data_6TFH # _entry.id 6TFH # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6TFH pdb_00006tfh 10.2210/pdb6tfh/pdb WWPDB D_1292105396 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-09-23 2 'Structure model' 1 1 2024-01-24 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 2 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' database_2 4 2 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6TFH _pdbx_database_status.recvd_initial_deposition_date 2019-11-14 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Huang, L.' 1 ? 'Lilley, D.M.J.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Rna _citation.journal_id_ASTM RNARFU _citation.journal_id_CSD 2122 _citation.journal_id_ISSN 1469-9001 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 26 _citation.language ? _citation.page_first 878 _citation.page_last 887 _citation.title 'Structure and ligand binding of the ADP-binding domain of the NAD+ riboswitch.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1261/rna.074898.120 _citation.pdbx_database_id_PubMed 32295864 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Huang, L.' 1 ? primary 'Wang, J.' 2 ? primary 'Lilley, D.M.J.' 3 0000-0001-6882-2818 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'Chains: A' 16863.957 1 ? ? ? ? 2 non-polymer syn 'MANGANESE (II) ION' 54.938 9 ? ? ? ? 3 non-polymer syn NICOTINAMIDE-ADENINE-DINUCLEOTIDE 663.425 1 ? ? ? ? 4 non-polymer syn 'SODIUM ION' 22.990 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'GG(CBV)UUCAACAACCCCGUAGGUUGGGCCGAAAGGCAGCGAAUCUACUGGAGCC' _entity_poly.pdbx_seq_one_letter_code_can GGCUUCAACAACCCCGUAGGUUGGGCCGAAAGGCAGCGAAUCUACUGGAGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MANGANESE (II) ION' MN 3 NICOTINAMIDE-ADENINE-DINUCLEOTIDE NAD 4 'SODIUM ION' NA # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 CBV n 1 4 U n 1 5 U n 1 6 C n 1 7 A n 1 8 A n 1 9 C n 1 10 A n 1 11 A n 1 12 C n 1 13 C n 1 14 C n 1 15 C n 1 16 G n 1 17 U n 1 18 A n 1 19 G n 1 20 G n 1 21 U n 1 22 U n 1 23 G n 1 24 G n 1 25 G n 1 26 C n 1 27 C n 1 28 G n 1 29 A n 1 30 A n 1 31 A n 1 32 G n 1 33 G n 1 34 C n 1 35 A n 1 36 G n 1 37 C n 1 38 G n 1 39 A n 1 40 A n 1 41 U n 1 42 C n 1 43 U n 1 44 A n 1 45 C n 1 46 U n 1 47 G n 1 48 G n 1 49 A n 1 50 G n 1 51 C n 1 52 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 52 _pdbx_entity_src_syn.organism_scientific 'Candidatus Koribacter versatilis Ellin345' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 204669 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CBV 'RNA linking' n ;5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) ; ? 'C9 H13 Br N3 O8 P' 402.093 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 MN non-polymer . 'MANGANESE (II) ION' ? 'Mn 2' 54.938 NA non-polymer . 'SODIUM ION' ? 'Na 1' 22.990 NAD non-polymer . NICOTINAMIDE-ADENINE-DINUCLEOTIDE ? 'C21 H27 N7 O14 P2' 663.425 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 CBV 3 3 3 CBV CBV A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 A 7 7 7 A A A . n A 1 8 A 8 8 8 A A A . n A 1 9 C 9 9 9 C C A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 C 12 12 12 C C A . n A 1 13 C 13 13 13 C C A . n A 1 14 C 14 14 14 C C A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 G 23 23 23 G G A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 C 26 26 26 C C A . n A 1 27 C 27 27 27 C C A . n A 1 28 G 28 28 28 G G A . n A 1 29 A 29 29 29 A A A . n A 1 30 A 30 30 30 A A A . n A 1 31 A 31 31 31 A A A . n A 1 32 G 32 32 32 G G A . n A 1 33 G 33 33 33 G G A . n A 1 34 C 34 34 34 C C A . n A 1 35 A 35 35 35 A A A . n A 1 36 G 36 36 36 G G A . n A 1 37 C 37 37 37 C C A . n A 1 38 G 38 38 38 G G A . n A 1 39 A 39 39 39 A A A . n A 1 40 A 40 40 40 A A A . n A 1 41 U 41 41 41 U U A . n A 1 42 C 42 42 42 C C A . n A 1 43 U 43 43 43 U U A . n A 1 44 A 44 44 44 A A A . n A 1 45 C 45 45 45 C C A . n A 1 46 U 46 46 46 U U A . n A 1 47 G 47 47 47 G G A . n A 1 48 G 48 48 48 G G A . n A 1 49 A 49 49 49 A A A . n A 1 50 G 50 50 50 G G A . n A 1 51 C 51 51 51 C C A . n A 1 52 C 52 52 52 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MN 1 101 1 MN MN A . C 2 MN 1 102 2 MN MN A . D 2 MN 1 103 3 MN MN A . E 2 MN 1 104 4 MN MN A . F 2 MN 1 105 5 MN MN A . G 2 MN 1 106 6 MN MN A . H 2 MN 1 107 7 MN MN A . I 2 MN 1 108 8 MN MN A . J 2 MN 1 109 9 MN MN A . K 3 NAD 1 110 1 NAD NAI A . L 4 NA 1 111 1 NA NA A . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 N 1 A NAD 110 ? O4D ? K NAD 1 O4D 2 1 N 1 A NAD 110 ? C3D ? K NAD 1 C3D 3 1 N 1 A NAD 110 ? O3D ? K NAD 1 O3D 4 1 N 1 A NAD 110 ? C2D ? K NAD 1 C2D 5 1 N 1 A NAD 110 ? O2D ? K NAD 1 O2D 6 1 N 1 A NAD 110 ? C1D ? K NAD 1 C1D 7 1 N 1 A NAD 110 ? N1N ? K NAD 1 N1N 8 1 N 1 A NAD 110 ? C2N ? K NAD 1 C2N 9 1 N 1 A NAD 110 ? C3N ? K NAD 1 C3N 10 1 N 1 A NAD 110 ? C7N ? K NAD 1 C7N 11 1 N 1 A NAD 110 ? O7N ? K NAD 1 O7N 12 1 N 1 A NAD 110 ? N7N ? K NAD 1 N7N 13 1 N 1 A NAD 110 ? C4N ? K NAD 1 C4N 14 1 N 1 A NAD 110 ? C5N ? K NAD 1 C5N 15 1 N 1 A NAD 110 ? C6N ? K NAD 1 C6N # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.17.1_3660 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.17.1_3660 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 3 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 6TFH _cell.details ? _cell.formula_units_Z ? _cell.length_a 56.935 _cell.length_a_esd ? _cell.length_b 58.360 _cell.length_b_esd ? _cell.length_c 193.968 _cell.length_c_esd ? _cell.volume 644502.633 _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 6TFH _symmetry.cell_setting ? _symmetry.Int_Tables_number 23 _symmetry.space_group_name_Hall 'I 2 2' _symmetry.space_group_name_H-M 'I 2 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6TFH _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.0 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 75 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 6.8 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 280 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.2 M Potassium Chloride, 0.1 M Mg Acetate, 0.05 M Sodium Cacodylate pH 6.8, 10% w/v Polyethylene Glycol 3350' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 XE 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2019-09-28 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.8923 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'DIAMOND BEAMLINE I03' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.8923 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline I03 _diffrn_source.pdbx_synchrotron_site Diamond # _reflns.B_iso_Wilson_estimate 93.67 _reflns.entry_id 6TFH _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.95 _reflns.d_resolution_low 48.50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 12163 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 96.7 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 5.2 _reflns.pdbx_Rmerge_I_obs 0.122 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 10.8 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.059 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.996 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 2.95 _reflns_shell.d_res_low 3.00 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 0.5 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 359 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 2.7 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 1.8 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.48 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 113.50 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 6TFH _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.95 _refine.ls_d_res_low 48.49 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 12163 _refine.ls_number_reflns_R_free 616 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 92.61 _refine.ls_percent_reflns_R_free 5.06 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2234 _refine.ls_R_factor_R_free 0.2663 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2213 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 6TF0 _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 37.5261 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.5932 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.95 _refine_hist.d_res_low 48.49 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1151 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1112 _refine_hist.pdbx_number_atoms_ligand 39 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0115 ? 1275 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.9497 ? 1986 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0754 ? 262 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0109 ? 53 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 15.8029 ? 624 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.95 3.25 . . 165 2862 91.87 . . . 0.4676 . 0.4378 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.25 3.72 . . 166 2831 91.40 . . . 0.4360 . 0.3340 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.72 4.69 . . 158 2900 93.80 . . . 0.2262 . 0.2241 . . . . . . . . . . . 'X-RAY DIFFRACTION' 4.69 48.49 . . 127 2954 93.39 . . . 0.1956 . 0.1583 . . . . . . . . . . . # _struct.entry_id 6TFH _struct.title ;Crystal structure of the ADP-binding domain of the NAD+ riboswitch with Nicotinamide adenine dinucleotide, reduced (NADH); soaking with Manganese(II) (Mn2+) ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6TFH _struct_keywords.text 'RNA structure; Riboswitch; X-ray crystallography, Non-coding RNA, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 2 ? I N N 2 ? J N N 2 ? K N N 3 ? L N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6TFH _struct_ref.pdbx_db_accession 6TFH _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6TFH _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 52 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6TFH _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 52 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 52 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2280 ? 1 MORE -55 ? 1 'SSA (A^2)' 9250 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A G 2 "O3'" ? ? ? 1_555 A CBV 3 P ? ? A G 2 A CBV 3 1_555 ? ? ? ? ? ? ? 1.600 ? ? covale2 covale one ? A CBV 3 "O3'" ? ? ? 1_555 A U 4 P ? ? A CBV 3 A U 4 1_555 ? ? ? ? ? ? ? 1.614 ? ? metalc1 metalc ? ? A A 7 OP2 ? ? ? 1_555 H MN . MN ? ? A A 7 A MN 107 1_555 ? ? ? ? ? ? ? 2.446 ? ? metalc2 metalc ? ? A A 8 OP1 ? ? ? 1_555 D MN . MN ? ? A A 8 A MN 103 1_555 ? ? ? ? ? ? ? 2.270 ? ? metalc3 metalc ? ? A A 8 OP2 ? ? ? 1_555 E MN . MN ? ? A A 8 A MN 104 1_555 ? ? ? ? ? ? ? 2.198 ? ? metalc4 metalc ? ? A C 9 OP2 ? ? ? 1_555 E MN . MN ? ? A C 9 A MN 104 1_555 ? ? ? ? ? ? ? 2.209 ? ? metalc5 metalc ? ? A A 10 N7 ? ? ? 1_555 E MN . MN ? ? A A 10 A MN 104 1_555 ? ? ? ? ? ? ? 2.279 ? ? metalc6 metalc ? ? A A 11 OP2 ? ? ? 1_555 B MN . MN ? ? A A 11 A MN 101 1_555 ? ? ? ? ? ? ? 2.244 ? ? metalc7 metalc ? ? A U 17 OP1 ? ? ? 1_555 B MN . MN ? ? A U 17 A MN 101 2_655 ? ? ? ? ? ? ? 2.432 ? ? metalc8 metalc ? ? A G 19 N7 ? ? ? 1_555 G MN . MN ? ? A G 19 A MN 106 1_555 ? ? ? ? ? ? ? 2.084 ? ? metalc9 metalc ? ? A G 23 N7 ? ? ? 1_555 C MN . MN ? ? A G 23 A MN 102 1_555 ? ? ? ? ? ? ? 2.416 ? ? metalc10 metalc ? ? A A 30 OP1 ? ? ? 1_555 L NA . NA ? ? A A 30 A NA 111 1_555 ? ? ? ? ? ? ? 2.927 ? ? metalc11 metalc ? ? A G 32 N7 ? ? ? 1_555 F MN . MN ? ? A G 32 A MN 105 1_555 ? ? ? ? ? ? ? 2.304 ? ? metalc12 metalc ? ? A G 47 N7 ? ? ? 1_555 J MN . MN ? ? A G 47 A MN 109 1_555 ? ? ? ? ? ? ? 2.527 ? ? metalc13 metalc ? ? D MN . MN ? ? ? 1_555 K NAD . O2A ? ? A MN 103 A NAD 110 1_555 ? ? ? ? ? ? ? 2.540 ? ? metalc14 metalc ? ? D MN . MN ? ? ? 1_555 K NAD . O1N ? ? A MN 103 A NAD 110 1_555 ? ? ? ? ? ? ? 2.507 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 52 N3 ? ? A G 1 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 52 O2 ? ? A G 1 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 52 N4 ? ? A G 1 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 51 N3 ? ? A G 2 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 51 O2 ? ? A G 2 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 51 N4 ? ? A G 2 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A CBV 3 N3 ? ? ? 1_555 A G 50 N1 ? ? A CBV 3 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A CBV 3 N4 ? ? ? 1_555 A G 50 O6 ? ? A CBV 3 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A CBV 3 O2 ? ? ? 1_555 A G 50 N2 ? ? A CBV 3 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 49 N1 ? ? A U 4 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 49 N6 ? ? A U 4 A A 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 48 O6 ? ? A U 5 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 48 N1 ? ? A U 5 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 47 N1 ? ? A C 6 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 47 O6 ? ? A C 6 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 47 N2 ? ? A C 6 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 46 N3 ? ? A A 7 A U 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 46 O4 ? ? A A 7 A U 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 13 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 13 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 13 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 14 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 14 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 14 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 45 N3 ? ? A G 16 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 45 O2 ? ? A G 16 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 45 N4 ? ? A G 16 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 44 N1 ? ? A U 17 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 44 N6 ? ? A U 17 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 18 N1 ? ? ? 1_555 A U 43 N3 ? ? A A 18 A U 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 18 N6 ? ? ? 1_555 A U 43 O4 ? ? A A 18 A U 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 19 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 19 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 19 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 20 N1 ? ? ? 1_555 A U 41 O2 ? ? A G 20 A U 41 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A G 20 O6 ? ? ? 1_555 A U 41 N3 ? ? A G 20 A U 41 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog37 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 40 N1 ? ? A U 21 A A 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 21 O4 ? ? ? 1_555 A A 40 N6 ? ? A U 21 A A 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 22 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 22 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 37 N3 ? ? A G 23 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 37 O2 ? ? A G 23 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 37 N4 ? ? A G 23 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 24 N1 ? ? ? 1_555 A A 35 N1 ? ? A G 24 A A 35 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog45 hydrog ? ? A G 24 O6 ? ? ? 1_555 A A 35 N6 ? ? A G 24 A A 35 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog46 hydrog ? ? A G 25 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 25 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 25 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 25 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 25 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 33 N1 ? ? A C 26 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 33 O6 ? ? A C 26 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 33 N2 ? ? A C 26 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 27 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 27 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 27 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 27 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 27 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 27 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 28 N2 ? ? ? 1_555 A A 31 N7 ? ? A G 28 A A 31 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A A 8 ? A A 8 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O2A ? K NAD . ? A NAD 110 ? 1_555 66.6 ? 2 OP1 ? A A 8 ? A A 8 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O1N ? K NAD . ? A NAD 110 ? 1_555 75.6 ? 3 O2A ? K NAD . ? A NAD 110 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O1N ? K NAD . ? A NAD 110 ? 1_555 61.0 ? 4 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 OP2 ? A C 9 ? A C 9 ? 1_555 93.6 ? 5 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 N7 ? A A 10 ? A A 10 ? 1_555 122.2 ? 6 OP2 ? A C 9 ? A C 9 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 N7 ? A A 10 ? A A 10 ? 1_555 78.7 ? 7 OP2 ? A A 11 ? A A 11 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 OP1 ? A U 17 ? A U 17 ? 1_555 35.0 ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A MN 101 ? 2 'binding site for residue MN A 101' AC2 Software A MN 102 ? 1 'binding site for residue MN A 102' AC3 Software A MN 103 ? 2 'binding site for residue MN A 103' AC4 Software A MN 104 ? 3 'binding site for residue MN A 104' AC5 Software A MN 105 ? 1 'binding site for residue MN A 105' AC6 Software A MN 106 ? 1 'binding site for residue MN A 106' AC7 Software A MN 107 ? 2 'binding site for residue MN A 107' AC8 Software A MN 108 ? 1 'binding site for residue MN A 108' AC9 Software A MN 109 ? 1 'binding site for residue MN A 109' AD1 Software A NAD 110 ? 6 'binding site for residue NAD A 110' AD2 Software A NA 111 ? 2 'binding site for residue NA A 111' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 2 A A 11 ? A A 11 . ? 1_555 ? 2 AC1 2 U A 17 ? U A 17 . ? 2_655 ? 3 AC2 1 G A 23 ? G A 23 . ? 1_555 ? 4 AC3 2 A A 8 ? A A 8 . ? 1_555 ? 5 AC3 2 NAD K . ? NAD A 110 . ? 1_555 ? 6 AC4 3 A A 8 ? A A 8 . ? 1_555 ? 7 AC4 3 C A 9 ? C A 9 . ? 1_555 ? 8 AC4 3 A A 10 ? A A 10 . ? 1_555 ? 9 AC5 1 G A 32 ? G A 32 . ? 1_555 ? 10 AC6 1 G A 19 ? G A 19 . ? 1_555 ? 11 AC7 2 A A 7 ? A A 7 . ? 1_555 ? 12 AC7 2 G A 16 ? G A 16 . ? 1_555 ? 13 AC8 1 G A 38 ? G A 38 . ? 1_555 ? 14 AC9 1 G A 47 ? G A 47 . ? 1_555 ? 15 AD1 6 C A 6 ? C A 6 . ? 1_555 ? 16 AD1 6 A A 7 ? A A 7 . ? 1_555 ? 17 AD1 6 A A 8 ? A A 8 . ? 1_555 ? 18 AD1 6 G A 47 ? G A 47 . ? 1_555 ? 19 AD1 6 G A 48 ? G A 48 . ? 1_555 ? 20 AD1 6 MN D . ? MN A 103 . ? 1_555 ? 21 AD2 2 G A 28 ? G A 28 . ? 1_555 ? 22 AD2 2 A A 30 ? A A 30 . ? 1_555 ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 "HO3'" _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 CBV _pdbx_validate_close_contact.auth_seq_id_1 3 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 P _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 U _pdbx_validate_close_contact.auth_seq_id_2 4 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 0.72 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 N3 A G 19 ? ? C4 A G 19 ? ? 1.306 1.350 -0.044 0.007 N 2 1 N3 A A 29 ? ? C4 A A 29 ? ? 1.306 1.344 -0.038 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N3 A G 1 ? ? C4 A G 1 ? ? C5 A G 1 ? ? 131.74 128.60 3.14 0.50 N 2 1 N3 A G 1 ? ? C4 A G 1 ? ? N9 A G 1 ? ? 122.00 126.00 -4.00 0.60 N 3 1 C8 A G 2 ? ? N9 A G 2 ? ? C4 A G 2 ? ? 109.15 106.40 2.75 0.40 N 4 1 N9 A G 2 ? ? C4 A G 2 ? ? C5 A G 2 ? ? 102.71 105.40 -2.69 0.40 N 5 1 C6 A A 7 ? ? N1 A A 7 ? ? C2 A A 7 ? ? 111.84 118.60 -6.76 0.60 N 6 1 C2 A A 7 ? ? N3 A A 7 ? ? C4 A A 7 ? ? 115.39 110.60 4.79 0.50 N 7 1 N3 A A 7 ? ? C4 A A 7 ? ? C5 A A 7 ? ? 121.19 126.80 -5.61 0.70 N 8 1 C5 A A 7 ? ? C6 A A 7 ? ? N1 A A 7 ? ? 122.65 117.70 4.95 0.50 N 9 1 N1 A A 7 ? ? C6 A A 7 ? ? N6 A A 7 ? ? 113.10 118.60 -5.50 0.60 N 10 1 N3 A C 9 ? ? C4 A C 9 ? ? C5 A C 9 ? ? 124.31 121.90 2.41 0.40 N 11 1 "O5'" A A 11 ? ? P A A 11 ? ? OP1 A A 11 ? ? 118.71 110.70 8.01 1.20 N 12 1 "O5'" A C 14 ? ? P A C 14 ? ? OP2 A C 14 ? ? 99.01 105.70 -6.69 0.90 N 13 1 C2 A C 14 ? ? N3 A C 14 ? ? C4 A C 14 ? ? 116.38 119.90 -3.52 0.50 N 14 1 N3 A C 14 ? ? C4 A C 14 ? ? C5 A C 14 ? ? 124.33 121.90 2.43 0.40 N 15 1 C5 A C 14 ? ? C6 A C 14 ? ? N1 A C 14 ? ? 117.07 121.00 -3.93 0.50 N 16 1 N1 A C 15 ? ? C2 A C 15 ? ? O2 A C 15 ? ? 123.66 118.90 4.76 0.60 N 17 1 N3 A C 15 ? ? C2 A C 15 ? ? O2 A C 15 ? ? 116.78 121.90 -5.12 0.70 N 18 1 C2 A G 16 ? ? N3 A G 16 ? ? C4 A G 16 ? ? 115.30 111.90 3.40 0.50 N 19 1 N1 A A 18 ? ? C6 A A 18 ? ? N6 A A 18 ? ? 122.30 118.60 3.70 0.60 N 20 1 N3 A G 19 ? ? C4 A G 19 ? ? N9 A G 19 ? ? 121.46 126.00 -4.54 0.60 N 21 1 N1 A A 29 ? ? C6 A A 29 ? ? N6 A A 29 ? ? 114.73 118.60 -3.87 0.60 N 22 1 "O5'" A A 30 ? ? P A A 30 ? ? OP1 A A 30 ? ? 118.14 110.70 7.44 1.20 N 23 1 C2 A G 36 ? ? N3 A G 36 ? ? C4 A G 36 ? ? 115.55 111.90 3.65 0.50 N 24 1 C5 A G 36 ? ? C6 A G 36 ? ? N1 A G 36 ? ? 114.85 111.50 3.35 0.50 N 25 1 C5 A G 38 ? ? C6 A G 38 ? ? N1 A G 38 ? ? 114.71 111.50 3.21 0.50 N 26 1 C5 A A 39 ? ? C6 A A 39 ? ? N1 A A 39 ? ? 120.92 117.70 3.22 0.50 N 27 1 N1 A A 39 ? ? C6 A A 39 ? ? N6 A A 39 ? ? 112.97 118.60 -5.63 0.60 N 28 1 C6 A A 40 ? ? C5 A A 40 ? ? N7 A A 40 ? ? 136.65 132.30 4.35 0.70 N 29 1 N1 A A 40 ? ? C6 A A 40 ? ? N6 A A 40 ? ? 111.88 118.60 -6.72 0.60 N 30 1 C6 A U 41 ? ? N1 A U 41 ? ? C2 A U 41 ? ? 124.64 121.00 3.64 0.60 N 31 1 C5 A U 41 ? ? C6 A U 41 ? ? N1 A U 41 ? ? 118.74 122.70 -3.96 0.50 N 32 1 C6 A C 42 ? ? N1 A C 42 ? ? C2 A C 42 ? ? 117.54 120.30 -2.76 0.40 N 33 1 N3 A C 42 ? ? C4 A C 42 ? ? C5 A C 42 ? ? 118.20 121.90 -3.70 0.40 N 34 1 C4 A C 45 ? ? C5 A C 45 ? ? C6 A C 45 ? ? 120.58 117.40 3.18 0.50 N 35 1 C5 A G 48 ? ? C6 A G 48 ? ? N1 A G 48 ? ? 107.38 111.50 -4.12 0.50 N 36 1 N1 A G 48 ? ? C6 A G 48 ? ? O6 A G 48 ? ? 125.20 119.90 5.30 0.60 N # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 x,-y,-z 3 -x,y,-z 4 -x,-y,z 5 x+1/2,y+1/2,z+1/2 6 x+1/2,-y+1/2,-z+1/2 7 -x+1/2,y+1/2,-z+1/2 8 -x+1/2,-y+1/2,z+1/2 # _pdbx_entry_details.entry_id 6TFH _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CBV O3P O N N 73 CBV P P N N 74 CBV O1P O N N 75 CBV O2P O N N 76 CBV "O5'" O N N 77 CBV "C5'" C N N 78 CBV "C4'" C N R 79 CBV "O4'" O N N 80 CBV "C3'" C N S 81 CBV "O3'" O N N 82 CBV "C2'" C N R 83 CBV "O2'" O N N 84 CBV "C1'" C N R 85 CBV N1 N N N 86 CBV C2 C N N 87 CBV O2 O N N 88 CBV N3 N N N 89 CBV C4 C N N 90 CBV N4 N N N 91 CBV C5 C N N 92 CBV C6 C N N 93 CBV BR BR N N 94 CBV HO3P H N N 95 CBV HO1P H N N 96 CBV "H5'1" H N N 97 CBV "H5'2" H N N 98 CBV "H4'" H N N 99 CBV "H3'" H N N 100 CBV "HO3'" H N N 101 CBV "H2'" H N N 102 CBV "HO2'" H N N 103 CBV "H1'" H N N 104 CBV HN41 H N N 105 CBV HN42 H N N 106 CBV H6 H N N 107 G OP3 O N N 108 G P P N N 109 G OP1 O N N 110 G OP2 O N N 111 G "O5'" O N N 112 G "C5'" C N N 113 G "C4'" C N R 114 G "O4'" O N N 115 G "C3'" C N S 116 G "O3'" O N N 117 G "C2'" C N R 118 G "O2'" O N N 119 G "C1'" C N R 120 G N9 N Y N 121 G C8 C Y N 122 G N7 N Y N 123 G C5 C Y N 124 G C6 C N N 125 G O6 O N N 126 G N1 N N N 127 G C2 C N N 128 G N2 N N N 129 G N3 N N N 130 G C4 C Y N 131 G HOP3 H N N 132 G HOP2 H N N 133 G "H5'" H N N 134 G "H5''" H N N 135 G "H4'" H N N 136 G "H3'" H N N 137 G "HO3'" H N N 138 G "H2'" H N N 139 G "HO2'" H N N 140 G "H1'" H N N 141 G H8 H N N 142 G H1 H N N 143 G H21 H N N 144 G H22 H N N 145 MN MN MN N N 146 NA NA NA N N 147 NAD PA P N S 148 NAD O1A O N N 149 NAD O2A O N N 150 NAD O5B O N N 151 NAD C5B C N N 152 NAD C4B C N R 153 NAD O4B O N N 154 NAD C3B C N S 155 NAD O3B O N N 156 NAD C2B C N R 157 NAD O2B O N N 158 NAD C1B C N R 159 NAD N9A N Y N 160 NAD C8A C Y N 161 NAD N7A N Y N 162 NAD C5A C Y N 163 NAD C6A C Y N 164 NAD N6A N N N 165 NAD N1A N Y N 166 NAD C2A C Y N 167 NAD N3A N Y N 168 NAD C4A C Y N 169 NAD O3 O N N 170 NAD PN P N N 171 NAD O1N O N N 172 NAD O2N O N N 173 NAD O5D O N N 174 NAD C5D C N N 175 NAD C4D C N R 176 NAD O4D O N N 177 NAD C3D C N S 178 NAD O3D O N N 179 NAD C2D C N R 180 NAD O2D O N N 181 NAD C1D C N R 182 NAD N1N N Y N 183 NAD C2N C Y N 184 NAD C3N C Y N 185 NAD C7N C N N 186 NAD O7N O N N 187 NAD N7N N N N 188 NAD C4N C Y N 189 NAD C5N C Y N 190 NAD C6N C Y N 191 NAD HOA2 H N N 192 NAD H51A H N N 193 NAD H52A H N N 194 NAD H4B H N N 195 NAD H3B H N N 196 NAD HO3A H N N 197 NAD H2B H N N 198 NAD HO2A H N N 199 NAD H1B H N N 200 NAD H8A H N N 201 NAD H61A H N N 202 NAD H62A H N N 203 NAD H2A H N N 204 NAD H51N H N N 205 NAD H52N H N N 206 NAD H4D H N N 207 NAD H3D H N N 208 NAD HO3N H N N 209 NAD H2D H N N 210 NAD HO2N H N N 211 NAD H1D H N N 212 NAD H2N H N N 213 NAD H71N H N N 214 NAD H72N H N N 215 NAD H4N H N N 216 NAD H5N H N N 217 NAD H6N H N N 218 U OP3 O N N 219 U P P N N 220 U OP1 O N N 221 U OP2 O N N 222 U "O5'" O N N 223 U "C5'" C N N 224 U "C4'" C N R 225 U "O4'" O N N 226 U "C3'" C N S 227 U "O3'" O N N 228 U "C2'" C N R 229 U "O2'" O N N 230 U "C1'" C N R 231 U N1 N N N 232 U C2 C N N 233 U O2 O N N 234 U N3 N N N 235 U C4 C N N 236 U O4 O N N 237 U C5 C N N 238 U C6 C N N 239 U HOP3 H N N 240 U HOP2 H N N 241 U "H5'" H N N 242 U "H5''" H N N 243 U "H4'" H N N 244 U "H3'" H N N 245 U "HO3'" H N N 246 U "H2'" H N N 247 U "HO2'" H N N 248 U "H1'" H N N 249 U H3 H N N 250 U H5 H N N 251 U H6 H N N 252 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 CBV O3P P sing N N 76 CBV O3P HO3P sing N N 77 CBV P O1P sing N N 78 CBV P O2P doub N N 79 CBV P "O5'" sing N N 80 CBV O1P HO1P sing N N 81 CBV "O5'" "C5'" sing N N 82 CBV "C5'" "C4'" sing N N 83 CBV "C5'" "H5'1" sing N N 84 CBV "C5'" "H5'2" sing N N 85 CBV "C4'" "O4'" sing N N 86 CBV "C4'" "C3'" sing N N 87 CBV "C4'" "H4'" sing N N 88 CBV "O4'" "C1'" sing N N 89 CBV "C3'" "O3'" sing N N 90 CBV "C3'" "C2'" sing N N 91 CBV "C3'" "H3'" sing N N 92 CBV "O3'" "HO3'" sing N N 93 CBV "C2'" "O2'" sing N N 94 CBV "C2'" "C1'" sing N N 95 CBV "C2'" "H2'" sing N N 96 CBV "O2'" "HO2'" sing N N 97 CBV "C1'" N1 sing N N 98 CBV "C1'" "H1'" sing N N 99 CBV N1 C2 sing N N 100 CBV N1 C6 sing N N 101 CBV C2 O2 doub N N 102 CBV C2 N3 sing N N 103 CBV N3 C4 doub N N 104 CBV C4 N4 sing N N 105 CBV C4 C5 sing N N 106 CBV N4 HN41 sing N N 107 CBV N4 HN42 sing N N 108 CBV C5 C6 doub N N 109 CBV C5 BR sing N N 110 CBV C6 H6 sing N N 111 G OP3 P sing N N 112 G OP3 HOP3 sing N N 113 G P OP1 doub N N 114 G P OP2 sing N N 115 G P "O5'" sing N N 116 G OP2 HOP2 sing N N 117 G "O5'" "C5'" sing N N 118 G "C5'" "C4'" sing N N 119 G "C5'" "H5'" sing N N 120 G "C5'" "H5''" sing N N 121 G "C4'" "O4'" sing N N 122 G "C4'" "C3'" sing N N 123 G "C4'" "H4'" sing N N 124 G "O4'" "C1'" sing N N 125 G "C3'" "O3'" sing N N 126 G "C3'" "C2'" sing N N 127 G "C3'" "H3'" sing N N 128 G "O3'" "HO3'" sing N N 129 G "C2'" "O2'" sing N N 130 G "C2'" "C1'" sing N N 131 G "C2'" "H2'" sing N N 132 G "O2'" "HO2'" sing N N 133 G "C1'" N9 sing N N 134 G "C1'" "H1'" sing N N 135 G N9 C8 sing Y N 136 G N9 C4 sing Y N 137 G C8 N7 doub Y N 138 G C8 H8 sing N N 139 G N7 C5 sing Y N 140 G C5 C6 sing N N 141 G C5 C4 doub Y N 142 G C6 O6 doub N N 143 G C6 N1 sing N N 144 G N1 C2 sing N N 145 G N1 H1 sing N N 146 G C2 N2 sing N N 147 G C2 N3 doub N N 148 G N2 H21 sing N N 149 G N2 H22 sing N N 150 G N3 C4 sing N N 151 NAD PA O1A doub N N 152 NAD PA O2A sing N N 153 NAD PA O5B sing N N 154 NAD PA O3 sing N N 155 NAD O2A HOA2 sing N N 156 NAD O5B C5B sing N N 157 NAD C5B C4B sing N N 158 NAD C5B H51A sing N N 159 NAD C5B H52A sing N N 160 NAD C4B O4B sing N N 161 NAD C4B C3B sing N N 162 NAD C4B H4B sing N N 163 NAD O4B C1B sing N N 164 NAD C3B O3B sing N N 165 NAD C3B C2B sing N N 166 NAD C3B H3B sing N N 167 NAD O3B HO3A sing N N 168 NAD C2B O2B sing N N 169 NAD C2B C1B sing N N 170 NAD C2B H2B sing N N 171 NAD O2B HO2A sing N N 172 NAD C1B N9A sing N N 173 NAD C1B H1B sing N N 174 NAD N9A C8A sing Y N 175 NAD N9A C4A sing Y N 176 NAD C8A N7A doub Y N 177 NAD C8A H8A sing N N 178 NAD N7A C5A sing Y N 179 NAD C5A C6A sing Y N 180 NAD C5A C4A doub Y N 181 NAD C6A N6A sing N N 182 NAD C6A N1A doub Y N 183 NAD N6A H61A sing N N 184 NAD N6A H62A sing N N 185 NAD N1A C2A sing Y N 186 NAD C2A N3A doub Y N 187 NAD C2A H2A sing N N 188 NAD N3A C4A sing Y N 189 NAD O3 PN sing N N 190 NAD PN O1N doub N N 191 NAD PN O2N sing N N 192 NAD PN O5D sing N N 193 NAD O5D C5D sing N N 194 NAD C5D C4D sing N N 195 NAD C5D H51N sing N N 196 NAD C5D H52N sing N N 197 NAD C4D O4D sing N N 198 NAD C4D C3D sing N N 199 NAD C4D H4D sing N N 200 NAD O4D C1D sing N N 201 NAD C3D O3D sing N N 202 NAD C3D C2D sing N N 203 NAD C3D H3D sing N N 204 NAD O3D HO3N sing N N 205 NAD C2D O2D sing N N 206 NAD C2D C1D sing N N 207 NAD C2D H2D sing N N 208 NAD O2D HO2N sing N N 209 NAD C1D N1N sing N N 210 NAD C1D H1D sing N N 211 NAD N1N C2N sing Y N 212 NAD N1N C6N doub Y N 213 NAD C2N C3N doub Y N 214 NAD C2N H2N sing N N 215 NAD C3N C7N sing N N 216 NAD C3N C4N sing Y N 217 NAD C7N O7N doub N N 218 NAD C7N N7N sing N N 219 NAD N7N H71N sing N N 220 NAD N7N H72N sing N N 221 NAD C4N C5N doub Y N 222 NAD C4N H4N sing N N 223 NAD C5N C6N sing Y N 224 NAD C5N H5N sing N N 225 NAD C6N H6N sing N N 226 U OP3 P sing N N 227 U OP3 HOP3 sing N N 228 U P OP1 doub N N 229 U P OP2 sing N N 230 U P "O5'" sing N N 231 U OP2 HOP2 sing N N 232 U "O5'" "C5'" sing N N 233 U "C5'" "C4'" sing N N 234 U "C5'" "H5'" sing N N 235 U "C5'" "H5''" sing N N 236 U "C4'" "O4'" sing N N 237 U "C4'" "C3'" sing N N 238 U "C4'" "H4'" sing N N 239 U "O4'" "C1'" sing N N 240 U "C3'" "O3'" sing N N 241 U "C3'" "C2'" sing N N 242 U "C3'" "H3'" sing N N 243 U "O3'" "HO3'" sing N N 244 U "C2'" "O2'" sing N N 245 U "C2'" "C1'" sing N N 246 U "C2'" "H2'" sing N N 247 U "O2'" "HO2'" sing N N 248 U "C1'" N1 sing N N 249 U "C1'" "H1'" sing N N 250 U N1 C2 sing N N 251 U N1 C6 sing N N 252 U C2 O2 doub N N 253 U C2 N3 sing N N 254 U N3 C4 sing N N 255 U N3 H3 sing N N 256 U C4 O4 doub N N 257 U C4 C5 sing N N 258 U C5 C6 doub N N 259 U C5 H5 sing N N 260 U C6 H6 sing N N 261 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6TFH 'double helix' 6TFH 'a-form double helix' 6TFH tetraloop 6TFH 'bulge loop' 6TFH 'mismatched base pair' 6TFH 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 52 1_555 -0.104 0.017 0.170 0.911 0.903 0.727 1 A_G1:C52_A A 1 ? A 52 ? 19 1 1 A G 2 1_555 A C 51 1_555 -0.342 -0.143 -0.272 0.584 -4.549 -1.844 2 A_G2:C51_A A 2 ? A 51 ? 19 1 1 A CBV 3 1_555 A G 50 1_555 -1.185 0.212 -0.156 5.145 -10.431 3.343 3 A_CBV3:G50_A A 3 ? A 50 ? 19 1 1 A U 4 1_555 A A 49 1_555 -1.164 0.141 0.221 -0.967 -9.143 1.941 4 A_U4:A49_A A 4 ? A 49 ? 20 1 1 A U 5 1_555 A G 48 1_555 1.764 -0.273 0.225 1.260 -9.232 4.133 5 A_U5:G48_A A 5 ? A 48 ? 28 1 1 A C 6 1_555 A G 47 1_555 0.264 -0.135 0.461 11.018 -17.285 4.040 6 A_C6:G47_A A 6 ? A 47 ? 19 1 1 A A 7 1_555 A U 46 1_555 0.263 0.122 0.678 2.886 -7.059 -3.116 7 A_A7:U46_A A 7 ? A 46 ? 20 1 1 A G 16 1_555 A C 45 1_555 -0.063 -0.054 -0.535 -12.382 -10.573 2.082 8 A_G16:C45_A A 16 ? A 45 ? 19 1 1 A U 17 1_555 A A 44 1_555 0.036 -0.024 0.170 -9.609 -4.913 -0.581 9 A_U17:A44_A A 17 ? A 44 ? 20 1 1 A A 18 1_555 A U 43 1_555 0.224 0.149 -0.333 -9.111 -9.547 1.900 10 A_A18:U43_A A 18 ? A 43 ? 20 1 1 A G 19 1_555 A C 42 1_555 0.727 0.258 0.304 0.404 -15.759 8.308 11 A_G19:C42_A A 19 ? A 42 ? 19 1 1 A G 20 1_555 A U 41 1_555 -2.326 -0.739 -0.075 5.630 -4.012 -4.191 12 A_G20:U41_A A 20 ? A 41 ? 28 1 1 A U 21 1_555 A A 40 1_555 -0.141 0.002 -0.049 -1.105 2.828 -0.694 13 A_U21:A40_A A 21 ? A 40 ? 20 1 1 A U 22 1_555 A A 39 1_555 0.023 -0.073 0.349 1.801 -0.072 0.106 14 A_U22:A39_A A 22 ? A 39 ? 20 1 1 A G 23 1_555 A C 37 1_555 0.158 -0.053 0.538 12.526 -5.425 -1.929 15 A_G23:C37_A A 23 ? A 37 ? 19 1 1 A G 24 1_555 A A 35 1_555 -0.681 1.831 0.148 8.694 -6.825 -24.770 16 A_G24:A35_A A 24 ? A 35 ? 8 1 1 A G 25 1_555 A C 34 1_555 -0.071 -0.134 0.418 6.900 -6.574 -3.188 17 A_G25:C34_A A 25 ? A 34 ? 19 1 1 A C 26 1_555 A G 33 1_555 0.192 -0.046 0.065 5.711 -3.835 1.199 18 A_C26:G33_A A 26 ? A 33 ? 19 1 1 A C 27 1_555 A G 32 1_555 0.136 -0.107 0.076 1.702 -3.757 1.912 19 A_C27:G32_A A 27 ? A 32 ? 19 1 1 A G 28 1_555 A A 31 1_555 7.296 -4.456 0.956 13.289 -11.394 -13.451 20 A_G28:A31_A A 28 ? A 31 ? ? ? 1 A C 13 1_555 A G 38 1_555 0.094 -0.147 -0.254 8.327 -3.919 1.174 21 A_C13:G38_A A 13 ? A 38 ? 19 1 1 A C 14 1_555 A G 36 1_555 0.141 -0.075 0.003 1.516 1.488 1.581 22 A_C14:G36_A A 14 ? A 36 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 52 1_555 A G 2 1_555 A C 51 1_555 -0.467 -1.498 3.223 1.799 9.252 32.688 -3.926 1.063 2.683 16.028 -3.117 33.984 1 AA_G1G2:C51C52_AA A 1 ? A 52 ? A 2 ? A 51 ? 1 A G 2 1_555 A C 51 1_555 A CBV 3 1_555 A G 50 1_555 0.242 -1.669 3.152 -1.337 5.017 27.303 -4.582 -0.799 2.792 10.507 2.801 27.783 2 AA_G2CBV3:G50C51_AA A 2 ? A 51 ? A 3 ? A 50 ? 1 A CBV 3 1_555 A G 50 1_555 A U 4 1_555 A A 49 1_555 0.032 -1.881 3.468 -4.802 6.216 26.952 -5.341 -1.196 2.920 12.990 10.036 28.053 3 AA_CBV3U4:A49G50_AA A 3 ? A 50 ? A 4 ? A 49 ? 1 A U 4 1_555 A A 49 1_555 A U 5 1_555 A G 48 1_555 0.085 -0.924 3.216 0.950 2.830 47.515 -1.366 -0.032 3.160 3.508 -1.178 47.604 4 AA_U4U5:G48A49_AA A 4 ? A 49 ? A 5 ? A 48 ? 1 A U 5 1_555 A G 48 1_555 A C 6 1_555 A G 47 1_555 0.279 -2.460 2.600 0.464 8.043 21.377 -8.117 -0.596 1.586 20.758 -1.197 22.828 5 AA_U5C6:G47G48_AA A 5 ? A 48 ? A 6 ? A 47 ? 1 A C 6 1_555 A G 47 1_555 A A 7 1_555 A U 46 1_555 -1.254 -0.816 3.080 -2.614 14.659 39.523 -2.520 1.498 2.699 20.803 3.710 42.130 6 AA_C6A7:U46G47_AA A 6 ? A 47 ? A 7 ? A 46 ? 1 A A 7 1_555 A U 46 1_555 A G 16 1_555 A C 45 1_555 0.623 -2.750 3.612 9.218 12.826 30.085 -6.722 0.373 2.365 22.838 -16.413 33.894 7 AA_A7G16:C45U46_AA A 7 ? A 46 ? A 16 ? A 45 ? 1 A G 16 1_555 A C 45 1_555 A U 17 1_555 A A 44 1_555 -1.005 -1.709 3.160 -7.594 2.726 35.714 -3.091 0.578 3.165 4.377 12.191 36.585 8 AA_G16U17:A44C45_AA A 16 ? A 45 ? A 17 ? A 44 ? 1 A U 17 1_555 A A 44 1_555 A A 18 1_555 A U 43 1_555 -0.179 -0.948 3.244 4.118 7.830 29.604 -3.230 1.099 2.856 14.909 -7.841 30.870 9 AA_U17A18:U43A44_AA A 17 ? A 44 ? A 18 ? A 43 ? 1 A A 18 1_555 A U 43 1_555 A G 19 1_555 A C 42 1_555 0.836 -1.169 3.264 0.365 -0.247 30.168 -2.195 -1.532 3.282 -0.474 -0.701 30.171 10 AA_A18G19:C42U43_AA A 18 ? A 43 ? A 19 ? A 42 ? 1 A G 19 1_555 A C 42 1_555 A G 20 1_555 A U 41 1_555 -0.060 -2.551 2.817 0.426 10.332 18.673 -9.704 0.279 1.244 29.126 -1.201 21.323 11 AA_G19G20:U41C42_AA A 19 ? A 42 ? A 20 ? A 41 ? 1 A G 20 1_555 A U 41 1_555 A U 21 1_555 A A 40 1_555 -0.324 -1.752 3.539 -3.065 8.223 40.363 -3.402 0.119 3.153 11.749 4.380 41.267 12 AA_G20U21:A40U41_AA A 20 ? A 41 ? A 21 ? A 40 ? 1 A U 21 1_555 A A 40 1_555 A U 22 1_555 A A 39 1_555 0.553 -1.321 3.187 -1.231 4.721 32.161 -3.137 -1.190 2.946 8.461 2.207 32.520 13 AA_U21U22:A39A40_AA A 21 ? A 40 ? A 22 ? A 39 ? 1 A U 22 1_555 A A 39 1_555 A G 23 1_555 A C 37 1_555 1.880 -0.929 2.735 3.989 6.480 43.175 -1.764 -2.200 2.730 8.725 -5.372 43.809 14 AA_U22G23:C37A39_AA A 22 ? A 39 ? A 23 ? A 37 ? 1 A G 23 1_555 A C 37 1_555 A G 24 1_555 A A 35 1_555 0.019 -4.403 3.128 -0.432 7.523 27.069 -10.451 -0.118 1.860 15.690 0.902 28.079 15 AA_G23G24:A35C37_AA A 23 ? A 37 ? A 24 ? A 35 ? 1 A G 24 1_555 A A 35 1_555 A G 25 1_555 A C 34 1_555 0.491 -1.864 3.214 -9.142 3.264 33.862 -3.540 -2.091 2.804 5.465 15.310 35.187 16 AA_G24G25:C34A35_AA A 24 ? A 35 ? A 25 ? A 34 ? 1 A G 25 1_555 A C 34 1_555 A C 26 1_555 A G 33 1_555 0.473 -1.868 3.284 0.818 1.698 38.395 -3.047 -0.617 3.210 2.580 -1.243 38.440 17 AA_G25C26:G33C34_AA A 25 ? A 34 ? A 26 ? A 33 ? 1 A C 26 1_555 A G 33 1_555 A C 27 1_555 A G 32 1_555 0.518 -1.540 3.302 1.529 6.183 30.573 -3.999 -0.682 2.962 11.568 -2.860 31.213 18 AA_C26C27:G32G33_AA A 26 ? A 33 ? A 27 ? A 32 ? 1 A C 27 1_555 A G 32 1_555 A G 28 1_555 A A 31 1_555 -2.197 -1.042 3.109 -2.201 7.579 49.238 -1.758 2.456 3.017 9.029 2.622 49.827 19 AA_C27G28:A31G32_AA A 27 ? A 32 ? A 28 ? A 31 ? 1 A C 13 1_555 A G 38 1_555 A C 14 1_555 A G 36 1_555 2.110 -1.852 3.365 -3.390 6.890 50.968 -2.588 -2.653 2.971 7.955 3.914 51.505 20 AA_C13C14:G36G38_AA A 13 ? A 38 ? A 14 ? A 36 ? # _pdbx_audit_support.funding_organization 'Cancer Research UK' _pdbx_audit_support.country 'United Kingdom' _pdbx_audit_support.grant_number A18604 _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id NAD _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id NAD _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 6TF0 _pdbx_initial_refinement_model.details ? # _space_group.name_H-M_alt 'I 2 2 2' _space_group.name_Hall 'I 2 2' _space_group.IT_number 23 _space_group.crystal_system orthorhombic _space_group.id 1 # _atom_sites.entry_id 6TFH _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.017564 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.017135 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.005155 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source BR ? ? 34.81562 ? ? ? 6.45270 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? H ? ? 0.99627 ? ? ? 14.84254 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? MN ? ? 20.23591 4.67902 ? ? 2.76514 44.01191 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? NA ? ? 9.38062 1.54875 ? ? 3.38349 72.32734 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O1- ? ? 5.12366 3.84317 ? ? 3.49406 27.47979 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_