0.258 -1.948 3.171 0.296 1.783 33.555 -3.647 -0.399 3.068 3.086 -0.512 33.602 25 AA_G60C61:G73C74_AA A 60 ? A 74 ? A 61 ? A 73 ? 1 A C 61 1_555 A G 73 1_555 A C 62 1_555 A G 72 1_555 0.256 -1.757 3.551 4.147 7.978 30.917 -4.634 0.299 3.023 14.583 -7.580 32.168 26 AA_C61C62:G72G73_AA A 61 ? A 73 ? A 62 ? A 72 ? 1 B U 8 1_555 B A 48 1_555 B A 9 1_555 B U 47 1_555 0.182 -1.383 3.585 4.818 8.005 33.522 -3.603 0.471 3.175 13.556 -8.159 34.764 27 BB_U8A9:U47A48_BB B 8 ? B 48 ? B 9 ? B 47 ? 1 B A 9 1_555 B U 47 1_555 B U 10 1_555 B A 46 1_555 -0.065 -1.751 3.439 -1.010 1.564 31.449 -3.528 -0.076 3.350 2.883 1.861 31.502 28 BB_A9U10:A46U47_BB B 9 ? B 47 ? B 10 ? B 46 ? 1 B U 10 1_555 B A 46 1_555 B A 11 1_555 B U 45 1_555 -0.046 -1.513 2.965 -0.121 17.188 33.424 -4.164 0.059 1.981 27.725 0.195 37.473 29 BB_U10A11:U45A46_BB B 10 ? B 46 ? B 11 ? B 45 ? 1 B A 11 1_555 B U 45 1_555 B U 12 1_555 B G 44 1_555 0.638 -1.607 3.287 1.158 1.099 39.489 -2.506 -0.807 3.260 1.626 -1.714 39.520 30 BB_A11U12:G44U45_BB B 11 ? B 45 ? B 12 ? B 44 ? 1 B U 12 1_555 B G 44 1_555 B G 13 1_555 B A 43 1_555 -1.146 -1.286 3.422 2.544 0.352 53.372 -1.453 1.441 3.361 0.392 -2.831 53.429 31 BB_U12G13:A43G44_BB B 12 ? B 44 ? B 13 ? B 43 ? 1 B G 13 1_555 B A 43 1_555 B A 14 1_555 B A 42 1_555 -0.887 -0.944 3.640 -1.102 2.617 -21.237 1.346 -2.889 3.677 -7.060 -2.973 -21.424 32 BB_G13A14:A42A43_BB B 13 ? B 43 ? B 14 ? B 42 ? 1 B A 14 1_555 B A 42 1_555 B C 15 1_555 B G 41 1_555 1.477 -1.087 3.201 5.686 3.022 60.560 -1.216 -1.188 3.262 2.988 -5.621 60.869 33 BB_A14C15:G41A42_BB B 14 ? B 42 ? B 15 ? B 41 ? 1 B C 15 1_555 B G 41 1_555 B U 16 1_555 B U 40 1_555 1.704 -1.297 3.760 1.877 3.621 37.793 -2.519 -2.344 3.702 5.570 -2.888 38.005 34 BB_C15U16:U40G41_BB B 15 ? B 41 ? B 16 ? B 40 ? 1 B G 25 1_555 B C 38 1_555 B U 26 1_555 B A 37 1_555 -0.741 -1.531 3.151 3.055 4.295 30.499 -3.635 1.933 2.829 8.088 -5.753 30.940 35 BB_G25U26:A37C38_BB B 25 ? B 38 ? B 26 ? B 37 ? 1 B U 26 1_555 B A 37 1_555 B G 27 1_555 B C 36 1_555 -0.138 -1.580 3.397 -5.013 25.423 40.702 -3.800 -0.197 2.119 32.853 6.479 47.954 36 BB_U26G27:C36A37_BB B 26 ? B 37 ? B 27 ? B 36 ? 1 B G 27 1_555 B C 36 1_555 B G 28 1_555 B C 35 1_555 1.454 -2.674 3.159 3.448 4.650 25.332 -7.132 -2.359 2.801 10.431 -7.734 25.974 37 BB_G27G28:C35C36_BB B 27 ? B 36 ? B 28 ? B 35 ? 1 B U 59 1_555 B G 75 1_555 B G 60 1_555 B C 74 1_555 2.028 -1.616 4.048 -2.525 0.408 35.868 -2.689 -3.722 3.883 0.662 4.093 35.956 38 BB_U59G60:C74G75_BB B 59 ? B 75 ? B 60 ? B 74 ? 1 B G 60 1_555 B C 74 1_555 B C 61 1_555 B G 73 1_555 0.318 -1.961 3.230 -0.267 2.764 36.535 -3.486 -0.541 3.076 4.401 0.425 36.637 39 BB_G60C61:G73C74_BB B 60 ? B 74 ? B 61 ? B 73 ? 1 B C 61 1_555 B G 73 1_555 B C 62 1_555 B G 72 1_555 0.039 -1.880 3.334 3.353 6.537 30.971 -4.581 0.519 2.876 12.030 -6.170 31.810 40 BB_C61C62:G72G73_BB B 61 ? B 73 ? B 62 ? B 72 ? 1 B C 62 1_555 B G 72 1_555 B G 63 1_555 B G 71 1_555 1.611 2.639 -0.165 158.084 -52.818 -177.005 -1.320 0.804 -0.183 26.410 79.044 -179.653 41 BB_C62G63:G71G72_BB B 62 ? B 72 ? B 63 ? B 71 ? # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id AMZ _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id AMZ _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 'AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE' AMZ 4 'POTASSIUM ION' K 5 'CESIUM ION' CS 6 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5BTP _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'isothermal titration calorimetry' _pdbx_struct_assembly_auth_evidence.details '~500 nM apparent binding affinity' #